Voulme 5 Number 6 - Supplementary Issue - HealthMED Journal (2011) moreVoulme 5 Number 6 - Supplementary Issue of HealthMED Journal (2011) |
1025 views |
Volume 5 / Number 6 - Suppl. 1 / 2011
EDITORIAL BOARD
HealthMED
Journal of Society for development in new net environment in B&H Editor-in-chief Execute Editor Associate Editor Editorial assistant Technical editor Mensura Kudumovic Mostafa Nejati Azra Kudumovic Jasmin Musanovic Eldin Huremovic
Altuntaş EE, Balaban H, Uysal İÖ, Akın PZ
Sadržaj / Table of Contents
The Effect of Pentoxiphylline, a non-specific phospodiesterase inhibitor, on Angiogenesis in Chicken Chorioallantoic Membrane (CAM) Model .................. 1841 The Backgrounds, consequences, and future of the integration of Medical Education and Health Service Delivery System ............................................... 1847
Members Paul Andrew Bourne (Jamaica) Xiuxiang Liu (China) Nicolas Zdanowicz (Belgique) Farah Mustafa (Pakistan) Yann Meunier (USA) Forouzan Bayat Nejad (Iran) Suresh Vatsyayann (New Zealand) Maizirwan Mel (Malaysia) Budimka Novakovic (Serbia) Diaa Eldin Abdel Hameed Mohamad (Egypt) Zmago Turk (Slovenia) Bakir Mehic (Bosnia & Herzegovina) Farid Ljuca (Bosnia & Herzegovina) Sukrija Zvizdic (Bosnia & Herzegovina) Damir Marjanovic (Bosnia & Herzegovina) Emina Nakas-Icindic (Bosnia & Herzegovina) Aida Hasanovic(Bosnia & Herzegovina) Bozo Banjanin (Bosnia & Herzegovina)
Sogand Turani, Ali-Akbar Haghdoost, Mohammad-Reza Maleki, Hamid Ravaghi, Reza Dehnavieh Tijang, Somayeh Noori Hekmat
The effect of Cyclosporine-a on the renal vascularresponse to ANG II and Adrenegic Agonist in Sprague-Dawley rat ................................... 1857
Tan Yong Chia, Munavvar A Sattar, Mohammed H Abdulla, Edward J Johns
Low-cost tools for microbial quality assessment of drinking water in South Africa ................................... 1868
Luyt, C. D., Muller W. J., Tandlich, R.
Chaos and order: disrupted lives by depression ....... 1878
Modesto Leite Rolim Neto, Alberto Olavo Advincula Reis, Irineide Beserra Braga, Cícero Hedilberto Filguêiras Macêdo
The Frequency of MRSA carriers in Health care workers in Gorgan, North of Iran .............................. 1885
Somayeh Rahimi Alang, Abolfazl Amini, Fatemeh Cheraghali, Alijan Tabbaraei, Ezzat Allah Ghaemi
Address of the Editorial Board
Sarajevo, Bolnicka BB phone/fax 00387 33 956 080 healthmedjournal@gmail.com http://www.healthmedjournal.com DRUNPP, Sarajevo Number 6 - Suppl. 1, 2011 1840-2291
Comparison of the Automated Cell Counter and Manual Method for the Assessment of Dialysis Fluids in Peritoneal Dialysis Patients ......................... 1891
Yasemin Usul Soyoral, Huseyin Begenik, Mehmet Naci Aldemir, Ali Irfan Baran, Habib Emre, Mustafa Kasım Karahocagil, Reha Erkoc
Published by Volume 5 ISSN
HealthMED journal with impact factor indexed in:
- Thomson Reuters ISI web of Science, - Science Citation Index-Expanded, - Scopus, - EBSCO Academic Search Premier, - Index Copernicus, - getCITED, and etc.
Excessive television viewing increases BMI, yet not a risk factor for childhood obesity or thinness: A cross sectional study on Thai school children ........ 1895
Lakkana Rerksuppaphol, Sanguansak Rerksuppaphol
Turkish Mothers’ Use of Non-Pharmacological Methods for Relieving Children’s Postoperative Pain ................................................................................. 1902
Mehtap Cürcani, Ayda Çelebioğlu, Sibel Küçükoğlu
Sadržaj / Table of Contents
An economic evaluation of China’s new cooperative Activities to prevent common types of maltreatment medical scheme on TB health care: a case study in of Slovenian nursing home residents: the nursing five counties in Ningxia province, China ................... 1909 staff viewpoint ............................................................... 2000
Peng Kong, Meng Qingyue, Bian Xufeng Ana Habjanic, Satu Elo, Arja Isola, Dusanka Micetic-Turk
The Effect of Moderate Endurance Training on V-Y fasciocutaneous sliding flap in the surgical Cardioprotective Molecule Adaptations .................... 1912 treatment of invasive vulvar cancer ........................... 2010
Zong-Yan Cai, Cheng-Chen Hsu, Mei-Chich Hsu, Mao-Shung Huang, Chao-Pin Yang, Yung-Yu Tsai, Borcherng Su
Srdjan Djurdjevic, Aleksandar Curcic, Mirjana Bogavac, Ljiljana Ivanovic
Measuring health care quality with the Servqual method: Investigation of the work accidents based on the a comparison in public and private hospitals ........... 1921 statement of the nurses at the hospital in Turkey ..... 2015
Oğuz Işık, Dilaver Tengilimoğlu, Mahmut Akbolat Ceylanım Ceylan, Ayşe Beşer
Economic Costs of Domestic Violence: A Community A Novel model for inference of gene regulatory Study in South Africa ................................................... 1931 networks ........................................................................ 2024
Koustuv Dalal, Suraya Dawad Blagoj Ristevski, Suzana Loskovska
Hepatitis B Prevention for the Nurses - A Review Erosive nature of dental defect - case report ............. 2034 Article ............................................................................. 1941 Ivana Stojsin, Tatjana Brkanic, Duska Blagojevic, Aniko Ferenc
Mitra Zandi, Seyed-Moayed Alavian, Kamran Bagheri-Lankarani
Retrospective Analysis of Intoxication Patients Periodontal condition of pregnant women assessed Admitted to Intensive Care Unit: Evidence Based by CPITN and the role of the nurses according to Management vs Personal Experience ........................ 2039 the needs of treatment .................................................. 1951 Cem Ertan, Ender Gedik, Neslihan Yucel, F. Sinem Akgun, Sibel
Ayfer Tezel, Adnan Tezel Aslan, Türkan Togal, M. Ozcan Ersoy
Liver slices are the optimal model for mimicking Vascular access for hemodialysis: an experience report .............................................................................. 1959 apoptosis activation in vitro ........................................ 2047
Guilherme Centofanti, Eliane Y. Fujii, Rafael N. Cavalcante, Edgar Bortolini, Luiz Carlos de Abreu, Vitor E. Valenti, Adilson C. Pires, Hugo Macedo Junior, Yumiko R. Yamazaki, Soraya G. Audi, Jose R. Cisternas, Joao R. Breda, Valdelias X. Pereira, Edson N. Fujiki, João A. Correa Irina Milisav, Dusan Suput
Automatic identification breast cancer using multiresolution algorithm ............................................ 2051
Marina Djokovic, Aleksandar Peulic, Nenad Filipovic
Comparative Polymerase Chain Reaction Use for Deaths in Hotels ............................................................ 2065 Tuberculosis in Taipei, Taiwan: 2003–2008 ............... 1963 Muhammet Can, Riza Yilmaz, Isil Pakis
Yung-Fong Yen, Pesus Chou, Chung-Yeh Deng
Digital radiography in root canal working length Study of antibiotic resistant H. pylori isolated from determination ................................................................ 2074 Iranian patients during 2009-2010 ............................. 1970 Tatjana Brkanic, Ivana Stojsin, Karolina Vukoje, Duska
Sara Sayadi, Mojtaba Darboue, Hosein Dabiri, Leila Shokrzadeh, Blagojevic, Vladan Osatovic Tabasom Mirzaee, Masoud Alebouyeh, Dariush Mirsatari, Homayoun Zojaji, Ehsan Nazemalhoseini, Mohammad Reza Zali Quality Of Life Of Patients With Tuberculosis ......... 2081 Mehtap Tan, Hatice Polat
Clinical prediction of pediatric dengue virus infection in Taiwan-a Rasch scaling approach .......................... 1977 Association between bacterial Vaginosis and Wen-Pin Lai, Tsair-Wei Chien, Hung-Jung Lin, Wei-Chih Kan, precancerous changes of the Cervix ........................... 2088
Shih-Bin Su
The effects of highly concentrated oxygen flow rate changes on the blood oxygen saturation and heart Relationship between emotional intelligence and rate of young and elderly subjects .............................. 1986 leadership behavior of turkish male nursing Jae-Hoon Jun, Mi-Hyun Choi, Jeong-Han Yi, Soon-Cheol Chung students .......................................................................... 2097 Effects of magnetic stimulation of cervical spinal cord on main cerebral arterial blood flow ................. 1993
Ünal Özüm, Hatice Balaban, Hande Yapışlar, Suat Topaktaş Serap Altuntas, Rahsan Akyıl
Milena Misic, Gordana Ranđelovic, Branislava Kocic, Ljiljana Suvajdzic, Sadeta Hamzic, Sukrija Zvizdic, Marko Tomic
Sadržaj / Table of Contents
Semiquantitative radiological and clinical assessment of the restoration of alveolar bone defects treated with biphasic calcium phosphate/poly-dl-lactide-co glycolide composite ....................................................... 2105
Dragan Petrovic, Zorica Ajdukovic, Sladjana Petrovic, Nenad Ignjatovic, Stevo Najman, Ivica Vuckovic
Retroperitoneal lymphadenectomy following chemotherapy for testicular cancer – analysis of postoperative complications according to Clavien-Dindo classification ........................................ 2186
Dimitrije Jeremic, Sasa Vojinova, Ivan Levakov, Goran Marusic
Assessment of life quality in patients with Exposıng sıtuatıons mobbıng of the nurses ın Rheumatoid Arthritis ................................................... 2190 Turkey ............................................................................ 2115 Snezana Tomasevic-Todorovic, Ksenija Boskovic, Radmila
Zümrüt Akgün Şahin, Funda Kardaş Özdemir, Sevinç Köse
The first case report of serologically confirmed cat scratch disease of a boy in Serbia ......................... 2121 Does the patients with cervical infection and Marina Djordjevic-Spasic, Aleksandar Potkonjak, Bjanka Lako, symptoms of imminent preterm delivery has elevated Radoslava Doder, Grozdana Canak, Liljana Suvajdzic, Velimir serum levels of interferon gamma (IFN-γ) ................... 2196
Kostic
Matijevic, Cila Demesi-Drljan, Slobodan Pantelinac, Aleksandar Knezevic
Giant pulmonary artery aneurysm due to uncorrected atrial septal defect: evaluated by multidetector Secondary Lymphedema of the arm in malignant computed tomography ................................................. 2126 breast tumors and oncological rehabilitation ............ 2201
Enbiya Aksakal, Mecit Kantarcı, Hüseyin Şenocak
Mirjana Bogavac, Snezana Brkic, Dejan Celic, Aleksandra Novakov-Mikic, Tatjana Ilic, Zelimir Eric
History of surgical correction of Hypospadias .......... 2130
Biljana Lucic Prostran, Jan Varga, Branka Radojcic, Dragana Zivkovic
Svetlana Popovic-Petrovic, Sanja Tomic, Vasa Petrovic, Dragana Milutinovic
Causes and symptoms of contact sensitivity – a Vesna Damnjanovic, Vinka Filipovic, Slavica Cicvaric Kostic, Branka Novcic, Radmila Janicic two-decade review of research results of the allergy department of the clinic of dermatovenereology diseases in Novi Sad ...................................................... 2138 Analysis of the status of the functional abilities of Marina Jovanovic, Neda Mimica-Dukic, Silvija Brkic, Pal Boza, young football players using Conconi test ................. 2214
Aleksandra Petrovic, Djordjije Karadaglic, Ivan Mikov, Biljana Bozin, Goran Anackov Miroslav Smajic, Dusan Maric, Dejan Madic, Franja Fratric, Slavko Molnar, Jan Varga
Managers’ orientation of health care organization – comparison study of Serbia, Macedonia and Slovenia .......................................................................... 2206
Subdural Empyema associated with Orbital Assessing the differences in quality of life in patients Cellulitis and Petrositis ................................................ 2152 after acute neuroinfection ............................................ 2225
Aleksandra Stojadinovic, Nevenka Roncevic, Svetlana Kuzmanovic, Radoslava Doder, Ksenija Boskovic, Sandra Stefan Mikic, Marija Knezevic-Pogancev, Aleksandar Milojevic Matilda Vojnovic, Dragan Doder, Sinisa Sevic
Serum level of anti-müllerian hormone as predictor Polymorphism of Genes TNFα and LTα in First-Degree of ovarian response in IVF .......................................... 2158 Relatives Suffering from Sarcoidosis-Case report ...... 2233
Stevan V Milatovic, Vesna L Kopitovic, Djordje L Ilic, Aleksandra Tatjana Radjenovic Petkovic, Tatjana Pejcic, Tatjana Jevtovic M Trninic Pjevic, Artur L Bjelica, Srdjan P Djurdjevic Stoimenov, Desa Nastasijevic Borovac
Diagnostic scores in acute Appendicitis with prospective Effects of swimming training on body composition evaluation of Neoplanta score in pediatric patients ..... 2163 and bone mineral density of prepubertal boys ......... 2237
Branka Radojcic, Slobodan Grebeldinger, Tomislav Cigic, Igor Meljnikov, Nikola Radojcic Dejan Madic, Dusan Maric, Borislav Obradovic, Jelena Obradovic, Franja Fratric, Veselin Buncic, Boris Popovic, Dusanka Tumin, Jan Varga, Milan Pantovic
Good preoperative evaluation and preparation of Recommended INR Values for Performing disabled patients for dental procedures significantly reduce perioperative complications ............................ 2176 Oral-surgical Interventions ......................................... 2243
Biljana Draskovic, Anna Uram Benka, Gordana Turanjanin-Tomic, Naida Hadziabdic, Halid Sulejmanagic, Midhat Haracic, Rifka Rizvanbegovic, Vesna Basic, Nedim Sulejmanagic, Ziba Ljutovic Dejan Dimitrijevic, Danica Stanic
Antioxidant capacity in some medicinal plants Metatarsalgia caused with Osteoid Osteoma in active gymnast: case report .................................................... 2183 and fruits extracts ......................................................... 2252
Maric M.D, Djan I, Maric L.D, Madic D, Petkovic D, Velickovic S, Gajdobranski Dj Majda Srabovic, Melita Poljakovic, Zorica Hodzic, Bozo Banjanin, Mirzeta Saletovic, Cazim Salimovic, Ekrem Pehlic
Sadržaj / Table of Contents
Idiopathic venous thromboembolism and lung cancer .................................................................... 2258
Selma Arslanagic, Rusmir Arslanagic, Naima Arslanagic
Echocardiography prognostic parameters at dilatative cardiomyopathy - Case report ................... 2263
Omer Perva, Majla Cibo, Muhamed Spuzic
Identification of propionic acid methyl derivate as non-steroidal antirheumatic drug by infrared spectroscopy .................................................................. 2266
Ekrem Pehlic, Djulsa Bajramovic, Mirza Nuhanovic, Aida Sapcanin, Bozo Banjanin, Husein Nanic, Melita Poljakovic, Majda Srabovic, Cazim Salimovic
Maxillary Tuberosity Fracture as a Post-Operative Complication - Case study .......................................... 2272
Naida Hadziabdic, Sanja Komsic, Halid Sulejmanagic
Instructions for the authors........................................... 2279 Uputstvo za autore.......................................................... 2280
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The Effect of Pentoxiphylline, a nonspecific phospodiesterase inhibitor, on Angiogenesis in Chicken Chorioallantoic Membrane (CAM) Model
Altuntaş EE1, Balaban H2, Uysal İÖ1, Akın PZ3
1 2
3
Faculty of Medicine, University of Cumhuriyet, Department of Ear Nose and Throat Education and Research Hospital, Sivas City, Turkey, Faculty of Medicine, University of Cumhuriyet, Department Neurology Education and Research Hospital, Sivas City, Turkey Faculty of Medicine, University of Cumhuriyet, Department of Parasitology, Sivas City, Turkey.
Abstract Objectives: Based on a neovascularization study conducted using specific phosphodiesterase inhibitors in the literature, the aim of the present study was to answer the question “As specific phosphodiesterase inhibitors have positive or negative effects on angiogenesis, what kind of an effect does pentoxiphylline, which is a phosphodiesterase inhibitor, have on angiogenesis?” by using chorioallantoic membrane model. Material and Methods: In this study we investigated the effects of a vasodilating agent, Pentoxifylline (Trental® 300mg/15 ml, Sanofi aventis İlaçları Limited Şirketi®, Istanbul) on angiogenesis. Pentoxifylline was used in the form of soluble infusion. We studied the sequence of the vascular events after Pentoxifylline in the chicken chorioallantoic membrane at day 9 of development. Using stereoscopic microscope (Leica EZ4D), we monitored the regrowth of capillaries in the Pentoxifylline treated area. Results: Pentoxiphylline has no effect on angiogenesis in chicken chorioallantoic membrane model. Conclusion: According to our literature review, this is the first study using chicken chorioallantoic membrane model in studying effect of Pentoxifylline on angiogenesis. Although Pentoxifylline has been reported to have no antiangiogenic effect in some studies using different in vivo models, our study has shown that Pentoxifylline
does not have any effect on angiogenesis. For this reason, we believe this effect of Pentoxifylline should be studied in more details using different in vivo models in future studies and effects of specific phosphodiesterase inhibitor 1, 2 and 3 on angiogenesis should be studied by chicken chorioallantoic membrane model to better understand the effect of Pentoxifylline. Key words: Pentoxifylline, chicken chorioallantoic membrane, phosphodiesterase inhibitor, in vivo, angiogenesis Introduction Pentoxifylline (PTX), a methylxanhine derivative and a non-specific phosphodiesterase inhibitor which is avasodilating agent enhancing red blood cell deformability, inhibits inflammatory reactions and reduces blood viscosity by inhibiting platelet aggregation. PTX has therefore been used for the symptomatic treatment of various vascular disorders, sudden sensorineural hearing loss, including intermittent claudication, ischemic leg ulcers, and peripheral vascular disorders (1, 2). Phosphodiesterase inhibitors (PDEs) are currently classified into 11 distinct families, based on their different substrate specificities, mode of regulation, and sequence homology (3, 4). Several PDEs including PDE5, PDE6, and PDE9 are cGMP-specific; some specifically degrade cAMP (PDE4 and PDE7). Inhibitors of cAMP PDE have 1841
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
been shown to exert a negative effect on endothelial cell properties associated with angiogenesis, while less is known about the effects of cGMPspecific PDE inhibitors on endothelial cell functions (5, 6). In addition, non-specific PDEs effect on endothelial cell properties associated with angiogenesis is unknown. Angiogenesis plays an essential role during embryogenesis, adult physiological vascular remodeling and sometimes in tumor development and some pathological events such as diabetic retinopathy (7). Essential in vivo models used in angiogenesis studies are chicken chorioallantoic membrane (CAM), rabbit cornea model (“micropocket”), rodent mesenteric model, sponge implant mode, matrigel and classic tumor model and zebrafish model. However, CAM and rabbit cornea methods are accepted as the easiest and simplest models both of which can be repeated and allows quantitative measurement of the angiogenic response (8-10). Based on a neovascularization study conducted using specific PDEs in the literature, the aim of the present study was to answer the question “As specific PDEs have positive or negative effects on angiogenesis, what kind of an effect does pentoxiphylline, which is a phosphodiesterase inhibitor, have on angiogenesis?” by using CAM model. To the best of our knowledge, this is the first study using CAM model in studying effect of PTX on angiogenesis. To this end, we studied the effects of pentoxiphylline on neo-vascularization in CAM and aimed at investigating its contribution to the process of angiogenesis. Materials and methods Preparation of the pellets In this study we investigated the effects of a vasodilating agent, PTX (Trental® 300mg/15 ml, Sanofi aventis İlaçları Limited Şirketi®, Istanbul) on angiogenesis. PTX was used in the form of soluble infusion. Appropriate volumes of solutions were used to achieve three different concentrations of the drug (10-4 M, 10-5 M and 10-6 M). Due to lack of adequate knowledge, the choice of these concentrations could not be based on the results of the previ1842
ous studies. So we tried to use wide range of drug concentrations and these concentrations were based on the knowledge that therapeutic concentrations of drugs at treatment side are 10-5 M to 10-6 M. First of all, a concentration of 10-4 M of the drug was prepared and more diluted concentrations were prepared by diluting these solutions. The classical molarity formula (M=m/V) was used to find out the required drug amount to provide exact dilution in 10 µL of discs. We prepared approximately twenty discs for each study set. Therefore, approximately 1 mL agar and drug mixture was prepared (10 µLx100=1mL). For easy administration, the pellets were prepared as 10 µl drops on circular stainless steel surface which is 5 mm in diameter. The pellets were then solidified in room temperature. Chicken chorioallantoic membrane (CAM) assay Ross 220 impregnated chick eggs were obtained from Yemsel Tavukculuk Hayvancilik Yem Hammaddeleri Sanayi ve Ticaret Anonim Sirketi (Kayseri). The impregnated chick eggs were incubated in horizontal position in 37.5°C and 80% relative humidified environment. On the 5th day of incubation period, 5 ml of albumin was taken from the solid side of the eggs by a syringe (Figure 1A) allowing detachment of the embryo from the eggshell and a shell piece of 2-3 cm in diameter was removed to open a window on the other side of the eggs. Normal development was verified and embryos with malformations or dead embryos were excluded. The window was sealed with gelatin and the eggs were returned to the incubator for 72 hours for the diameter of CAM to be approximately 2 cm, and then on day 8 the pellets were placed on chorioallantoic membranes of each egg. The eggs were then incubated for 24 hours and after this period angiogenesis was evaluated. For each concentration of the study and positive control drugs (bevacizumab 10-6 M), twenty eggs were used in each egg set. All of the tests were duplicated. For no pellet and agar only negative controls, one and two egg sets were used respectively. Our exclusion criteria were having inflammation and embryo toxicity caused by the pellets. There was no exclusion related to inflammation.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Angiogenesis scoring The vascular composition of the chorioallantoic membranes where the pellets were administered was evaluated under stereoscopic microscope (Leica EZ4D) by using the scoring system of Burgermeister et al. on day 9 (11) (Table 1). Table 1. The scoring system of angiogenic effect of the compounds on chorioallantoic membrane.
Score 0 Effect Absent Explanation Normal embryo, no difference with respect to surrounding capillaries There is no area lacking capillary vessels. The density of the capillaries were decreased but not larger than the pellet
Results Normal development of embryos and the pellets were placed on chorioallantoic membranes of each egg were shown in Figure 1 B-C. In the first negative controls, angiogenesis of chorioallantoic membranes was normal. The pellets with no drugs including only 10 µl agarose solution as the second negative controls did not cause any significant anti-angiogenic effect (average anti-angiogenic score = 0.2). The average anti-angiogenic scores of bevacizumab was 1 (good anti-angiogenic effect). The average anti-angiogenic scores of pentoxiphylline 10-4M, 10-5M and 10-6M were 0.4 (no anti-angiogenic effect), 0.3 (no anti-angiogenic effect), and 0.2 (no anti-angiogenic effect), respectively (Figure 1D).
0,5
Poor
1
2
The area lacking capillaries is small or capillary density was Moderate decreased in a certain area. The effects are not more than twice of the pellet area The area lacking capillaries is at Strong least as twice as pellet area
After the scoring, the equation developed by Krenn & Paper (12) was used for the determination of the average mean score for each drug concentration: Average score = [Egg number (Score 2) X 2 + Egg number (Score 1) X 1] / [Total egg numbers (Score 0, 1, 2)] Average score <0.5 = no anti-angiogenic effect. Average score 0.5 to 0.75 = weak anti-angiogenic effect, score >0.75 to 1 = good anti-angiogenic effect, and score >1 = very good anti-angiogenic effect. Statistical Analysis The data were expressed as median (min-max) in dot-plot graphs. Anti-angiogenic scores of study drugs and positive controls were analyzed by Kruskal-Wallis with post hoc Dunn’s multiple comparison test tests and expressed as median (minmax). A p value of less than 0.05 was considered as statistically significant.
Journal of Society for development in new net environment in B&H
1843
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Figure 2. Shows the median anti-angiogenic scores of pentoxiphylline in 10-4M, 10-5M and 10-6M concentrations. As shown in the scatterdot graph, there was no significant difference between groups (p>0.05). Discussion The starting point of our study was the fact that some specific PDEs have positive or negative effects on angiogenesis while our aim was to study the effects of pentoxiphylline, which is a phosphodiesterase inhibitor, on angiogenesis based on the said fact. As a result, we have evaluated the effect of pentoxifylline which is a nonspecific phosphodiesterase inhibitor, on the process of angiogenesis with the CAM model. Angiogenesis is a tightly regulated process known to be essential for normal embryonic development that has also been implicated in physiological, as well as pathological, phenomena in fully developed organisms (13, 14). Angiogenesis is the formation of new blood vessels by pre-existing endothelial cells (EC), is both a necessary developmental and survival process with the potential to also be detrimental, promoting certain disease processes (15). In angiogenesis studies, chick embryonic chorioallantoic membrane (CAM) model is the most commonly used, fast, objective and quantitative method (3) Phosphodiesterase are the enzymes that catalyze hydrolysis of the 3′ cyclic phosphate bonds of adenosine and/or guanosine 3′, 5′ cyclic monophosphate. These enzymes have been grouped into several families based on their regulation and substrate specificity. Some PDEs such as type 4
Figure 1. A. The view of taking 5 ml of albumin from the solid side of the eggs by a syringe, B. The view of embryo after removing shell piece of 2-3 cm in diameter to open a window, C. The view of placing pellets on chorioallantoic membranes of each egg, D. The view of the pellet on CAM (Scoring angiogenesis, Score 0). The median antiangiogenic scores of pentoxiphylline in 10-4M, 10-5M and 10-6M concentrations shows in the Figure 2. As shown in the scatter-dot graph, there was no significant difference between groups (p>0.05) (Figure 2). Overall, these results suggest that, pentoxiphylline has no effect on angiogenesis in CAM model. 1844
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
(for example teophiline) are specific for cAMP, while others such PDE5 (for example Sildenafil), specific for cGMP. The PDE1 family is activated by Ca++/calmodulin and is capable to act on both cAMP and cGMP (16-18). Sildenafil is a specific PDE5 inhibitor. Pyriochou et al (19) carried out a study where they investigated the effects of sildenafil on neo-vascularization in the CAM and in angiogenesis related properties of endothelial cell in vitro. They found that the PDE5 inhibitors might be useful in instances where neo-vascularization is desired. Foresta et al. (20) demonstrated that a prolonged therapy with PDE5 inhibitors does improve endothelial function and increases circulating endothelial progenitor cells, suggesting a role of PDE5 in endothelial progenitor cells physiology. Foresta et al. showed in in vivo and in vitro models that they cause an increase in vascularization due to the said increase in circulating endothelial progenitor cells (20). In a study where they used a CAM model to investigate the effect of CC-5079, which is a PDE4 inhibitor, on angiogenesis, Vu et al. (21) showed that not PDE5 but PDE4, which is effective on cAMP, had antiangiogenic and intitumor activities. PTX is drug which is frequently used by ENT physicians in sudden sensorineural hearing loss and in increasing arterial supply in reconstruction flaps. PTX is a non-specific inhibitor of phosphodiesterases (PTX inhibits PDE1-5), which decreases hydrolysis of both cAMP and cGMP, and thereby augments cyclic nucleotide-dependent signal transduction. The exact mechanisms underlying the therapeutic effects of PTX are not fully recognized (22). Mendes et al.(23) used murine model of peritoneal adhesion to investigate the effects of controlling adhesion development through inhibition of its key components (angiogenesis, inflammation and fibrosis) with the PDEs cilostazol and PTX. As a result of this study, a more marked effect of PDE inhibitors was in decreasing angiogenesis which was assessed by hemoglobin content, vessel number, and by VEGF levels. Hasebe et al. (24) showed that PTX inhibited angiogenesis in neonatal rat retina but was not effective in reducing neovascularization in the oxygen-exposed neonatal rat. PTX, which is a nonspecific phosphodiesterase inhibitor, may have an angiogenesis enhancing effect
just like Sildenafil which is a specific PDE5 inhibitor used in a study of Pyrichou et al (19) or it may have an antiangiogenetic effect like CC-5079 which is a specific PDE4 inhibitor used in a study of Vu ye et al.(21). In our study, we evaluated the effect of PTX on angiogenesis by using CAM model has been defined as a commonly used method in angiogenesis studies by Verhoelst et al (3). To our knowledge, before this study the effects of PTX in angiogenesis have not been investigated on the CAM model. Despite studies of Mendes et al. (23) and Hasebe et al.(24) where they showed by using different in vivo models that PTX inhibits angiogenesis, the results we obtained in our study showed that PTX has neither a positive nor a negative effect on PTX. We believe that having no effect by PTX on angiogenesis in CAM model could be related to the following 1) PTX may be inhibiting both PDE 4 and PDE 5 at an equal rate 2) PTX does not have a potential to effect angiogenesis 3) PTX inhibits PDE-1-5. Although there are studies on the effects of PDE 4 and 5 on angiogenesis, we could not find any studies employing PDE1, 2 and 3 in the literature. The results we obtained could have been caused by the effects of PTX on PDE 1, 2 and 3. Conclusion According to our literature review, this is the first study using CAM model in studying effect of PTX on angiogenesis. Although PTX has been reported to have no antiangiogenic effect in some studies using different in vivo models, our study has shown that PTX does not have any effect on angiogenesis. For this reason, we believe this effect of PTX should be studied in more details using different in vivo models in future studies and effects of specific PDE1, 2 and 3 on angiogenesis should be studied by CAM model to better understand the effect of PTX. Acknowledgments We would like to thank Dr.Ihsan Bagcıvan for critical review of the manuscript. We also thank Dr.Ahmet Altun for his technical assistance and Dr. Ali Çetin for statistical analysis. 1845
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
References
1. Hormann K. Rheological effects of pharmacological treatment of inner ear disorders. Scand Audiol Suppl. 1987; 26: 47-8. 2. Lédée-Bataille N, Olivennes F, Lefaix JL, Chaouat G, Frydman R, Delanian S. Combined treatment by pentoxifylline and tocopherol for recipient women with a thin endometrium enrolled in an oocyte donation programme. Hum Reprod. 2002; 17(5): 1249-53. PubMed PMID: 11980747. 3. Verhoelst E, De Ketelaere B, Bruggeman V, Villamor E, Decuypere E, De Baerdemaeker J. Development of a fast, objective, quantitative methodology to monitor angiogenesis in the chicken chorioallantoic membrane during development. Int J Dev Biol. 2011; 55(1):85-92. PubMed PMID: 21425083. 4. Morales-Garcia JA, Redondo M, Alonso-Gil S, Gil C, Perez C, Martinez A, Santos A, Perez-Castillo A. Phosphodiesterase 7 inhibition preserves dopaminergic neurons in cellular and rodent models of Parkinson disease. PLoS One. 2011; 24; 6(2):e17240. PubMed PMID: 21390306; PubMed Central PMCID: PMC3044733. 5. Essayan DM. Cyclic nucleotide phosphodiesterases. J Allergy Clin Immunol 2001; 108: 671– 680. 6. Favot L, Keravis T, Holl V, Le Bec A, Lugnier C. 2003. VEGF-induced HUVEC migration and proliferation are decreased by PDE2 and PDE4 inhibitors. Thromb Haemost 1990: 334–343. 7. Costa C, Soares R, Schmitt F. Angiogenesis: now and then. APMIS 2004; 112: 402-412. 8. Norrby K. In-vivo models of angiogenesis. J Cell Mol Med 2006; 10: 588-612. 9. Vallee BL, Riordan JF, Lobb RR, et al. Tumor-derived angiogenesis factors from rat Walker 256 carcinoma: an experimental investigation and review. Experientia 1985; 41: 1-15. 10. Auerbach R, Auerbach W, Polakowski I. Assays for angiogenesis: a review. Pharmac Ther 1991; 51: 1-11. 11. Bürgermeister J, Paper DH, Vogl H, Linhardt RJ, Franz G. LaPSvS1, a (1-->3)-beta-galactan sulfate and its effect on angiogenesis in vivo and in vitro. Carbohydr Res. 2002; 337(16): 1459-1466. 12. Krenn L, Paper DH. Inhibition of angiogenesis and inflammation by an extract of red clover (Trifolium pratense L.). Phytomedicine. 2009; 16(12): 1083-8. 13. Conway EM, Collen D, Carmeliet P. 2001. Molecular mechanisms of blood vessel growth. Cardiovasc Res 49:507–521. 14. Eichmann A, Makinen T, Alitalo K. Neural guidance molecules regulate vascular remodeling and vessel navigation. Genes Dev. 2005; 19(9): 1013-21. Review. PubMed PMID: 15879551.
15. Favot L, Keravis T, Holl V, Le Bec A, and Lugnier C (2003) VEGF-induced HUVEC migration and proliferation are decreased by PDE2 and PDE4 inhibitors. Thromb Haemost 90:334–343. 16. Beavo JA. Cyclic nucleotide phosphodiesterases: functional implicationsof multiple isoforms. Physiol. Rev. 1995; 75, 725–748. 17. Medina AE. Therapeutic utility of phosphodiesterase type I inhibitors in neurological conditions. Front Neurosci. 2011; (18)5: 21. PubMed PMID: 21373359; PubMed Central PMCID: PMC3044262. 18. Maurice DH, Palmer D, Tilley DG, Dunkerley HA, Netherton SJ, Raymond DR, Elbatarny HS, and Jimmo SL. Cyclic nucleotide phosphodiesterase activity, expression and targeting in cells of the cardiovascular system. Mol Pharmacol. 2003; 64: 533–546. 19. Pyriochou A, Zhou Z, Koika V, Petrou C, Cordopatis P, Sessa WC, Papapetropoulos A. The phosphodiesterase 5 inhibitor sildenafil stimulates angiogenesis through a protein kinase G/MAPK pathway. J Cell Physiol. 2007; 211(1): 197-204. PubMed PMID: 17226792. 20. Foresta C, De Toni L, Magagna S, Galan A, Garolla A. Phosphodiesterase-5 inhibitor tadalafil acts on endothelial progenitor cells by CXCR4 signalling. Curr Drug Deliv. 2010; 7(4): 274-82. PubMed PMID: 20695838. 21. Vu HN, Miller WJ, O'Connor SA, He M, Schafer PH, Payvandi F, Muller GW, Stirling DI, Libutti SK. CC5079: a small molecule with MKP1, antiangiogenic, and antitumor activity. J Surg Res. 2010; 164(1): 11625. Epub 2009 Feb 24. PubMed PMID: 19726061. 22. Taha H, Grochot-Przeczek A, Was H, Kotlinowski J, Kozakowska M, Marek A, Skrzypek K, Lackowska B, Balcerczyk A, Mustafa S, Dulak J, Jozkowicz A. Modulation of inflammatory response by pentoxifylline is independent of hemeoxygenase-1 pathway. J Physiol Pharmacol. 2009 Jun;60(2):3-12. PubMed PMID:19617639. 23. Mendes JB, Campos PP, Rocha MA, Andrade SP. Cilostazol and pentoxifylline decrease angiogenesis, inflammation, and fibrosis in sponge-induced intraperitoneal adhesion in mice. Life Sci. 2009; 84(15-16):53743. Epub 2009 Feb 14. PubMed PMID: 19232362. 24. Hasebe Y, Thomson LR, Dorey CK. Pentoxifylline inhibition of vasculogenesis in the neonatal rat retina. Invest Ophthalmol Vis Sci. 2000; 41(9): 2774-8. PubMed PMID: 10937597. Correspondence author Emine Elif Altuntaş Department of Otorhinolaryngology, Cumhuriyet University, School of Medicine Turkey, E-mail: ealtunta@yahoo.com
1846
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The Backgrounds, consequences, and future of the integration of Medical Education and Health Service Delivery System
Sogand Turani1, Ali-Akbar Haghdoost2, Mohammad-Reza Maleki1, Hamid Ravaghi1, Reza Dehnavieh Tijang3, Somayeh Noori Hekmat1
1
2 3
Health Services Administration, School of Management & Medical Information Science, Tehran University of Medical Sciences, Iran, Research Center for Modeling in Health, Kerman University of Medical Sciences, Iran, Health Services Administration, Research Center for Health Management, Policymaking and Economics, Kerman University of Medical Sciences, Iran.
Abstract Objective: In 1985 a huge revolution occurred in Iran’s health system and the entire health-related education program was integrated into the Ministry of health, forming ministry of health and medical education (MOHME). The current study was designed to explore the integration impact on the both medical education and health service delivery system after about 26 years. Study design: This study was based on qualitative study methods criteria for participant selection were defined and purposeful sampling method was used and continued with snow ball sampling and. A total of 23 respondents participated in this study. Participants were selected according to their experience and effect on the integration. Data was obtained through semi-structured interviews. The interviews were conducted by the main researcher, audio-recorded, transcribed and analyzed one by one and together. Main themes were identified from the data and analyzed using Grounded theory approach by Atlas Ti 5.2 software. Results: totally 5 major themes and 3 major barriers regarding the integration emerged. These themes were: Health human resource, Educational setting enlargement, Community Based Medical Education, Community-Oriented Research, Education quality; and barriers were: Management and Implementation Conditions of Integration.
Conclusion: Although integration has made a major revolution in Iranian medical research, education and health services systems’, there is still room for improvement and while structural integration has been carried out powerfully, functional integration have not been implemented yet. Key words: Integration- Medical EducationMedical Research- Health Service- Iran Introduction Iran's medical education system has coped with huge changes in the past 2 decades in order to integrate the entire medical and health-related education program into the Ministry of health; forming ministry of health and medical education (MOHME) in 1985[1]. The most important goals of this integration was to bridge the gap between health researches and education programs and society’s health needs and to address acute health human resource shortage especially physician[2-4]. Lack of access to medical services in far flung areas had led to poor conditions that affected the population's health[5]. In 1980 and ’81 there was an acute need for greater medical workforce as in some areas rate of physician per populations was only 1 in 18,000. That was why foreign doctors were on the ground to render medical services to people[6]. 1847
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Before integration took place; many of those people were living in small towns and large villages had not even seen an Iranian physician until that time and some of villages had virtually no access to medical care. The number of medical students admitted annually was 1207 and the ratio of physicians to the population of the country was 1/2800, which was far too low[7]. To achieve Health for All, the Ministry of Health established a health network system to provide primary health care throughout the country in 1982, but the main problem was inadequate health human resources. At this point, the High Council of Cultural Revolution decided to propose the separation of medical sciences universities from the Ministry of Science, Research and Technology, and its integration into the Ministry of Health to increase the number of health-related students in general and medical students in particular[7]. After the implementation of integration strategy, the Ministry of Health and Medical Education supervised all educational activities, including research programs and service provisions of medical schools. At this point, universities of medical sciences and health services were born and at least one university of medical sciences (UMS) was established in each province[8]. The primary goal of this integration was to supply more health workers especially physicians to respond to the flourishing health market needs. Moreover, some additional goals can be mentioned like the expansion of medical universities in all the provinces(at least one university of medical sciences (UMS) in each province), the supply of more educational facilities for students, the implementation of community based medical education and unified management of medical human resources supply and demand(1). In spite of the integration superlative philosophy this strategy has been implemented with a poor review of literatures’ background. Since in 1985 with parliament approval, this strategy has been implemented precipitately, policy makers didn’t take evidence based decision making into consideration before and after the implementation of this huge change[9].
1 Walton. H. Global Demands ON Medical Education; the Case of Iran. Iranian Journal of Medical Education, Vol. 1, No 2, Winter 2001, pp 14-17.
Now, more than two decades after implementing the integration it is time to make concentrated efforts on strengthening the positive aspects of integration and eliminating its negative side effects instead of arguing for the dissociation of medical universities from MOHME. Many measures have been taken for and against integration and some research has been done to survey experts who are with or against of integration[9, 10]. In 2006, a team including WHO consultants and a national team of experts was assigned to the structure and function of the integrated educational and health care delivery systems at central and peripheral levels but persistence this study have remained unfinished[11, 12]. In spite of the importance of evaluating different aspects of integration, there are not many published studies available on the topic. In this study a qualitative methodology was chosen as the most suitable approach for identifying an implemented plan challenges and ways to deal with them[13]. The focus of the work was not on measuring the level of integration achieved, but discovering how the experts judged the extent to which integration had been implemented, its key Achievements and Challenges. Method This research was based on a qualitative study design, with a thematic framework was used to identify various positive and negative aspects of the integration on communicating between the education system and the service provision system. Qualitative interviews are suitable in generating rich, in-depth data that illuminate our understanding of complex social, behavioral and educational issues[14]. while Health policy analysis is an ongoing process, qualitative methods focus on the identification, description and explanation of interactional processes among individuals or groups within a given social context[15]; which making it the ideal method for studying our topic. This qualitative study included 23 semi-structural interviews, carried out between July and September 2010, with each interview lasting roughly an hour. Interviews and discussions continued until the point of saturation.
1848
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Criteria for participant selection were defined as having research project or paper related to integration or being involved in the integration medical education and health service provision system policy making. Purposeful sampling were used and continued with snow ball sampling as the codes and categories emerged. Purposive samples of five policy makers who are well known for their approach to integration were selected. As integration has many supporters and those who are against it, the study was thus addressed the views of both groups concerning integration and the factors which influenced it at the implementation phase. Interviews were conducted with different stakeholders ranging from researchers, policy makers, service providers and university professors in medical and related fields. The research team briefed the participants on the study's objectives before the interviews began. It was pointed out that this research focuses on the proximity between service delivery and medical education systems. The current integration situation, the strengths and weaknesses of the integration program, potential solutions to the shortcomings of the program and its implementation were discussed with the participants. Verbal consent was obtained at the beginning of each session and most interviews conducted at the respective interviewees’ locations or offices to suit their convenience. The study proposal was presented to the School of Management and Medical Informatics Research Affairs Board and was approved by the ethics committee. Data Analysis The interviews were conducted by the main researcher, audio-recorded, transcribed and analyzed one by one and together. After the interviews were conducted they were all transcribed immediately, read again and again, and analyzed for exploring codes. Subsequently and if necessary further interviews were carried out for further explanation or clarification of the previous statements. Interviewing was stopped when data saturation occurred; effectively when participants had no new information to add. The interviews were coded with a summary of the emergent categories and were then checked
by the supervisors. They also studied the transcripts of the interviews and proceeded to identify the core category. Respondents were guaranteed anonymity, told that they could refuse to answer any question or stop the interview at any time. Qualitative analysis was performed through the thematic framework method; the documented interviews and their transcripts were coded and analyzed by two researchers independently using Atlas Ti Software5.2. This included coding of individual interview to identify major themes and categories and the development of summary sheets for each interview. In the event of disagreement between the two individuals, the category was chosen by the study group. The core categories were finalized considering the primary categories. Two researchers performed the coding independently. Categories generated by the individual coders were compared and discussed in research meetings between the research team. These discussions resulted in re-coding of some data and reanalysis of relevant segments. Participant checks and Credibility: In qualitative research, one of the methods for validating the accuracy of research findings is the use of participant checks as a member check, prolonged engagement with participants, a peer check and an external check[16]. For this check, 9 participants were choose, and the interpretation were given to them in order to check the authenticity of the work; 4 of the participants provided a number of suggestions for changing the summaries to better reflect what they communicated to the interviewers. The rest of those contacted affirm that the summaries reflect their views. Result and Discussion / Finding The study groups were selected according to their experience and influence on integration policy making and its implementation. 100% of those invited agreed to have interview. Table1 shows participants’ characteristics (Table 1). Based on the comprehensive descriptions given by the respondents, in relation to the communications between medical education sector and service provision system 5 major themes and 3 major barriers regarding this integration emerged. 1849
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 1. Characteristics of interviews participants
Position in the System Administrative positions in national level -(Ex)health minister -(Ex)deputy mister -High ranking position in health ministry -(Ex)Chancellor Administrative positions in provincial/medical -(Ex)vice chancellor university level -High ranking service provision managers -Academic staff Academic/scientific well known experts -researchers Total Number of Participants Frequency 3 3 10 2 5 7 20 12 minimum years experience in their position 4 3 4 3.5 3.5 3 7 9 23*
*Some of participants belonged to more than one category/cell in the table; for example, a participant may be “hospital manager” and at a same time be a member of “academic staff” too.
Table 2. Major themes in relation to their sub-themes
Major Themes Health Human Resources Educational setting Enlargement Community Based Medical Education (CBME) Community-Oriented Research (COR) Education Quality Sub-Themes Increase in the number of specialized health human resources health human resources dispersion Supply & Demand Equation Establishment of new universities Establishment of new courses Establishment of new teaching hospitals Faculty Student Service delivery Linking Research to Action Attention to HSR and Applied Researchers 376 establishing EDC & EDO in all medical universities Failure to utilize good educators Education seems more important than service Lack of standardized teaching hospitals Integration Barriers easy access to information for research university faculty supervision on service delivery system Medical education/teaching and service delivery cost reduction/ efficiency unilateral shift of professionals from educational groups to service delivery system differences in goals/targets of faculty members and service delivery managers Inadequate preliminary studies (roles, legislation, finance) Unclear/undefined definition of integration and its evaluation
Management
Integration Implementation
These themes were: 1. Health Human Resources 2. Educational Setting Enlargement 3. Community Based Medical Education (CBME) 4. Community-Oriented Research (COR) 5. Education Quality. 1850
Table 2 shows major themes in relation to their sub-themes (Table 2). A summary of key strategic factors is presented below, while supportive qualitative comments from the interviews are cited in the text. Excerpts of individuals' statements which demonstrate their outlook towards the study categories are shown in “Italic”.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Health Human Resources A number of participants mentioned rapid movement in faculty recruitment as a result of establishing new universities and courses. “Increasing the number of faculties was the cause for setting up new courses. We established new courses everywhere (provincial university) we found there was a need for them.” Increasing the medical and paramedical student admission with matching the numbers of students trained met the national needs for medical professions were witnessed by all participants: "Shortage of Iranian physicians meant foreign physicians who were not familiar with local customs or language were used to provide health services in remote areas. Integration was a good opportunity to utilize all health facilities like hospital’s bed and specialists for student education” On the other hand, some interviewees believed there is an oversupply in human health human resources. Almost all interviewees said the distribution of faculties and specialized human health recourses was an undeniable result of integration. However, some of them had doubts about expansion of other health workers. Since Health Network Program was taking place simultaneously, this dispersion may be a result of the Health Network Program. On the other hand, not all participants accepted dispersion as a positive aspect: “Due to specialists’ dispersion in various parts of the country, we lose their scientific teamwork opportunity. Therefore Integration was damaging to knowledge and science production. “ Some interviewees regarded the supply and demand equation as matching sufficiency and qualities which are needed in community. “The philosophy of supply and demand unified stewardship is accepted by many international organizations like WHO and WFME. “ Educational setting Enlargement In participants’ view, the main achievements of integration were enlargement of educational settings’ like universities, faculty and teaching hospitals.
Before the integration, large cities like Tehran, Shiraz, Mashad and some other metropolises had medical schools. Establishing new universities, ultimately lead to an increase in the number of medical schools, faculties, and student admissions. One of the integration policy makers who were also a university faculty member regarded establishing new courses as: “We establish new courses in order to respond to healthcare system’s human resources need, while back in 1978, there were no such courses on offer. “ Also some of these courses are not useful at the moment but cannot be cancelled. Integration created new opportunities in which MOHME established new hospitals in most provinces and hospitals and health setting which were available at that time were utilized for education. Community Based Medical Education (CBME) Another main philosophy of integration was reaching to CBME, because the community (in its broadest sense) needs medical practitioners who can provide a range of medical services in hospitals and community settings in a wide range of urban, regional, rural and remote communities. As interviewees mentioned, establishing HCCOM (High Council of Community-Oriented Medical Education) in MOHME was one of the first steps in CBME governance. Interviewees mentioned different aspects of CBME in integration: Faculty Training of faculty members was the responsibility of establishing educational development centers (EDC) at each medical university. Furthermore, medical universities provided continuous medical education (CME) for the medical community. Faculties benefited from the integration policy. A closer look shows that the healthcare system also benefited from the integration by cooperating in healthcare policy making and faculty allowance of health programs (faculty as health program supporter) and teaching in community setting and in1851
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
volving in community problems. Although some policy makers and faculties believed: Most of individuals believed CBME haven’t been implemented thoroughly yet and there are too many gaps to fill. For example, there is no organized connection between hospital faculties and health settings, some faculties aren’t aware of community health problem and don’t feel they are in charge of it due to lack of supportive legislation for CBME. Student Learning in circumstances which will be useful later was witnessed by most of interviewees which caused student awareness of community problems. Furthermore, many community-based programs make health services available to the community as soon as students begin to learn in that community; in this way they are contributing to the delivery of healthcare as well as their education. Despite all these, most policy makers believed inattention to modifying curriculum content due to community changeable health priorities, causes new graduates don't have qualities which were vital in work place. Some of the participant's points of views are as: Teaching medical students was not according to needs but according to Harrison’s textbook… In specialized teaching hospitals students usually see patients whose conditions need advanced treatments. However, after graduation medical students will qualify as general practitioners who work at health centers but not in specialized hospitals. It is unethical to use medical student in the treatment of patients as it weakens patients’ rights. Service delivery Almost all interviewees agreed that integration increased service delivery capacity by using senior medical and paramedical students and university faculties as service providers; but Service delivery managers declared some problems lied in the integration as: Lack of faculty supervision in service delivery package developing process and its review, tre1852
atment priority over prevention, lack of logical connection between health centers and related schools, service providers unwillingness to accept trainee medical students, Irregular use of medications by students, overindulgence in service delivery, unified stewardship of service delivery administration system and its audit system which prevents right evaluation. Furthermore, they cited student as troublemakers in service delivery settings: "….those who are constantly committing medical errors...." Community-Oriented Research (COR) Some faculty members believed after integration, the research topics and methodologies became more applied and more community-oriented. While some researchers believed linking research to action was useful, others believed it was not: ‘’some of the researches carried out are not based on needs and are just designed to publish their results in international journals’’. Service providers said they had doubts over research result being acceptable and applicable because there was not a master plan for defining research priorities. "….researches which is conducted to resolve system problem, requires plenty of financial support and time...." "Unfortunately, much of our researches is just a copy of international researches and only is carrying out for the sake of having articles published and is not designed to address society’s problems." Education Quality Establishing Education Development Centers in all medical universities were emphasized as positive aspects of integration by almost all faculty members. They also considered disregarding good educators: All medical universities and almost all faculty members and most policy makers emphasized Quality assessment of professional competence as a positive aspect of integration. Individuals also con-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
sidered an unwillingness to teach preventive measures and a preference towards specialized fields were factors that lead to poor quality of education. “if a professor does his best to improve the quality of education at university his efforts will not be appreciated. However, if the same professor dedicates his time for the sake of writing and publishing articles which may not be useful to society or undergraduates, his efforts will be appreciated’’. Some faculty members believed education is victim of service: “Universities spend most of their efforts and resources on service delivery and education has faced difficulties" “For Large universities their commitment on expanding frontiers of science should be more important than service delivery targets. However, these universities are busy with service provision issues.” Lack of standardized teaching hospitals: “… Our best hospitals have been asked to be teaching hospitals without having the minimum facilities were needed. …. Nowadays, Teaching hospitals are unable to continue to do their jobs”. Barriers to Integration Success Management Different groups of interviewees mentioned different positive aspects of integration in managing both educational and service delivery systems. Faculties regarded easy access to information for research; and policy makers and service providers regarded university faculty supervision on service delivery system and its cost reduction as integration strengths. Service providers also noted unilateral displacement of professionals from educational groups to service delivery system: “Individuals become health ministers or deputies who are academic without having any experience in health system management’’. “we never choose capable managers who can provide good healthcare services but choose high academic achievers and hope they learn on the job. Why do not we choose people who have experience? Unfortunately, seniority politics would not allow this’’.
Distinguishable differences in incentives of faculty members and service delivery managers were witnessed between interviewees from all groups. Providing maximum services at minimum cost is the most important success indicator for service providers, while on theoretic study, having books published, teaching, writing articles and attending conferences are important faculty promotion criteria, just as in any other university in the world. Some individuals argued using physicians as managers in different levels of health system: “it is possible to find exceptions. For example may be we could find a doctor who is a competent manager or policy maker, this is the exception as we do not teach policy making or managerial skills to medical students’’. Integration Implementation Almost all interviewees believed integration hasn't been implemented completely. The changes in structural integration have not affected performance. Policy makers believed due to inadequate preliminary studies and unclear definition of integration, evaluating the impact of integration has become complicated. Moreover, inadequate legislation on functional integration, unclear roles (duty), lack of supportive financial legislation was barriers to implementing functional integration which most agreed upon. A diagram of these themes, sub-themes and related mini-themes, and the relationships between them, is depicted in Figure 1.
Journal of Society for development in new net environment in B&H
1853
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Figure 1. Model of integration themes, sub-themes and related mini-themes, and their relationships
Discussion Integrating health sector manpower education into the health services delivery system at the national level was a change which only occurred in Iran[4, 7, 11, 12, 17]. To date several discussions have been held about the effectiveness of this integration and in different time periods have been analyzed[9, 10]. Due to inadequate preliminary studies and unclear definition of integration, it is not possible to provide a quantitative impact analysis. Therefore, the research team decided to perform a qualitative study to better understand the impact of the integration after about 26 years. The study groups were selected according to their experience and effect on integration policy making and its implementation from different administrative levels, academic staff and researchers. In total 23 experts were selected and interviewed using an interview instrument developed to cover the current situation and desirable situation of educational system and service delivery system. The results of the study categorized in 5 major themes: Health human resource, Educational setting enlargement, Community Based Medical Education (CBME), Community-Oriented Research (COR) and Education quality. Major barriers included Management and Integration Implementation. Generally speaking there was controversy on positive and negative aspects of integration. One of the consensuses referred to was integration 1854
implementation. Almost all participants believed integration has not been implemented thoroughly. There has been a long debate in Iran and a lot of criticism of ministry of health when the integration plan/act was initiated for the first time and it eliminated the opportunity to perform more studies on its legislations, financial circumstances, impact analysis criteria, and role definition[10]. Where community-oriented research is concerned, it may seem that after integration took place, due to communication between faculty members and field staff, the research topics became more community-oriented. However, some of the experts believed since in most cases as there was not a master plan, large parts of our research results were not acceptable and applicable. Universities need to invest resources in community partnerships that address community concerns in order to build the trust necessary for community-based research[18]. Green and his colleagues, in their study of participatory research in health promotion in Canada, suggested the need for “legitimizing the field, supporting the field through reform of the funding process, and building the capacity for greater emphasis on participatory action research in the future[19].In areas of education quality, promotion of professional examination system and establishing EDC & EDO in all medical universities to support university faculty by keeping them up-to-date there were some remarkable achievements which were emphasized. However, many academic experts believed this change was not effective in solving problems such as the failure to encourage good educators and lack of standardized teaching hospitals. Sufficient researches are needed to support educational practice, educational efficiency and the process of accreditation[20]. Faculties’ promotion of health programs and their participation in health policy making, as well as teaching in community setting and involvement in community problems are community-based medical education opportunities were created as a result of the integration[7]. Krothe also have explored ways to deliver health care in a cost-effective manner and to provide settings for faculty practice and student clinical experiences[21]. Interviewees argued treatment’s priority over prevention and unwillingness to accept students in the field; while working in field make students
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
much better prepared to identify problems[22]. Furthermore, a unified stewardship of service delivery administration system and its audit system were problems within the service delivery system. Ulusoy and Çingöl have emphasized on evaluation because of its potentially profound influence on organizational performance[23]. Almost all participants agreed that significant successes had been achieved to address acute health human resources shortage. Saide and Steward argue that delay in the health human resources recruitment process as a result of lack of qualified health worker may reduce the achievement of desired health sector objectives, such as service coverage[24]. Although all the participants agreed with increase in health human resources supply, but there was controversy on accepting it as an achievement for now. Almost all participants agreed that in 1985 the main problem to achieve "Health for All" was inadequate health manpower and integration was a suitable solution to answer the country’s needs at the time. However, there is debate on accepting mass production as integration mission at this present time; Thereby, the main goal of integration is pointless and new strategies must focus efforts to increase quality of education. One of the participants believed when policy makers in Iran talk about integration, they just point out some examples of integration like CBME or internship courses in the field not the integration all organization’s processes. Integrating medical education and health services delivery has been emphasized by several policymakers since establishing MOHME and little attention has been paid to integrating other parts of system like research, financing, legislation, policymaking and innovation system. To achieve unified goal different aspects must be taken into consideration. Minimum level of integration is “Cross Boundary Process”. Cross boundary processes are the processes which some parts of them are carried out in one unit and other parts are done in other units or organizations. Two systems can be merged only when the systems had previously been integrated[25]. It is important to note while intra boundary processes lead to more efficiency, cross boundary processes lead to system integration.
Conclusion Looking at the past shows that since the beginning of the integration many efforts have been undertaken to promote capacities building in both education and health service delivery systems and considerable successes have been achieved. However, some shortcomings may also exist. To address these problems, an idea is going back to the situation before 1985 when medical and paramedical education system were separated from service delivery system, like other countries in the world. A far better idea is to move forward and continue to steadily advance reform. These reforms should have characteristics. For example, while promoting the quality of education and health service delivery it should be considered that increasing production capacity shouldn’t be pursued as the main objective. Also, in recent years, implementing policies to strengthen the central government has become less important. While policies which can improve provincial universities’ ability to set and implement plans addressing particular problems in their area should be pursued. References
1. Entezari. A ea. Iran’s Achievements in Health, Three Decades after the Islamic Revolution Toward Social Accountability of Medical Education in Iran. Iranian J Publ Health. 2009;38(1):27-8. 2. Azizi. MH. The Historical Backgrounds of the Ministry of Health Foundation in Iran. Arch Iranian Med 2007;10 (1):119 – 23. 3. Pezeshkian. M ea. Integration of medical education and health care: the experience of Iran. Journal of medical education. 2003;3(1). 4. WFME. Impressions of medical education in IR Iran: - WFME Contributions to the reform process: WFME 2004. 5. Akbari M, Zarenejad. A. Picture of Health in the Islamic Republic of Iran: Status Report on Healthcare and Medical Education. 53rd WHO’s Eastern Mediterranean Regional Committee Meeting. 2006.
Journal of Society for development in new net environment in B&H
1855
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
6. Zarenejad. A AM, Delara. S. Three Decades of Endeavor on the Health Care Front: Status Report on Health care and Medical Education. Tehran: Public Relations Department of Ministry of Health and Medical Education; 2009. 7. Marandi. SA. The Integration of Medical Education and Health Care Services in the I.R. of Iran and its Health Impacts. Iranian J Publ Health. 2009;38(1):4-12. 8. Khojasteh. A, et al. Integration of Medical Education and Healthcare Service. Iranian J Publ Health. 2009;38(1):29-31. 9. Lameei A, Labbaf Ghassemi R. The meaning, causative factors, consequences, and future of the integration form the perspectives of the supports and opponents of it. Research Journal of Hakim. 2009;1(12):10-20 (in Farsi). 10. Majdzadeh R, et al. Linking research to action’ in Iran: Two decades after integration of the Health Ministry and the medical universities. public health 2010;124:404-11. 11. Associate IMe. Scientific documents of the Integration of Medical Education and Health Care Services. Tehran: Golrang Chap 2002. 12. World Health Organization ROftEM. Report on the Regional meeting of WHO Collaborating Centres in the Eastern Mediterranean Region; 2003. 13. Jandagh G, Zarei Matin H. Application of qualitative research in management (why, when and how). Iranian Journal of Management Studies (IJMS). 2010 3(3):59 - 74. 14. DiCicco-Bloom B, Crabtree BF. The qualitative research interview. . Medical Education. 2006;40(4):314–21. 15. Kennedy TJT, Lingard LA. Making sense of grounded theory in medical education. Medical education. 2006;40:101–8. 16. Ardichvili A, Page V, Wentling T. Motivation and barriers to participation in virtual knowledge-sharing communities of practice. Journal of knowledge management. 2003;7(2):64-77. 17. Farhud. DD ea. Progress of Education, Research and Services in Medical Genetics, in Some Institutions of Iran. Iranian J Publ Health. 2009;38(1):115-8.
18. SEIFER SD, CALLESON DC. Health professional faculty perspectives on community-based research: implications for policy and practice. Journal of interprofessional care. 2004;18,(4):416-28. 19. Israel A, ET al. Review of community-based research: Assessing Partnership Approaches to Improve Public Health. Public Health. 1998. (19):73–202. 20. Norcini JJ, Banda BB. Increasing the quality and capacity of education: the challenge for the 21st century. Medical Education. 2011;45:81-6. 21. Krothe Js. Community Development through Faculty Practice in a Rural Nurse-Managed Clini. Public Health Nursing. 2000;17(4):264-72. 22. Okamura S, et al. Undergraduate Training Program to Review Medical Service from the Patients’ Viewpoint. HealthMED. 2011;5(1). 23. Ulusoy H, Çingöl N. Nurse Managers’and Staff Nurses’ Assessment and Evaluation of Organizational Culture. HealthMED 2011;5(1):136-45. 24. Saide M, Steward D. Decentralization and human resource management in the health sector: a case study (1996-1998) from Nempula providence, Mozambique. International journal of health planning and management. 2001;16:155-68. 25. Black L, Carlile P, Repenning N. A Dynamic Analysis of Different Cross-Boundary Behaviors Emerging from Similar Organizations. Presented at the Academy of Management meetings. Washington D.C., USA 2001. Corresponding author Somayeh Noori Hekmat Health Services Administration, School of Management & Medical Information Science, Tehran University of Medical Sciences, Iran, E-mail: snhekmat@kmu.ac.ir
1856
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The effect of Cyclosporine-a on the renal vascular response to ANG II and Adrenegic Agonist in SpragueDawley rat
Tan Yong Chia1, Munavvar A Sattar1, Mohammed H Abdulla1, Edward J Johns2
1 2
School of Pharmaceutical Sciences, Universiti Sains Malaysia, Minden, Penang, Malaysia, Department of Physiology, Aras Windle, University College Cork, College Road, Cork, Ireland.
Abstract Background: The present study investigates the effect of cyclosporine A (CsA) on renal haemodynamics and excretory functions. Methods: Sprague-Dawley rats received CsA for 21 days at (25 mg/kg/day) p.o. The renal cortical vasoconstriction to noradrenaline, phenylephrine, methoxamine and angiotensin II was done at the end of treatment period. Data, mean±SEM were analyzed by ANOVA with significance at p<0.05. Results: CsA treated rats showed significant reduction in body weight, fluid intake, creatinine clearance, glomerular filtration rate, fractional sodium and potassium excretion with an elevation in blood pressure and urinary protein excretion compared to control. The renal vasoconstriction due to adrenergic agonists and angiotensin II was blunted although significant only for noradrenaline and angiotensin II in CsA treated group compared to control. Conclusion: These findings suggest an attenuation of AT1 or α1-adrenoceptors response to angiotensin II and adrenergic stimuli possibly due to higher sympathetic and renin-angiotensin systems activity in CsA-induced renal failure model. Key words: α1-adrenoceptor; cyclosporine A; noradrenaline, renal failure, Sprague-Dawley rats. Introduction Cyclosporine-A (CsA) is a cyclic endecapeptide obtained from extracts of the soil fungus namely Tolypocladium inflatum gams. It is a T-ce-
ll specific first line immunosuppressant which is widely employed in the management of solid organ transplantation and autoimmune diseases [1]. However, the clinical utility of CsA is often limited by the frequent occurrence of chronic nephrotoxicity and the development of hypertension [2]. The adverse renal effect of CsA mainly can be divided into two patterns: histological and functional abnormalities. The nephrotoxicity is often characterized by renal dysfunction as evidenced by a rise in plasma creatinine, a decrease in creatinine clearance and reductions in sodium and potassium excretion due to reduction of glomerular filtration rate and renal blood flow [3]. The morphological damages observed due to CsA treatment are interstitial fibrosis, tubular atrophy, arteriolopathy which later progresses to renal impairment [3]. In addition, CsA is suggested to trigger a chain of events that result in glomerular capillary hypertension and hyper-filtration. These effects may play a major role in the pathogenesis of proteinuria which is suggested to be mediated by a constellation of haemodynamic, oxidative and inflammatory reactions [4]. These are in part, driven by local angiotensin II type 1 (AT1) receptor activation by angiotensin II [4]. In relation to that, evidence is provided for the key role played by renin-angiotensin system in the progression of renal disease [5, 6]. The exact mechanisms of CsA induced hypertension and nephrotoxicity remains to be elucidated. Several studies have reported that CsA induced hypertension is associated with increased sympathetic nervous system activity [2, 7, 8]. In 1857
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
addition, changes in the vascular reactivity in response to noradrenaline after CsA treatment have also been reported [9]. It is further suggested that CsA directly affects the release of neurotransmitter from nerve endings and results in an increase in intracellular calcium release [10]. A decrease in the vascular sensitivity to noradrenaline has been reported in CsA induced-renal failure in rat [9]. Furthermore, a decrease in the vascular response to phenylephrine was shown in aorta from rats treated with CsA [11]. A vast number of studies have reported the role of α1-adrenoceptors in various diseased models, however, there is little of information on the functional contribution of α1- adrenoceptors in the regulation of renal haemodynamics in CsA induced-nephrotoxicity in rats. Hence, this study sets out to explore the hypothesis that CsA treatment may cause the deleterious effect on renal excretory function, impairs renal haemodynamics and alters the renal vascular sensitivity to angiotensin II and adrenergic agonists. Subjects and methods Animals Sixteen male Sprague-Dawley (SD) rats were procured from the Central Animal Facility of Universiti Sains Malaysia, Penang, Malaysia. The initial body weight of rats upon arrival ranged between 180 and 230 g. All experiments were performed in accordance to the approval of the Animal Ethics Committee of Universiti Sains Malaysia. Firstly, all rats were allowed to acclimatize to the environment in the animal transit room for a period of 7 days in a standard condition (25ºC, 60-70% humidity) with a 12h:12h day light dark cycle [12, 13]. All animals had free access to water and commercial rodent chow (Gold Coin Sdn. Bhd., Penang, Malaysia). The rats were then assigned into two groups. Control (C; n=8) and CsA treated (CS; n=8) and continue to receive standard chow and tap water ad libitum. Induction of renal failure was done by administration of CsA (Neoral®, Novartis, Basel, Switzerland) p.o. at a dose of (25 mg/kg/day) as previously mentioned for a period of 21 days [14]. 1858
Measurements Body weight, fluid intake, urine excretion and conscious blood pressure of each rat were measured weekly throughout the 21 days treatment period. Blood and urine samples were collected on every week from rats placed in metabolic cages (Nalgene®, Thermo Scientific, Philadelphia, USA) for 24 hours. The collected samples were immediately frozen at -30 ºC for further analyses of sodium, potassium, total protein and creatinine content. Creatinine clearance (CrCl), fractional sodium excretion (FENa+), fractional potassium excretion (FEK+) and glomerular filtration rate (GFR) were calculated using standard equations and studied. The kidney index (KI) was also measured using both left and right kidneys from the rat on day 22 after the acute vasoconstriction experiment [15], the right kidney which was not exposed to exogenous agonists was collected and stored in 10% formalin for histological examination using heamatoxylin and eosin staining. Blood Pressure measurements Systolic (SBP), diastolic blood pressure (DBP) and heart rate (HR) was measured in conscious rat using a tail cuff plethysmography (NIBP Controller, ADInstruments®, Sydney, Australia) every 7th day following a 3-day training period. The measurements were performed in a calm and dark room without applying external heat as previously reported [15]. An average of ten readings were taken from each rat with the difference of each reading not more than 5 mmHg are preferably selected. In addition, direct mean arterial blood pressure (MAP) measurements were also taken during the acute vasoconstriction studies in anaesthetized animals at the end of treatment period. Urine and plasma for renal functional estimations Immediately after the metabolic studies, urine and blood samples were collected and centrifuged at 2500 rpm for 5 minutes; to eliminate any precipitants in urine and blood samples. Then, plasma and urine supernatant were collected and kept fro-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
zen at -30ºC until analyzed. Creatinine and protein were measured using a spectrophotometric (Power Wave X340, Bio.Tek Instruments Inc., USA) method while sodium and potassium were measured using a flame photometer (Hitachi, Japan) [16]. Preparation of animals for acute renal vasoconstriction studies Acute renal vasoconstriction study was performed as previously described and the established method in this laboratory [15-17]. The animals were starved overnight but had free access to drinking water. Then, 60 mg/kg i.p. sodium pentobarbitone (Nembutal®, Sante Animale, Libourne, CEVA, France) were used to anesthetize the rats. The loss of conscious state was determined by the loss of reflexes of eyelid and when the tail was pinched. Following this, the animal was placed with its dorsal side on the surgical board. A tracheostomy was performed via a small incision in the neck region and cannulated (PE 240, Portex, Kent, UK) to provide clear air passage throughout the experiment. The left jugular vein was cannulated (PE 50, Portex, Kent, UK) as a preparatory line for maintenance dose of anesthesia or fluids whenever required. Another cannula was inserted into the left carotid artery and connected to a pressure transducer (Model P23 ID Gould, Statham Instrument, UK) which was linked to a computerized data acquisition system (PowerLab®, ADInstruments, Sydney, Australia) for continuous monitoring of blood pressure. A midline abdominal incision was done to expose the left kidney and its renal artery. This was followed by cannulation of the left common iliac artery and the cannula was pushed up to the level of the renal artery such that its beveled tip faces the entrance of the renal artery. This was necessary to ensure optimum close renal administration of agonists [18]. Noradrenaline (Sanofi Winthrop, Surrey, UK), phenylephrine (Knoll, Nottingham, UK), methoxamine (Wellcome, London, UK) and angiotensin II (CIBA-GEIGY, Basel, Switzerland) were administered via this cannula together with a continuous infusion of saline at a rate of 6 ml/kg/h. This cannula was attached to a second pressure transducer (model P23 ID Gould, Statham Instrument, UK) which
was also connected to a computerized data acquisition system (PowerLab®, ADInstruments, Australia) for the measurement of renal arterial pressure (RAP). One hour stabilization period was given after surgery before proceeding to agonist administration. Baseline levels of MAP, RAP and cortical blood flow (CBF) was recorded before and following graded bolus doses of noradrenaline (NA; 25, 50, 100 and 200 ng), phenylephrine (PE; 0.25, 0.5, 1 and 2 μg), methoxamine (ME; 1, 2, 3 and 4 μg) and angiotensin II (Ang II; 2.5, 5, 10 and 20 ng). Administrations of the agonists were carried out twice in an ascending followed by descending order to obtain an average response [14, 15,[19]. Upon completion of the haemodynamic study, the contralateral kidney, which was not exposed to agonists was collected and preserved for histological study. Statistical analysis The changes in CBF in response to adrenergic agonists were taken as the difference between the baseline values and the maximum drop in CBF in response to vasoconstriction effect of agonists. Measurements were determined off-line using (Lab Chart 6, ADInstruments, Sydney, Australia) software. Changes of CBF were expressed as percentage of the average base-line value of both ascending and descending responses. Data were presented as mean±S.E.M. Statistical analysis of the metabolic and heamodynamic studies and other data were performed under one- and two-way ANOVA followed by the Benferroni post hoc test using the statistical package (Superanova, Abacus In., CA, USA). The differences between the means were considered significant at 5% level. Results Metabolic and renal functional parameters Table 1 and table 2 summarize the metabolic and renal functional data for each group of animals. CS rats significantly decreased in body weight by approximately 20% (P<0.05) compared to C rats. Besides that, chronic treatment of CsA reduced the 1859
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
fluid intake by the rat about 12% (P<0.05) after 21 days. SBP, diastolic blood pressure (DBP) and MAP were significantly elevated (all P<0.05) at day 21 of treatment by about 15%. In renal functional studies, CsA treatment significantly decreased (P<0.05) CrCl ability in CS rat, where such phenomena started to onset after day 7 of the CsA treatment. A similar observation was also seen for FENa+ in CS rats. FEK+ was also significantly reduced (P<0.05) but this is only observed after 14 days of CsA treatment period and afterwards. The GFR in CS rats was significantly reduced (P<0.05) compared to C rats, and this situation has also observed from day 14 of the treatment. In contrary, urine protein excretion (UPE) was significantly higher (P<0.05) in CS rats compared to C rats which was also observed starting from day 14 onwards. KI was significantly higher (P<0.05) by almost 30% in CS rats compared to C rats. Baseline haemodynamic parameters during acute renal vasoconstrictor study Table 3 presents the results of baseline values of CBF, HR, MAP and RAP. During acute studies, CS rats manifested lower (P<0.05) CBF compared to C rats by about 13%. However, HR in CS rats were 16% higher (P<0.05) than C rats. MAP reading taken during conscious state using tail cuff plethysmography method and acute vasoconstrictor studies was not much different. However, CS rats had higher (P<0.05) MAP values than C rats by about 16%. The RAP in CS rats were 18% higher (P<0.05) compared to C rats. Histopathology study Histopathological study was done using haematoxylin and eosin staining light microscopy method. CS rats exhibited apparent ultrastructural changes which have been clearly presented in (Figure 1b). Kidney from rat treated with CsA exhibited mild ischaemic tubular damage where sloughed epithelial cells in the lumen associated with the loss of brush boarder, tubular dilatation and flattening of epithelial cells of the proximal tubules were observed which is labeled as (5). Subcapsular area 1860
showed inflammation with abscess neutrophils and was surrounded by foamy macrophages, this is labeled as (4). Meanwhile, glomerular apparatus also showed deformation which is classified as striped interstitial fibrosis with thickening of the tubular basement membranes and Bowmen’s capsule; it is shown as (3). On the other hand, C rats showed normal architecture as shown in (Figure 1a).
Figure 1. Effect of 21 days treatment of 25 mg/ kg/day CsA-induced chronic nephropathy. (a) Photomicrographs of haematoxylin and eosin staining light microscopy in SD rat renal tissue from C group. (Magnification: 400x). [1] Indicate normal appearance of glomerulus; [2] indicate normal appearance of proximal convoluted tubules (b) Photomicrographs of haematoxylin and eosin staining light microscopy in SD rat renal tissue from CS group. (Magnification: 400x). There is severe degenerative lesion of the glomerulus [3] and tubular atrophy [5] mainly in subcapsular area [4] with abscess (neutrophils) inflammation surrounded by inflammatory cells and foamy macrophages.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 1. Effect of 21 days of CsA administration on body weight, fluid intake, tail-cuff blood pressure and kidney index during the metabolic study. Values are presented as mean±S.E.M, * indicates P<0.05 compared to Day 0. § indicates P<0.05 between C and CS groups. Data were analyzed by repeated measures ANOVA followed by Bonferroni post hoc test.
Parameter Body weight (g) Fluid Intake (ml/kg/day) SBP (mmHg) DBP (mmHg) MAP (mmHg) Kidney index (%) Group C CS C CS C CS C CS C CS C CS n 8 8 8 8 8 8 8 8 8 8 8 8 Day 0 229±7 244±4§ 36±1 32±4§ 118±3 111±2§ 74±2 92±3§ 100±2 98±2§ --7 247±6 248±6§ 31±2 22±3§ 117±3 118±2§ 96±3 94±3§ 103±3 102±2§ --14 260±8 221±8*§ 30±2 23±1§ 117±2 105±1§ 97±3 86±2§ 104±2 113±2§ --21 271±8 215±9*§ 27±1 24±1§ 117±2 135±1*§ 93±2 110±2*§ 101±1 118±1*§ 0.33±0.01 0.43±0.01§
Table 2. Effect of 21 days of CsA administration on renal functional parameter including CrCl, FENa+, FEK+, GFR and urine protein excretion. Values are presented as mean±S.E.M, * indicates P<0.05 compared to Day 0. § indicates P<0.05 between C and CS groups. Data were analyzed by repeated measures ANOVA followed by Bonferroni post hoc test.
Parameter CrCl (ml/min/kg) FENa (%) FEK (%) GFR (ml/min/kg) UPE (mg/ml/kg) Group C CS C CS C CS C CS C CS n 8 8 8 8 8 8 8 8 8 8 Day 0 5.2±0.1 5.2±0.1§ 0.7±0.1 0.6±0.1§ 30.0±5.5 29.8±4.8§ 1.4±0.1 1.3±0.1§ 27.9±2.2 25.2±2.4§ 7 6.0±0.5 3.6±0.2*§ 0.8±0.2 0.3±0.1*§ 31.5±6.9 25.6±4.0§ 1.5±0.5 0.9±0.2§ 27.2±1.7 25.2±2.7§ 14 5.6±0.5 4.0±0.2*§ 0.8±0.2 0.1±0.0*§ 30.3±3.4 15.6±1.9*§ 1.5±0.5 0.6±0.2*§ 28.2±1.0 34.1±9.8*§ 21 5.1±0.2 3.4±0.1*§ 0.7±0.1 0.1±0.0*§ 29.0±4.8 10.9±1.1*§ 1.4±0.2 0.5±0.1*§ 25.8±1.9 49.3±1.3*§
Table 3. Effect of 21 days of CsA administration on haemodynamic parameters measured during the acute renal vasoconstrictor studies. § indicates P<0.05 between C and CS groups. Cortical blood flow (CBF); Heart rate (HR); Mean arterial blood pressure (MAP); Beat per minute (bpm); Blood perfusion unit (BPU). Data were analyzed by repeated measures ANOVA followed by Bonferroni post hoc test.
Parameter CBF (BPU/min) HR (bpm) MAP (mmHg) RAP (mmHg) n 8 8 8 8 Group C 181±8 263±18 99±6 92±3 CS 158±3§ 314±13§ 119±7§ 110±7§
Journal of Society for development in new net environment in B&H
1861
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Acute renal vasoconstrictor studies Noradrenaline (Figure 2a) depicted dose response curve for NA. Both C and CS group produced dose-dependent vasoconstrictions, with increasing responses as the doses were increased, the response was also increased. However, CS rats had less sensitive res-
ponse (P<0.05) compared to C rats. NA at 25 ng did not show any difference in the percentage drop in CBF between the two groups. Moreover, the vascular response to NA started to change when the dose of infused NA was increased gradually from 50 ng to 200 ng where by the CS group demonstrated a reduction (P<0.05) in cortical vasoconstriction response compared to C group.
Figure 2. Line graph shows dose response curve of the renal vasoconstrictor response to graded doses of NA, PE, ME and Ang II in C ( ) and CS ( ) groups. Values are shown in mean±S.E.M of n=8 rats in each group. * indicates P<0.05 with respect to each individual doses. Data were analyzed by two-way ANOVA followed by Bonferroni post hoc test. 1862
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Phenylephrine Intra-arterial administration of PE caused dose related renal vasoconstriction in both C and CS groups as shown in (Figure 2b). Intrarenal administration of 0.25 µg and 0.50 µg of PE did not manifest any changes in CBF. However, when 1.00 µg and 2.00 µg of PE was administered, the percentage drop in CBF in CS group appeared to be less sensitive (P<0.05) compared to C group. Methoxamine The methoxamine induced renal vasoconstrictor responses were presented in (Figure 2c). It was observed that in CS group, the vasoconstrictor responses due to ME were significantly reduced (P<0.05) compared to C group when progressively higher doses were administered. The small doses of ME, 1 µg and 2 µg did not exhibit any significant difference. In contrary, when high doses of 3 µg and 4 µg ME were administered, the CS group has significantly lower reduction (P<0.05) in CBF compared to C group. Angiotensin II Ang II caused dose related drops in CBF in CS group compared to C group and elicited a lower (p<0.05) cortical vasoconstrictor response in CS group compared to C group (Figure 2d). The smallest dose (25 ng) did not result in any significant difference between the studied groups. Nevertheless, when the dose of Ang II was increased from 50 ng to 200 ng, the vasoconstrictor response were proportionately reduced (P<0.05) in CS group as compared to C group. Interestingly, the observations of the vasoconstrictor response in Ang II are quite parallel to those seen when the adrenergic agonists were infused. Overall mean response of NA, PE, ME and Ang II (Figure 3) depicted the overall mean of responses from all doses of agonists employed du-
ring the renal vasoconstrictor response study. Ang II showed a 38% drop in CBF which is the most prominent reduction compared to others, subsequently, was followed by NA which showed 32% decrease in CBF followed by PE and ME. The overall mean response due to Ang II and NA were significantly smaller (P<0.05) in CS rats compared to C rats. However, PE and ME failed to show any significant changes in the vasoconstrictor response between the studied groups.
Figure 3. Bar graph shows the overall % drop in the renal CBF in response to NA, PE, ME and Ang II in C and CS rats. The overall mean is calculated as mean of all response due to 4 doses of each agonist. Values are presented as mean±S.E.M of n=8 rats in each group. * indicates P<0.05 between C and CS groups with respect to each types of agonists. Data were analyzed by T-test followed by Bonferroni post hoc test. Discussion The kidney is affected by many drugs and chemicals, some of which contribute to renal insufficiency and thus considerably to health care cost. The present study yields additional information that suggested 21 days administration of CsA induced renal dysfunction, morphological alteration in the kidney and hypertension in rats. Treatment with CsA was also found to be associated with systemic and renal vasoconstriction, ultimately leads to arterial hypertension [20]. In addition, an increasing body of evidence had suggested 1863
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
that long term administration of CsA may reduce the renal vascular responses to adrenergic and Ang II agonists [14]. In fact, such a situation has manifested because the renal circulation is richly endowed with sympathetic nerves that allow autonomic nervous system to regulate the renal haemodynamic and tubular function as well as body fluid homeostasis and blood pressure [19, 21]. Therefore, sympathetic nerves found in the renal system always playing a major role in maintaining the kidney functions in different disease condition. CsA administration resulted in reductions in body weight and also water intake, a marked decreased in CrCl together with a fall in GFR. The reduction of body weight was mainly due to the loss of body fluid via urination [22]. However, the high dose of CsA administration might have been a factor although others have reported the reduction of body weight in low dose of CsA treatment in antioxidant deficient rats [23]. This finding was also consistent to that reported by others [1, 24]. In contrary, there was more than 5.6 fold decrease in fractional FENa+ and 2.6 fold of FEK+, which may indicate a remarkable increased in reabsorptive capacity although others have reported sodium depletion to be associated with CsA treatment [25]. Hence, sodium reabsorption can be suggested to be the causative factor that leads to an increased blood pressure in this model [1]. The elevation of blood pressure can also be associated with the activation of reninangiotensin system (RAS) when urinary excretion of sodium is impaired by CsA. Moreover, another argument that can be put for the above situation was due to the vasoconstriction of renal arterioles that causes the reduction in blood perfusion pressure. This phenomena could actually contribute to sodium retention and therefore, a rise in blood pressure [8]. Furthermore, the participation of AT1 receptor stimulation could also augments the tubular sodium reabsorption in the kidney [26]. Moreover, evidence also exists for the effect of disturbed renal sodium handling on CsA-induced hypertension in patients with kidney disease [27]. Furthermore, the KI in CS group showed an increase by 1.3 fold compared to C group which indeed indicating glomerular hyper-proliferation. [28]. In addition, 1.9 fold increase of UPE was reported in this study. There were plenty of evidences reported on a potential nephrotoxic potential for 1864
proteinuria where such lines of evidence generally fall into two main conditons, namely, mesangial toxicity as a result of mesangial overload with anomalous filtered macromolecules. The induction of proximal tubular cell dysfunction as a results of excessive amount of protein that was observed in proximal tubular brush boarder may also account for the abnormal UPE. Indeed, this latter view is supported by the histological observation, where the proximal convoluted tubules and glomeruli showed clear destruction of their structural integrity. The mesangium that exist in nephron regulates single nephron glomerular filtration rate. However, when the destruction occurs in glomeruli, contraction of the mesangium will close and prevent perfusion of anatomically associated glomerular capillary loops, these results in decreased surface area available for glomerular filtration and reduced the glomerular ultrafiltration coefficient [29]. Reduction of CrCl resembles significant increase in plasma creatinine levels, conferring that CsA indeed causes glomerular dysfunction. Therefore, histologically distinguishable damage was seen in the present experiment settings and is in agreement with others [8, 30, 31]. It has been previously described that there was a correlation between the degrees of proteinuria to the rate of progression of renal failure. The existence of abnormally filtered proteins may interact adversely with the mesangium or with the cell lining the tubular space which will further enhance glomerular and interstitial damage [28]. This is brought by the infiltration of macrophages and deposition of extracellular matrix protein in mesangial cells [32]. Accumulation of these macromolecules produced mesangial cell proliferation and glomerulosclerosis [33]. CsA is classified as calcineurin inhibitor as it will bind to cyclophilin to inhibit phosphatase calcineurin, and thereby prevents the dephosphorylation of nuclear factor of activated T-cells that is essential for upregulation of messenger ribonucleic acid (mRNA) [34, 35]. Thus, CsA interferes with the synthesis of many lymphokine mediators, particularly interleukin-2, which is critical for T-lymphocyte proliferation and maturation where macrophages were activated [34, 35]. Therefore, the observation in the histological study is well evidenced in line with previous reports by the occurrence of proteinuria in renal failure state [14, 34].
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The adrenoceptors that mediate the action of renal vasoconstriction exist in several subtypes, but at the level of nephron the α1-adrenoceptors subtypes have been shown to be functionally relevant [16, 18, 19] . In the current study, the contribution of α1-adrenoceptors in controlling the adrenergically induced renal vasoconstriction response in anaesthetized rats was investigated. The baseline CBF in CS rats before administration of any exogenous agonists was approximately 13% lower than the C rats. As it was mentioned before, the blood flow in the cortex of the kidney constitutes ~90% of the total renal blood flow, interestingly, the finding from this study is well in accordance with the notion that CsA treatment reduces renal blood flow [36]. This indicates the pernicious effect of long term CsA administration tending to cause local haemodynamic changes in the rats’ kidney. CsA administration was associated with a marked vasoconstriction on renal arteries [36]. The attenuation of renal cortical vasoconstriction in response to exogenous Ang II and adrenergic stimuli were observed in CS rats compared to C rats. There was a significant reduction in the vascular response to exogenous NA but not to PE and ME. It has also been shown in earlier study that there is a reduction in responsiveness to NA and ME in spontaneous and renal hypertensive rats [37]. This may be due to the enhancement of sympathetic activity which is observed in renal failure [38]. CsA stimulated activation of the sympathetic system has been linked to hypertension and to systemic and renal haemodynamic abnormalities caused by this drug [7]. One proposed mechanism by which CsA stimulates sympathetic activity is the augmented NA release from terminal nerves of the kidney [39]. In relation to that, CsA induced hypertension seems to be caused in part by sympathetic overactivity with neurogenic vasoconstriction. However, the underlying mechanism by which CsA activates the sympathetic nervous system is not well understood [40]. This study therefore provides an insight on the effect of CsA on the renal vascular sensitivity to adrenergic agonists and the key role played by α1adrenoceptor in renal failure. However at this stage, it is not sufficiently understood which specific subtype of α1-adrenoceptor is potentially involved in mediating renal vasoconstriction in this model. A previous study from our team has indicated the
significance of α1-adrenoceptors in regulating rat renal haemodynamics either in normal or renal failure condition associated with hypertension [18]. The current study has shown a reduction in the renal vascular sensitivity to Ang II. According to Nishiyama et al., 2003, CsA activates renal sympathetic nerve activity and creates hyperactivity of RAS in renal failure rats and consequently results in down-regulation of AT1 receptors [20]. This interestingly, explained the reduced sensitivity of the renal vasculature to Ang II. In addition, there was evidence which showed that Ang II was highly expressed in the kidney of renal insufficiency rats [4]. In relation to that, it is suggested that CsA treatment induces Ang II production but through unknown mechanisms. However, the sympathetic stimulation brought by CsA may be the reason for increased intrarenal Ang II production [20]. Avdonin et al., 1999, showed that 24 hours treatment of CsA caused an increase in Ang II binding in vascular smooth muscle cells without changing its affinity. This suggested an enhancement of Ang II receptor expression in kidney failure condition. Furthermore, it has also been reported that mRNA expression of AT1 receptor in the aortic smooth muscle cells and endothelial cells were significantly increased in CsA induced hypertensive rats [41]. Thus, combination of elevated circulating Ang II levels and increased vascular AT1 receptor expression contributes to the renal vascular dysfunction and eventually leads to the development of hypertension in this model [42] . In the current study, treatment with CsA for 21 days was sufficient to increase the blood pressure by approximately 13%. A possible explanation for CsA induced arterial hypertension may be due to its action on the adrenergic system. CsA changes the vascular response to NA, and also affecting those α1-adrenoceptors by changing their transduction mechanism which directly stimulates a target on upstream G protein, possibly at the receptor level [43]. This activation results in a potentiation of inositol phosphate formation and intracellular calcium influx thus, inducing vascular contraction. Another explanation is the activation of afferent impulses from the diseased kidney to central integrative structures in the brain to cause increased sympathetic nerve discharge and eventually contributes to hypertension [44]. 1865
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
It is concluded therefore that CsA induced-renal failure is associated with derangement of renal excretory functions together with blunted renal vascular sensitivity to Ang II and adrenergic agonists. The hyperactivity of sympathetic and reninangiotensin systems are suggested to be responsible for decreased renal vascular response in this model of renal insufficiency. Acknowledgements USM Fellowship from institute of graduate studies (IPS) of Universiti Sains Malaysia is gratefully acknowledged for financial support. Many thanks to the Clinical Pathologist, Associate Professor Dr.Gurjeet Kaur Chatar Singh from Institite for Research in Molecular Medicine (INFORMM), USM for reviewing the histopathology section. We also appreciate for the skillful technical assistance from the Advance Medical and Dental Institute (AMDI) USM for technical support in the experiment. References
1. Satyanarayana PS, Chopra K. Oxidative stressmediated renal dysfunction by cyclosporine A in rats: attenuation by trimetazidine. Ren Fail 2002; 24:259-274. 2. Andoh TF, Bennett WM. Chronic cyclosporine nephrotoxicity. Curr Opin Nephrol Hypertens 1998; 7:265-270. 3. Taler SJ, Textor SC, Canzanello VJ, Schwartz L. Cyclosporin-induced hypertension: incidence, pathogenesis and management. Drug Saf 1999; 20:437-449. 4. Vaziri ND, Bai Y, Ni Z, Quiroz Y, Pandian R, Rodriguez-Iturbe B. Intra-renal angiotensin II/AT1 receptor, oxidative stress, inflammation, and progressive injury in renal mass reduction. J Pharmacol Exp Ther 2007; 323:85-93. 5. Taniyama Y, Griendling KK. Reactive oxygen species in the vasculature: molecular and cellular mechanisms. Hypertension 2003; 42:1075-1081. 6. Scholey JW. Angiotensin II and the glomerulus: focus on diabetic kidney disease. Curr Hypertens Rep 2003; 5:172-180. 7. Burdmann EA, Andoh TF, Yu L, Bennett WM. Cyclosporine nephrotoxicity. Semin Nephrol 2003; 23:465476. 8. Shihab FS, Andoh TF, Tanner AM, Bennett WM. Sodi-
um depletion enhances fibrosis and the expression of TGF-beta1 and matrix proteins in experimental chronic cyclosporine nephropathy. Am J Kidney Dis 1997; 30:71-81. 9. Roullet JB, Xue H, McCarron DA, Holcomb S, Bennett WM. Vascular mechanisms of cyclosporin-induced hypertension in the rat. J Clin Invest 1994; 93:2244-2250. 10. Mikkelsen EO, Poulsen SH, Nyborg NCB, Korsgaard N, Sehested J. Difference between aortic and renal vascular reactivity in cyclosporin A treated rats and the effect of cicletanine. Naunyn-Schmiedeberg's archives of pharmacology 1992; 345:356-361. 11. Auch-Schwelk W, Bossaller C, Gotze S, Thelen J, Fleck E. Endothelial and vascular smooth muscle function after chronic treatment with cyclosporin A. J Cardiovasc Pharmacol 1993; 21:435-440. 12. Abdulla MH, Sattar MA, Abdullah NA, Khan MAH, Allah HHA, Johns EJ. Interaction between reninangiotensin system and sympathetic nervous system in the systemic circulation of conscious SpragueDawley rats. HealthMed 2010; 2:328-334. 13. Vitor EV, Oseas MF, Luiz Carlos DA, Celso F. Adult spontaneously hypertensive rats from the same laboratory present different baroreflex gain. HealthMed 2011; 5:258-264. 14. Amudha G, Josephine A, Mythili Y, Sundarapandiyan R, Varalakshmi P. Therapeutic efficacy of DLalpha-lipoic acid on cyclosporine A induced renal alterations. Eur J Pharmacol 2007; 571:209-214. 15. Abdulla MH, Sattar MA, Abdullah NA, Khan MA, Anand Swarup KR, Johns EJ. The contribution of alpha(1B)-adrenoceptor subtype in the renal vasculature of fructose-fed Sprague-Dawley rats. Eur J Nutr 2010; 1-10. 16. Armenia A, Munavvar AS, Abdullah NA, Helmi A, Johns EJ. The contribution of adrenoceptor subtype(s) in the renal vasculature of diabetic spontaneously hypertensive rats. Br J Pharmacol 2004; 142:719-726. 17. Khan AH, Sattar MA, Abdullah NA, Johns EJ. Influence of cisplatin-induced renal failure on the alpha(1)-adrenoceptor subtype causing vasoconstriction in the kidney of the rat. Eur J Pharmacol 2007; 569:110-118. 18. Abdul Sattar M, Johns EJ. Alpha 1-adrenoceptor subtypes mediating adrenergic vasoconstriction in kidney, one-clip Goldblatt and deoxycorticosterone acetate-salt hypertensive rats. J Cardiovasc Pharmacol 1994; 24:420-428. 19. Hye Khan MA, Sattar MA, Abdullah NA, Johns EJ. Influence of combined hypertension and renal failure on functional alpha(1)-adrenoceptor subtypes in the rat kidney. Br J Pharmacol 2008; 153:1232-1241. 20. Nishiyama A, Kobori H, Fukui T, Zhang GX, Yao L,
1866
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
21. 22.
23.
24.
25.
26. 27.
28. 29.
30. 31.
32.
33. 34.
Rahman M, Hitomi H, Kiyomoto H, Shokoji T, Kimura S, Kohno M, Abe Y. Role of angiotensin II and reactive oxygen species in cyclosporine A-dependent hypertension. Hypertension 2003; 42:754-760. Robertson JL. Chemically induced glomerular injury: a review of basic mechanisms and specific xenobiotics. Toxicol Pathol 1998; 26:64-72. Satyanarayana PSV, Chopra K. Oxidative stressmediated renal dysfunction by cyclosporine A in rats: attenuation by trimetazidine. Ren Fail 2002; 24:259-274. Wang C, Salahudeen AK, McClain M, Whitehead J. Lipid peroxidation accompanies cyclosporine nephrotoxicity: effects of vitamin E. Kidney Int 1995; 47:927-934. Kon V, Sugiura M, Inagami T, Harvie BR, Ichikawa I, Hoover RL. Role of endothelin in cyclosporineinduced glomerular dysfunction. Kidney Int 1990; 37:1487-1491. Rosen S, Greenfeld Z, Brezis M. Chronic cyclosporine-induced nephropathy in the rat. A medullary ray and inner stripe injury. Transplantation 1990; 49:445-452. Stroth U, Unger T. The renin-angiotensin system and its receptors. J Cardiovasc Pharmacol 1999; 33 Suppl 1:S21-28; discussion S41-23. Curtis JJ, Luke RG, Jones P, Diethelm AG. Hypertension in cyclosporine-treated renal transplant recipients is sodium dependent. The Am J Med 1988; 85:134-138. Burton C, Harris KP. The role of proteinuria in the progression of chronic renal failure. Am J Kidney Dis 1996; 27:765-775. Lieberthal W, Nigam SK. Acute renal failure. II. Experimental models of acute renal failure: imperfect but indispensable. Am J Physiol-Renal 2000; 47:F1-F12. Shihab FS. Cyclosporine nephropathy: Pathophysiology and clinical impact. 1996; In, p 536. Lim SW, Li C, Sun BK, Han KH, Kim WY, Oh YW, Lee JU, Kador PF, Knepper MA, Sands JM, Kim J, Yang CW. Long-term treatment with cyclosporine decreases aquaporins and urea transporters in the rat kidney. Am J Physiol Renal Physiol 2004; 287:F139-151. Hostetter TH, Olson JL, Rennke HG, Venkatachalam MA, Brenner BM. Hyperfiltration in remnant nephrons: a potentially adverse response to renal ablation. Am J Physiol 1981; 241:F85-93. Yoshida Y, Fogo A, Ichikawa I. Glomerular hemodynamic changes vs. hypertrophy in experimental glomerular sclerosis. Kidney Int 1989; 35:654-660. Liu J, Albers MW, Wandless TJ, Luan S, Alberg DG, Belshaw PJ, Cohen P, MacKintosh C, Klee CB, Schreiber SL. Inhibition of T cell signaling by immunophilin-ligand complexes correlates with loss
35.
36.
37.
38.
39.
40.
41.
42. 43.
44.
of calcineurin phosphatase activity. Biochemistry 1992; 31:3896-3901. Lassila M. Cyclosporine A-induced hypertension and nephrotoxicity in spontaneously hypertensive rats on high-sodium diet. 2000; Available at: http:// ethesis.helsinki.fi/julkaisut/laa/biola/vk/lassila/cyclospo.pdf. Zimmerhackl LB, Fretschner M, Steinhausen M. Cyclosporin reduces renal blood flow through vasoconstriction of arcuate arteries in the hydronephrotic rat model. J Mol Med 1990; 68:166-174. Turrin MQ, Ferrari M, De Moraes S. Spontaneous and renal hypertensive rats: responsiveness of isolated right and left atria to noradrenaline, isoprenaline and methoxamine. J Auton Nerv Syst 1994; 46:1-8. Nitta K, Friedman AL, Nicastri AD, Paik S, Friedman EA. Granular juxtaglomerular cell hyperplasia caused by cyclosporine. Transplantation 1987; 44:417-421 Fujii T, Sugiura T, Ohkita M, Kobuchi S, Takaoka M, Matsumura Y. Selective antagonism of the postsynaptic [alpha] 1-adrenoceptor is protective against ischemic acute renal failure in rats. Eur J Pharmacol 2007; 574:185-191. Lyson T, Ermel LD, Belshaw PJ, Alberg DG, Schreiber SL, Victor RG. Cyclosporine- and FK506-induced sympathetic activation correlates with calcineurin-mediated inhibition of T-cell signaling. Circ Res 1993; 73:596-602. Avdonin PV, Cottet-Maire F, Afanasjeva GV, Loktionova SA, Lhote P, Ruegg UT. Cyclosporine A up-regulates angiotensin II receptors and calcium responses in human vascular smooth muscle cells. Kidney Int 1999; 55:2407-2414. Kim S, Iwao H. Molecular and cellular mechanisms of angiotensin II-mediated cardiovascular and renal diseases. Pharmacol Rev 2000. 52:11-34. Tavares P, Martinez-Salgado C, Ribeiro CA, Eleno N, Lopez-Novoa JM, Teixeira F. Cyclosporin Effect on Rat Aorta [alpha] 1-Adrenoceptors and Their Transduction Mechanisms. J Cardiovasc Pharm 2002; 40:181. Hausberg M, Kosch M, Harmelink P, Barenbrock M, Hohage H, Kisters K, Dietl KH, Rahn KH. Sympathetic nerve activity in end-stage renal disease. Circulation 2002; 106:1974-1979. Corresponding author Tan Yong Chia, School of Pharmaceutical Sciences, Universiti Sains Malaysia, Penang, Malaysia, E-mail: samual_84@hotmail.com
Journal of Society for development in new net environment in B&H
1867
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Low-cost tools for microbial quality assessment of drinking water in South Africa
Luyt, C. D.1, Muller W. J.2, Tandlich, R.1
1 2
Division of Pharmaceutical Chemistry, Faculty of Pharmacy, Rhodes University, South Africa, Unilever Centre for Environmental Water Quality, Institute for Water Research, Rhodes University, South Africa.
Abstract Background: Monitoring capacity shortages exist around South Africa, leading to a lack of microbial data, which is needed to make public health decisions about drinking water quality. Aims and Objectives: To evaluate a combination of two low-cost tests as potential tool for microbial monitoring of drinking water quality, and detection of infrastructural and treatment problems in South Africa. Method: Opportunistic sampling was conducted using the H2S strip test and the heterotrophic plate count (HPC) between June 2008 and February 2010. Results: No public health risks were detected in Matlosana City, Fochville and eThekwini Municipality. Twenty eight percent of drinking water samples were faecally contaminated in Makana Municipality, where the HPC concentrations ranged from 5 to greater than 1500 CFU/mL. Combination of the results from the tests correctly indicated that insufficient treatment, microbial regrowth and/or pipe bursts were the likely sources of contamination. Implementation of a monitoring programme, involving the Makana municipal officials, the authors and community volunteers, has so far been dysfunctional due to insufficient involvement by municipal officials. Conclusions: The two tests used here provide a valuable tool for drinking water quality monitoring in South Africa. Results of statistical testing indicate that the rates of faecal contamination are significant. Key word: hydrogen-sulphide strip test, HPC, South Africa, drinking water quality 1868
Background Drinking water of inadequate microbial quality combined with low standards of sanitation rank amongst the leading causes of disease in Africa (WHO, 2002). Target 7C of the United Nations Millennium Development Goals seeks to halve the number of people without sustainable access to safe drinking water and basic sanitation by 2015 (UNMDG, 2010). By 2005, 86 % of South Africans had access to basic drinking water through household connections, communal taps or wells (Bogetić and Fedderke, 2005). However, pipe bursts are common at the household level (PMG, 2009), and communal drinking water taps suffer from poor maintenance (Haarhoff et al., 2009). Water-treatment works are often not operated properly which leads to production of drinking water with high levels of microbial contamination (Momba et al., 2006). Therefore even if the necessary infrastructure is in place, drinking water supply is often unreliable. This forces communities to turn to water resources of inadequate microbial quality to meet their drinking water needs (Momba et al., 2006; Gundry et al., 2009). Raw water from these resources must undergo a minimum treatment, such as boiling, addition of bleach or sand filtration, before human consumption (Murray et al., 2004), to avoid the risk of a disease outbreak upon consumption of the water. Treatment at the household level can, however, be time-consuming and bleach has been shown to be too expensive in poor households (Monyai, 2004). A combination of these factors increases the chances of waterborne disease outbreaks. This makes
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
regular monitoring of microbial quality an essential aspect of public health policy in South Africa. South Africa is currently divided into 19 Water Management Areas (National Water Act - NWA, 1998; Murray et al., 2004). The National Department of Water Affairs operates the National Microbial Monitoring Programme (NMMP) for surface water (Murray et al., 2004) and groundwater (DWAF, 2000; DWAF, 2006; Murray et al., 2007). Turbidity, pH and concentrations of E. coli are determined on a weekly or bi-weekly basis in selected areas and data are centralised in a specialised database (Murray et al., 2004; Murray et al., 2007). The aim of both NMMPs is to assess the risk of faecal contamination of water resources used to supply drinking water to the South African population. There are 278 tertiary catchments in South Africa. Given the financial and logistical limitations it is impossible to sample every single catchment in the context of the NMMPs. Therefore priority catchments, most at risk from faecal contamination of water resources, have been selected for sampling (Murray et al., 2004). Only areas at high risk of faecal contamination are sampled, and so large parts of South Africa are excluded from the regular monitoring of microbial water quality (Murray et al., 2004). In addition, there is an insufficient number of accredited laboratories to perform the necessary analyses in provinces of the Eastern Cape, Northern Cape, and Mpumalanga (SANAS, 2011). This leads to irregular monitoring of microbial quality for drinking water, or complete lack thereof in parts of South Africa (DWAF, 2005), i.e. making it impossible to assess the public health threats from drinking water consumption. However, water quality monitoring forms a part of the municipal health services in terms of the National Health Act (NHA, 2008). To meet the regulatory requirements where analysis infrastructure and financial resources are limited, microbial water quality testing should require low labour intensity, and minimum time and financial investments before and during implementation; with results that meet the minimum proficiency testing criteria (APHA, 1998; DWA, 2011). The H2S strip test can detect the presence/absence of faecal contamination in drinking water (Manja et al., 1982). It has been used in microbial water quality monitoring in isolated areas with limited infrastructural
and personnel availability (Sobsey and Pfaender, 2002; Mosley and Shapr, 2005). Detection of faecal contamination at low levels of indicator microorganisms such as E. coli has been cited as one of its major drawbacks (Sobsey and Pfaender, 2002). Measurement of heterotrophic plate count (HPC) allows for the assessment of treatment problems (e.g. insufficient chlorination) and infrastructural problems (e.g. pipe bursts); as well as the assessment of the risk to human health upon water consumption (DWAF, 1996). Both tests are straight forward; and can be performed by personnel with a wide range of professional backgrounds after relatively short training periods by (Mosley and Sharp, 2005). Aims and Objectives In this study, the authors seek to use the modified H2S strip test according to Venkobachar et al. (1994) and Sobsey and Pfaender (2002) and the measurement of HPC in detecting faecal contamination and diagnosing treatment and infrastructural problems, which affect microbial drinking water quality in selected areas of South Africa. Attempts are made to design a monitoring framework involving the community, academia and municipal officials in the sample collection and problem reporting process, thus decreasing operational costs of the microbial water quality monitoring system. Methods Preparation of the sampling kits The H2S strip test medium of Venkobachar et al. (1994) was used in this study after a modification which involved addition of deoxycholate (0.5 %, w/v) to decrease the frequency of false positive results by inhibiting the growth of non-faecal bacteria (Sobsey and Pfaender, 2002). All consumables and chemicals were purchased from Sigma-Aldrich (Johannesburg, South Africa), Merck (Pty.) Ltd. (Cape Town/Johannesburg, South Africa), EC Labs (Port Elizabeth, South Africa), or Chemstores at Rhodes University (Grahamstown, South 1869
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Africa). Unless otherwise stated, the purity of all chemicals was 99 % or higher, and all chemicals were used as obtained from the supplier(s). The H2S strip test kits (hereafter referred to as the sampling kits) were prepared as described by Genthe and Franck (1999) with several modifications. After drying at 54 ºC in a UFE 700 oven (Memmert, Schwabach, Germany) overnight, the sampling kits were further processed using one of two methods. In the first method, the sampling kits were closed with caps and stored away from direct sunlight and at room temperature until use. In the second method, further sterilisation was undertaken. The H2S strips with the media components were removed from the kits after drying at 54 °C and placed into a 2 L glass beaker over approximately 150 g of anhydrous Na2SO4. The beaker was then covered with aluminium foil and sealed with the autoclave indicator tape. The beaker was placed into the Model RAU-53Bd REX MED autoclave (Hirayama Manufacturing, Tokyo, Japan) and the contents were sterilised at 121 kPa for 20 minutes. The Na2SO4 was not in direct contact with the dehydrated H2S strip test medium and was used to prevent the adsorption of moisture by the strips and the release of the H2S medium components during autoclaving. Urine jars were removed from the oven and chemically sterilised with 70 % ethanol after cooling to room temperature. They were irradiated under a UV lamp with open caps inside a LA1200 BII laminar flow hood (Laboratory and Air Purification Services, Midrand, South Africa) for 30 minutes. After the autoclaving and cooling to room temperature, the H2S strips were aseptically transferred into the sterile urine jars and the caps were closed immediately to obtain the final form of the sampling kits. The sampling kits were then stored away from direct sunlight, at room temperature until use. To establish the length of time the finished sampling kits remained sterile was checked periodically by pouring 20 mL of sterile deionised water into the sampling kits prepared using both methods and undertaking the sampling process and incubations (see below). Using the first method, the sampling kits remained free of microbial contamination for up to 5 weeks after preparation. However, using the second method resulted in a 6 week contamination free period. These findings 1870
indicate that sterile sampling kits can be prepared without the need for an autoclave using only a low-cost oven that can be temperature regulated at around 50 °C. Municipalities in isolated areas are more likely to use the H2S strip test if the low-cost option for the preparation of sampling kits exists. Sampling using the H2S strip test Before the H2S strip test sampling, the tap in a particular household was opened and the water was allowed to run for 15-30 seconds. The sampling kit was opened and filled with 20 mL of tap water. The remainder of the sampling procedure, as well as sample incubation, was identical to that of Genthe and Franck (1999). Field blanks were prepared periodically in a similar manner using sterile deionised water. A sample was positive for faecal contamination if its colour turns black inside the sampling kit within 72 hours of sample collection. No contamination caused by the sampling process was detected throughout the study, as all of the field blanks were negative for faecal contamination. The authors collected selected samples in the Makana Muncipality, and all the samples from the Matlosana City, Fochville, and eThekwini Municipality. In addition, volunteers were recruited to assist with sample collection in the Makana Municipality. Recruitment took place amongst the staff of the Faculty of Pharmacy or Institute for Water Research at Rhodes University; and the final-year students in the Bachelor-of-Pharmacy Programme at Rhodes University. The volunteers sampled water in selected areas of the Makana Municipality. Before the first sampling test, all volunteers underwent a fifteen-minute training on the sampling procedure and kits‘ storage, after sampling. The ability to perform the sampling correctly was then tested for each volunteer at the end of training. One or two days before sampling, the volunteers were provided with the required number of sampling kits. They were then instructed to undertake sampling at specific locations and requested to deliver the samples back to one of the authors after sampling; and before the expiration of the 72 hours incubation period. Overall 120 samples were collected (110 by the authors and staff volunteers and 10 by student volunteers) between June 2008 and February 2010.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Sampling and enumeration of HPC If a H2S sample was positive for faecal contamination, then drinking water was re-sampled by the authors using the H2S strip test and a separate water sample was collected for HPC enumeration. Nitril gloves were worn on-site, the sampled tap and the outside of the sterile sampling bottles; and the outside of sampling kits were chemically sterilised with 70 % ethanol. The sample collection was identical to the H2S strip test method, while, and a sterile 500 mL polyethytlene bottle was also filled to the brim with tap water for HPC enumeration. The sampling bottle was capped immediately. It was then transported into the laboratory at 4 °C and kept at this temperature until microbiological analyses were performed. HPC was enumerated by spread-plating onto the yeast extract-glucose-tryptone agar (APHA, 1998). All inoculations were performed under aseptic conditions in a LA1200 BII laminar-flow hood; and the Petri dishes were subsequently incubated at 35 ºC for 48 hours, using a Labcon low temperature incubator LTIE 10 (Labmark, Johannesburg, South Africa). Results are reported as colony-forming units/1 mL (CFUs/mL). GPS coordinates were recorded for the sampling sites where HPC samples were obtained using Google Earth (Available at: http://www.google.com/earth/ download/ge/agree.html); or the Garmin GPS 76 (Garmin International, Kansas City, USA). Ethical clearance for the study No names, personal information or hygiene practices are discussed in this article. Thus no ethical clearance was required for conducting this study, as indicated by the communication with the Ethical Standards Committee of Faculty of Pharmacy at Rhodes University. Results Drinking water quality in Matlosana City, Fochville and eThekwini Municipality Opportunistic sampling was performed by the authors in Matlosana City (North-West province),
Fochville (North-West province) and eThekwini Municipality (Province of KwazuluNatal). Sampling in Matlosana City took place between 17th and 28th December 2008, when a total of 10 samples were collected from one donor household. Sampling in Fochville was carried out between 14th August and 7th September 2009 when a total of 10 samples were obtained from two donor households. Sampling in eThekwini Municipality took place from 30th November and 2th December 2009 when a total of 4 samples were obtained from two donor households. All samples were taken in middle-class suburbs and all were negative for faecal contamination. Based on this limited sample size, drinking water was microbiologically safe for human consumption in Matlosana City, Fochville and eThekwini Municipality during the study. Drinking water quality in Makana Municipality Sampling in the Makana Municipality was performed opportunistically between June 2008 and February 2010. The authors and volunteers collected 96 samples from 20 donor households and 5 residences on the Rhodes University Campus. Results of the H2S strip test indicated that around 28 % of drinking water samples were faecally contaminated. Fourteen sampling sites were initially positive for faecal contamination using the H2S strip test, and these were re-sampled within 48 hours. Thirteen samples were positive during the second sampling (re-sampling). The H2S strip test results and the respective HPC concentrations from this resampling only are summarised in Table 1, along the GPS coordinates of the re-sampled sites. Discussion The South African Department of Water Affairs operates the Blue Drop Programme which assesses the quality of water services in municipalities around South Africa (DWA, 2011). According to the respective evaluation guidelines 99 % of drinking water samples, taken in a given municipality must meet the South African National Standard for Drinking Water, i.e. must be free of faecal con1871
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
tamination (DWA, 2011). This means that concentration of E. coli must be below 0 CFUs/100 mL (SABS, 2006). Data from our laboratory show that the modified version of the H2S strip test used in this study provides positive results for the presence of faecal contamination if the concentration of E. coli is equal to 2 CFUs/100 mL (data not shown). Based on this fact and the requirements listed above, the municipality will be compliant
with the Blue Drop Programme guidelines if 1 % of drinking water samples is positive for faecal contamination using the H2S strip test. Based on the results from this study, 28 % of drinking water samples taken in the Makana Municipality were positive for faecal contamination using the H2S strip test (see above). Whether this value was significantly different from 1 % was tested using the z-test for the difference between two proporti-
Table 1. Results of the H2S strip test and the HPC concentrations from re-sampling at the sampling sites from the Makana Municipality, which were initially positive for faecal contamination
Sampling site Fingo Village New Street Rhodes apartments New Street Rhodes apartments 8 Cathcart Street The Greens Complex The Checkers complex Bathurst Street 2 Cathcart Street Fitzroy Park Jan Smuts House Chris Hani House Botha House John Kotze House De-Beers House
a
GPS coordinates S 33º 18’ 16.0’’ E 26º 32’ 38.5’’ S 33º 18’ 35.7’’ E 26º 31’ 21.5’’ S 33º 18’ 35.7’’ E 26º 31’ 21.5’’ S 33º 19’ 02.9’’ E 26º 32’ 01.5’’ S 33º 18’ 33.8’’ E 26º 31’ 26.3’’ S 33º 18’ 36.5’’ E 26º 31’ 25.3’’ S 33º 18’ 42.1’’ E 26º 31’ 37.0’’ S 33º 18’ 58.0’’ E 26º 31’ 57.6’’ S 33º 18’ 04.2’’ E 26º 31’ 39.0’’ S 33º 18’ 51.6’’ E 26º 30’ 55.7’’ S 33º 18’ 59.0’’ E 26º 31’ 48.6’’ S 33º 18’ 47.7’’ E 26º 31’ 05.1’’ S 33º 18’ 51.9’’ E 26º 31’ 06.5’’ S 33º 18’ 58.3’’ E 26º 30’ 39.6’’
Sampling Date 18/06/2008 18/08/2009 22/08/2009 23/08/2009 24/08/2009 24/08/2009 25/08/2009 27/08/2009 20/12/2009 18/02/2010 18/02/2010 18/02/2010 18/02/2010 18/02/2010
H2S strip testa 48 hours 39-48 hours 48 hours 48 hours 48hours 48 hours 24 hours 60 hours 48 hours 72 hours 72 hours 72 hours 72 hours Negative
HPC (CFUs/mL)b > 1500 > 1500 5 568 > 1500 135 250 400 986 > 1500 > 1500 > 1500 > 1500 1038
Guideline evaluationc 3 3 1 2 3 2 2 2 2 3 3 3 3 3
Results are times after which the H2S strip was positive, i.e. period after which black color development was observed, or the sample was reported as negative if no black colour development was observed after 72 hours since sample collection. b Reported as colony forming units in 1 ml of sample and represent a geometric mean of four replicate samples. c Health risk upon domestic use of the tested water: 1-No contamination detected as HPC ranges from 5 to 100 CFUs/mL, 2-Insufficient treatment, contamination after treatment and potential regrowth indicated, slight risk of waterborne disease exists upon domestic use of the water as HPC ranges from 100 to 1000 CFUs/mL; 3-Treatment breakdown, contamination after treatment or definite regrowth in the distribution system, increased risk ot waterborne diseases upon domestic use of water as HPC is above 1000 CFUs/mL.
1872
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
ons at a 5 % level of significance (UPA, 2010). The value of the test statistic z was calculated using the Microsoft Excel package software package (Microsoft Inc., Johannesburgm South Africa) and it was equal to 26.711. Distribution of z follows the normal distribution for large sample numbers such as 96 in this study (UPA, 2010). At a 5 % level of significance, the critical value of z is therefore equal to 1.960 (http://pegasus.cc.ucf.edu/~pepe/Tables.pdf). As a result, there was a statistically significant difference between the rate of faecally polluted drinking water samples required by the Blue Drop Programme guidelines and the rate observed in the Makana Municipality. The p-value was below 0.010. If the rate in the Makana Municipality is higher than 1 %, then the values of the z statistic should be higher than 1.645 at a 5 % level of significance (http://pegasus. cc.ucf.edu/~pepe/Tables.pdf). The above mentioned data show that this is indeed the case. Muyima and Ngcakani (1996) reported HPC concentrations ranging from 0.4 to 3.6 CFUs/mL in drinking water samples from the distribution network in the town of Alice, South Africa. Obi et al. (2007) reported HPC concentrations ranging from 1.6 to 15 CFUs/mL at the point of use in drinking water samples taken in the Limpopo and Mpumalanga provinces of South Africa. The HPC concentrations reported from this study far exceed the literature data from South Africa. The H2S strip test was shown to provide positive results if the HPC concentration is above 1 CFU/ml in 51 to 57 % of faecally-contaminated water samples (Genthe and Franck, 1999). Based on the values in Table 1, the respective value was equal to 86 % in this study. This observation is probably the result of different species composition of the H2S strip test bacteria in this study and the study of Genthe and Franck (1999). The South African Department of Water Affairs and Forestry has published water quality guidelines for domestic use (which includes drinking; DWAF, 1996). Using the guidelines and the measured HPC concentrations, an evaluation of the public health risk and diagnosis of infrastructural and treatment problems was done for the drinking water in Makana Municipality. Results of the evaluation are shown in the last column in Table 1. In 38 % of cases faecal contamination of drinking water probably resulted from insufficient treatment, possible recontamination or re-growth
of indicator microorganisms in the distribution infrastructure. This was indicated by HPC concentrations from 135 to 986 CFUs/mL. For 50 % of faecally contaminated samples, this was probably the result of a complete treatment breakdown, recontamination or definite re-growth of indicator microorganisms in the distribution infrastructure. Such conclusions are indicated by the HPC concentrations greater than 1500 CFUs/mL. The Waainek water Treatment works (capacity 9 000 m³/d) treats water from the Howieson’s Poort, Settler’s, Jameson and Milner dams (Doudenski, 2004). This water is then treated and filtered via the Waainek reservoir (2 250 m³), the two town filter reservoirs (7 500 m³) and a low level reservoir (3 000 m³) (DWAF, 2004). These supply water to the west of Grahamstown (DWAF, 2004). The eastern part of Grahamstown is supplied from the Glen Melville Dam through the James Kleynhans Water Treatment Works (10 000 m³/day) and finally from the Bothas’s Hill (7 000 m³), the Mayfield reservoir (3 000 m³) and the Tantayi reservoir (2 500 m³) (DWAF, 2004). The water is the distributed by gravity reticulation networks to the residences (DWAF, 2004). The Orange-Fish Government Water Scheme channels water into the Glen Melville Dam (DWAF, 2004). The Settlers/Howieson’s Poort Dam system is currently used to full capacity and thus any future water requirements have to be met by the Glen Melville Dam (DWAF, 2004). Results from Table 1 were communicated to the Makana municipal officials. At the same time, site visits were used to locate the source of microbial contamination. Pipe bursts were established as the sources of contamination at Fingo Village June 2008 and in all the samples from August 2009. Recontamination of drinking water in the distribution infrastructure was the most likely contamination cause, as the H2S strip test samples, taken at the James Kleynhans and the Waainek water treatment works were negative on both occasions. The respective HPC concentrations ranged from 15 to 50 CFUs/mL. During sampling in February 2010, one of the chlorinators at the Waainek water treatment works, supplying water to the Rhodes University campus broke down. Low levels of residual chlorine below 0.2 mg/L in drinking water distribution network led to re-growth of heterotrophic bacteria in the drinking water distribution infrastructure. 1873
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
It took the municipal officials between 1 and 3 weeks to eliminate the problems as indicated by the time it took to obtain a negative H2S strip test sample during follow-up visits to the sites. This maximum period of three weeks was also observed at Fingo Village in June 2008. Conclusions drawn based on the South African Water Quality guidelines and results of the investigations into the sources of the elevated HPC concentrations were in good mutual agreement. The study results also demonstrated the applicability of the combination of the H2S strip test and the HPC enumeration in tracing public health issues and infrastructural/ treatment problems in the Makana Municipality. Therefore no statistical testing was performed on the HPC data. Proposed monitoring framwework for the Makana Municipality as an outcome of the study results Based on communication with the Makana Municipality, their Department of Environment and Health is responsible for regular microbial water quality monitoring as stipulated by the National Health Act (NHA, 2008). The municipal officials indicated that samples for microbiological analyses were taken once a month and sent for analyses to accredited laboratories at Amatole Water or in the Nelson Mandela Metropolitan Municipality. Newspaper interviews from the local paper indicate that this was indeed the case month as of August 2010 (Mini, 2010; MacGregor, 2010). However, historical data on microbial drinking water quality were not provided when requested by the authors from the Makana municipal officials. Based on the findings from this study, the authors approached the municipal officials with a proposal for the development of a monitoring system for microbial water quality in the Makana Municipality. Staff from the Water and Sanitation Department, and the Department of Environment and Health at the Makana Municipality, would choose a number of relevant sampling points throughout the reticulation infrastructure. The number should be as low as possible to be manageable with regard to financial and logistical considerations. At the same time, it would also be large 1874
enough to provide a whole picture about microbial water quality throughout the municipal area of jurisdiction. The municipal staff would be further responsible for the recruitment of the volunteers. The authors, members of the academic community would be responsible for the preparation of the sampling kits and the HPC plates. They would develop recruitment materials that would explain the purpose of the monitoring programme, time requirements, and potential health risks to the prospective volunteers; as well as provide the necessary training to take samples. The volunteers would be responsible for sampling and delivery of samples to the authors for evaluation, after proper training. The authors would function as a hub for the distribution of sampling equipment, collection of samples and performance of HPC enumerations. If problems with microbial water quality were detected, the authors would communicate the results to the Municipal staff who would then take remedial action. A database of all results would be freely available to all participants as well as members of the wider public through a website and the local press. An exploratory meeting about this proposal took place in May 2009. This was attended by the Municipal Manager, Department Heads of Water and Sanitation, and the Environment and Health from the Makana Municipality, the corresponding author, and several local NGOs. The idea of the monitoring framework was well received and considered of great potential benefit to Makana Municipality. The authors were requested to conduct a literature review to address the following points: legal requirements for appointment of volunteers, and provide examples of similar programmes from around the world which could be used as guidelines for implementation, involvement of DWAF and validity of the results. A budget was also requested. The National Water Act states that only authorised people apppointed by the Minister can monitor water quality and perform duties (Water Act 1998 Chapter 13, Part 1, article 124 &125). When volunteers are appointed then they have the rights stipulated by their appointment certificate to access the property. The DWAF director needs to appoint volunteers before they can be used for monitoring (Rossouw and Februarie, 2006). In
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
the case of Makana Municipality this would be the Director based in the King Williams Town Office, Eastern Cape province, South Africa. The monitoring programme could be modelled on the Philipppine Water Watch, which involved farmers in microbial water quality monitoring (Rossouw and Februarie, 2006). The population involved in that programme had a similar standard of living and literacy levels to that in Makana Municipality. Based on the prices of consumables and the community engagement by the authors, the total cost of the programme was estimated at 8000 ZAR or 1200 USD, annually. The updated proposal was communicated to the municipal officials in August 2009. No further communication has been received by the authors from Makana Municipality after this date, in spite of several requests for an update by the authors. Independent funding is currently sought by the authors to test this volunteerbased monitoring framework without municipal or DWA involvement. Study limitations Sampling conducted in this study was opportunistic due to limited funding available to the authors. This might have affected the sampling size. Further research will be conducted once additional research funds become available and the geographical scope of the study will be widened to address the sampling size issues. The intermittent involvement of the municipal staff from Makana Municipality led to the lack of implementation of the proposed monitoring framework, despite clear benefits to the public health in the area. Change of the implementation strategy for the above-mentioned system will have to designed probably involving non-governmental organisation. Conclusion Opportunistic, albeit limited, sampling showed that drinking water quality in Matlosana City, Fochville and eThekwini Municipality did not pose any risk to public health. Thirty percent of samples from Makana Municipality were faecally contaminated and the HPC concentrations ranged
from 5 to greater than 1500 CFUs/mL. Pipe bursts and lack of chlorination, i.e. treatment breakdown, were the cause of contamination. One to three weeks were required for fixing of these problems, which puts public health at risk. A volunteer-based monitoring system for microbial water quality has been proposed, involving academia, municipal departments and the general public. The system has not implemented to date. The response time on part of the Makana municipal officials was found to be a major stumbling block. Therefore monitoring programme will be implemented first through collaboration with NGOs working on water resource strategies in the area. In this way, data will be collected on the usefulness of the proposed monitoring framework and later used to get involvement from the Makana municipal officials. Acknowledgements Although the research described in this article has been funded in part by the Water Research Commission of South Africa (Consultancy grant No. K8/806), it has not been subjected to the WRC's required peer and policy review and therefore does not necessarily reflect the views of the WRC and no official endorsement should be inferred. The authors would like to thank staff and student volunteers from Rhodes University for their help with sample collection. References
1. APHA, AWWA and WEF (1998). Standard methods for the examination of water and wastewater (20th Edition). APHA, Washington DC. 2. Bogetić, Ž., Fedderke, J. W. (2005). International benchmarking of South Africa’s infrastructure performance. University of Cape Town and the World Bank, Cape Town, South Africa. 3. Department of Water Affairs (DWA, 2011). Blue drop requirements 2011 South African Drinking Water Quality Incentive-based Regulation. View at: www.dwaf.gov.za/dir_ws/dwqr/Subscr/ViewNewsDoc.asp?FileID=127 (website accessed on 17th January 2011).
Journal of Society for development in new net environment in B&H
1875
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
4. Department of Water Affairs and Forestry (DWAF, 2006). Resource Directed Management of Water Quality Series (Sub-Series WQP 1). Available at: http://www. dwaf.gov.za/documents/other/wqm/rdmwqp1aug06. asp (website accessed 20th February 2010). 5. Department of Water Affairs and Forestry (DWAF, 2005). A drinking water framework for South Africa. View at: http://www.dwaf.gov.za/Documents/ Other/DWQM/DWQMFrameworkDec05.pdf (website accessed on 17th January 2011). 6. Department of Water Affairs and Forestry (DWAF, 2000). Prioritisation of faecally contaminated areas. Available at: http://www.dwaf.gov.za/iwqs/microbio/Document/prioritisefin2.htm (website accessed on 19th February 2010). 7. Department of Water Affairs and Forestry (DWAF, 1996) South African Water Quality Guidelines, Vol. 1 (Domestic Water Use), Pretoria, South Africa. 8. Doudenski, H. V. (2004). Albany Coast Situation Assessment Study: Main Report, Vol. 1 (Final). Report No. PWMA 15/000/00/0406. Department of Water Affairs and Forestry. Pretoria, South Africa. Available at: http://www.dwaf.gov.za/Documents/ Other/WMA/15/AlbanyCoastSASDec04.htm (website accessed on 18th February 2009). 9. Genthe, B., Franck, M. (1999). A tool for Assessing Microbial Quality in Small Community Water Supplies: An H2S Strip Test. WRC Report No. 961/1/99, 33 pages. to: Water Research Commission. by: Division of Water, Environment and Forestry Technology, CSIR, Stellenbosch, South Africa. 10. Gundry, S. W., Wright, J. A., Conroy, R. M. , du Preez, M., Genthe, B., Moyo, S., Mutisi, C., Potgieter, N. (2009). Child dysentery in the Limpopo Valley: A cohort study of water, sanitation and hygiene risk factors. Journal of Water and Health 7(2): 259-266. 11. Haarhoff, J., Rietveld, L. C., Jagals, P. (2009). Rapid technical assessment and troubleshooting of rural water supply systems. Kruger National Park: Proceedings of the 10th Annual Water Distribution Systems Analysis Conference. 12. Macgregor, D. (2010). Grahamstown water passes test. Daily Dispatch. 26 August. View at: http:// albanymuseum.blogspot.com/2010/08/grahamstown-water-passes-test-20100826.html (website accessed on 29th August 2010).
13. Manja, K. S., Maurya, M. S., Rao, K. M. (1982). A simple field test for the detection of faecal pollution in drinking water. Bulletin of the World Health Organisation 60(5): 797-801. 14. Mini, P. (2010). Grocotts Mail Online[online] 24 August. View at: http://www.grocotts. co.za/content/experts-question-water-qualityclaims-24-08-2010 (website accessed on 29th August 2010). 15. Momba, M. N. B., Tyafa, Z., Brouckaert, B. M., Obi, C. L. (2006). Safe drinking water still a dream in rural areas of South Africa. Case Study: The Eastern Cape Province. Water SA 32(5): 715-720. 16. Monyai, P. (2004). Health - related water quality and surveillance model for the Peddie district in the Eastern Cape. Water Research Commission, WRC Report No.: 727/1/04, Pretoria, South Africa. 17. Mosley, L. M., Sharp, D. S. (2005). The hydrogen sulphide paper strip test. South Pacific Applied Geoscience Commission, South Pacific Applied Geoscience Commission and WHO Technical Report 373. Suva, Fiji. Available at: http://www.pacificwater.org/userfiles/file/TR0373.pdf (website accessed on 10th December 2010). 18. Murray, K., du Preez, M., Taylor, M. B., Meyer, R., Parsons, R., van Wyk, E., Kuhn, A., van Niekerk, H., Ehlers, M. M. (2007). National microbial monitoring programme for groundwater research report. Water Research Commission, WRC Report No. 1277/1/04, Pretoria, South Africa. Available at: http://www.wrc.org.za/Knowledge%20Hub%20 Documents/Research%20Reports/1277-1-04.pdf (website accessed on 28th December 2010). 19. Murray, K., du Preez, M., Kuhn, A. L., van Niekerk, H. (2004). A pilot study to demonstrate implementation of the national microbial monitoring programme. Water Research Commission, WRC Report No. 1118/1/04. Pretoria, South Africa. Available at: http://www.wrc.org.za/Knowledge%20Hub%20Documents/Research%20 Reports/1118-1-04.pdf (website accssed on 28th December 2010). 20. Muyima, N. Y. O., Ngcakani, F. (1996). Indicator bacteria and regrowth potential of the drinking water in Alice, Eastern Cape. Water SA 24(1): 2934.
1876
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
21. National Heath Act No.61 of 2003 as amended 2008 (NHA, 2009). South African Government Gazette No. 31187. Available at: http://www.mangaung.co.za/docs/National%20Health%20Act. pdf or http://www.alp.org.za/bills/National%20 health%20amend%20bill%2065%20-%202008. pdf (websites accessed 10th December 2009). 22. National Water Act No. 36 of 1998 (NWA, 1998). South African Government Gazette No.20706. Available at: http://www.dwaf.gov.za/Documents/ Legislature/nw_act/NWA.pdf (website accessed on 10th December 2009). 23. Obi, C. L., Momba, M. N. B., Samie, A., Igumbor, J. O., Green, E., Musie, E. (2007). Microbiological, physico-chemical and management parameters impinging on the efficiency of small water treatment plants in the Limpopo and Mpumalanga Provinces of South Africa. Water SA 33(2): 229238. 24. Parliamentary Monitoring Group. (PMG, 2009). Cholera responses. Available at: http://www.pmg. org.za/report/20090204-department-health-department-water-affairs-forestry-responses-cholera (website accessed on 11th February 2010). 25. Portland State University (UPA, 2010). SingleGroup Statistical Tests with a Binary Dependent Variable. View at: http://www.upa.pdx.edu/IOA/ newsom/da1/ho_z-test.pdf (website accessed on 19th January 2011). 26. Rossouw, L., February, D. A. (2006). Guidelines for implementing volunteer water quality monitoring in South Africa. WRC Report No KV 175/06, Water Research Commission, Pretoria, South Africa. 27. Sobsey, M. D., Pfaender, F. K. (2002). Evaluation of the H2S Method for Detection of Fecal Contamination of Drinking Water. Water, Sanitation and Health, Department of Protection and the Human Environment, WHO report WHO/SDE/ WSH/02.08, Geneva, Switzerland. 28. Sonzogni, W., J. Standridge & M. Bussen (2002) Preservation and survival of E. coli in well water samples submitted for routine analysis. Final report DNR Project #166. Wisconsin State Laboratory of Hygiene, Environmental Health Division, Madison, Wisconsin. 48pp. View at: http://www. dnr.state.wi.us/org/water/dwg/gw/research/reports/166.pdf (website accessed on 14th May 2009).
29. South African National Accreditation System (SANAS, 2011). Accredited Bodies and Laboratories in the SANAS Directory. View at: http://www. sanas.co.za/directory/test_default.php (website accessed on 17th January 2011). 30. United Nations Millennium Development Goals (UNMDG, 2010). Millennium Development Goal 7.View at: http://www.undp.org/mdg/goal7.shtml (website accessed on 8th December 2010). 31. Venkobachar, C., Kumar, D., Talreja, K., Kumar, A. Iyengar, I. (1994) Assessment of bacteriological quality using a modified H2S strip test. Aqua (Oxford) 43(6): 311-314. 32. World Health Organisation (WHO, 2002). World Health Report 2002-Reducing risks, promoting healthy lifestyle. Who Press, Geneva, Switzerland. Corresponding author Tandlich R., Division of Pharmaceutical Chemistry, Faculty of Pharmacy, Rhodes University, South Africa, E-mails: g04l4089@campus.ru.ac.za; r.tandlich@ru.ac.za
Journal of Society for development in new net environment in B&H
1877
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Chaos and order: disrupted lives by depression
Modesto Leite Rolim Neto1,2, Alberto Olavo Advincula Reis1, Irineide Beserra Braga3, Cícero Hedilberto Filguêiras Macêdo4
1 2 3 4
Programa de Pós-Graduação em Saúde Pública, Universidade de São Paulo, Brasil, Departamento de Medicina, Universidade Federal do Ceará, Brasil, Grupo de Pesquisa “Suicidiologia”, Universidade Federal do Ceará, Brasil, Programa de Pós-Graduação em Residência Médica, Divisão de Cirurgia Geral, Universidade Federal do Ceará, Brasil.
Abstract Clinical observations indicate that suffering and psychic pain, by means of the repertory of languages established by depression, are associated to subjective experiences of commitment to well-being and the social recognition of this experience. The objective of this qualitative study is to understand how people interpret the meanings associated with depression and probable consequences of suicidal tendencies. 150 people, including adolescents and adults of both sexes, were investigated. Narrative interview and listening were the instruments adopted to understand the problem. Besides the patients, statements from family members and the medical team were analyzed. The target population consisted of all individuals instates of depression, with suicidal manifestations, or with a history of attempted suicide. Key words: Depression; Suicide; Society. Introduction We undergo in many stages of our daily life, experiences where we search for the meaning of words. In this context, we confront personal and collective difficulties, dualities, and expectations in the different situations in which words allow for dialogues on examining conflicts, chance, complaints and descriptions which guide individuals in their pain and psychic suffering. Alert to messages which seek to transmit and explain the harshness of secret areas, regions of non-listening, spaces of need, recurrences and narratives, we have been 1878
tracing during the course of our anxieties, reflections on the spaces of listening, for a determinate field of application: depression. What to say about pain which cannot be said? Pain of nothingness, simply of the emptiness of being, indescribable, incommensurable, and because of this, call the word in vain?[1] In this sense, words enter the field of listening lacking forms of recognition in that which bears the possible and the necessary, familiarity and its absence, repetition and contempt when pain and psychic suffering transform themselves into disease. A person is defined as being ill if there is agreement between his own perceptions of commitment to well-being and the perceptions of people around him. Becoming ill is a social process, which involves other individuals besides the patient.[2] The objective is not to force truths, meanings which these words may hold, but, faced with circumstances which arise, to reveal fragilities and anxieties, the movements of its elaboration, upon the emergence of voices, in the articulation of the gaps with the experienced. It is the gaps which confer ‘truth’ to the story, the narrative which would open space for another/Another, for a sensitive listening.[3] This discussion is interesting when we think about the concept of order and disorder, as well as the relation between both, on repositioning the personal and cultural meanings in the context of the language of suffering itself, which makes its presence in the bridge between the subjective experiences of commitment to well-being and the social recognition of these experiences.[2]
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The term depression may signify a symptom, which is but a part of innumerable emotional disorders, without being exclusive of any one of them, may signify a syndrome, represented by many and varied psychic and somatic symptoms or, may signify an disease, characterized by marked affective alterations.[4] Our interest was in defining it as the place for responding to bad experiences, in the dialogical interaction with its interpretations, effects and solutions in people’s lives. The process, however, of defining someone as ill contains words on self comprehension, as in the perceptions of others, that which is represented by suffering or in the interaction of both. Perhaps it is possible, at this moment, to recognize the role of listening as an appeal to what exists and seeks to communicate, normally implying a series of subjective experiences. As Psychologists, we have been selecting, through clinical observations, the difficulties that people face on manifesting their pain and psychic suffering, when emptiness, loss or need offer words on encountering mediation between personal experience and the meaning that these offered to their own selves. It is from this experience that will arise the particular interest for the language of suffering and its repercussions in becoming ill. Fundamental in this process, was perceiving that falling ill involves subjective experiences of physical and/or emotional changes and to what degree this provokes order and disorder in the conduct of individuals when mobilizing words to express helplessness. To support the emergency of the strange is to live an experience of deterritorialization with another, and of resistance created by the forces which act in this field, in this intersubjective relationship, we seek another territory, another option in life.[3] Thus, we attempt to comprehend the existing relation between being depressive and the level of comtempt contained in the individuals’ narratives, on recognizing their subjectivities, as well as the suffering encountered in the treatment of underpriviledged patients at Primary Health Care Clinics. The narratives represent cultural documents which emerge in moments of unexpected rupture in the flow of daily life.[5] The results of this study are revealing linear forms of translating the personal and cultural meanings concealed in the treatment of the depressive, that is,
on decodifying the words of commitment with the real nature of the suffering and its dimensions, characterizing as “passive” the pain and suffering which reside in that which wants to be translated. In studies developed in the mental health area at Auta Alves Ferreira Health Clinic (founded in 1971, associated with SUS (Brazilian Public Health System), with Clinical, Psychological and Odontological services), in the city of Aparecida, in the hinterland of the state of Paraiba, we encountered a population of adolescents and adults from both sexes, derived from the rural and urban zone, whose principal economic activities were handcrafts (hammocks, quilts, cushions, embroideries) and subsistence agriculture (corn, beans, and rice) as well as a small production of cotton, having a per capita income averaging $35.00 per month. In an attempt to better understand the experience of meeting these individuals, treatments for depression were discussed during their visits to the Health Clinic. In this case, it can be concluded that the narrative would be exercising basic forms of organizing the experience with that of depression, allowing for the search of meaning in that which affects and mobilizes feelings. The subjects of this relation arrive invested with a series of experiences, bearing marks which were acquired over their lifetime. It is these marks which may resurface at this meeting, and this is only possible there, whether with another as a support for these marks, or of ‘another’ capable of mobilizing these marks. All are bearers-proponents of an enigma. Of a ‘voice’.[3] At this same time, we received an invitation to act in the Clinical Psychology area at the Santa Cruz Municipal Hospital, (with 30 beds, functioning with an ambulatory, minor surgeries and a psychological treatment service), located in the Paraiba hinterland. With patients from the rural and urban zones, we verified that the Health Secretary is concerned with establishing standard forms of becoming ill, known as “disease of the nerves”, considering the factors involved in depression. We concentrated our activity in the aforementioned Hospital, in the dimension of listening to the real meaning of the symptoms associated with the idea of “nerves”. We noticed that the concept of nerves is associated to the forms of explaining pain and psychic suffering, in 46% of 1879
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
the subjects examined, in a population of 150 individuals. “Nerves”, however, puts the question of distance and approximation of the communication forms established in depression in the exposition of the narratives, assuming, however, a unique manner of explaining traumatic experiences, associated to the symptoms. It was from this experience that arose the interest for another clinical manifestation such as suicide, obliging us to better reflect on this question and the interchange with depression. Doctors frequently objectify the disorder and separate it from the life of the patient, in whom the disorder is imbedded. They concentrate on the pathology. Possibly not perceiving the real significance of the problem.[6] It is in this professional and academic direction that depression and suicide acquire the stature of a more elaborate research to reveal the listening, the familiar and the tragic. It is worthwhile, at this point, to mention that the demands observed in the voices which needed interpretation by means of the authentication of the disease, come to assume the character denominated as world configuration[7], as defining personality as a form of organizing individual subjectivity.[8] Thus, listening comes to constitute a decoder of what is obscure, confused and silent, to bring out the “sub” meaning from the conscience (that which is experienced, postulated, intentionalized as concealed.[9] That is, connected to the spaces of pain and suffering from which the individual seeks to communicate through the psychic. Understanding how individuals interpret depression and suicide and how they respond to them, constitutes the objective of our investigation. In this context, the study interprets the voices used by people in organizing this experience, principally that which confers them meaning. Such an interest was articulated about the words which the subjects employed in their visits to the Auta Alves Ferreira Health Clinic in the city of Aparecida, and Santa Cruz Municipal Hospital, in the city of Santa Cruz, both located in the hinterland of the state of Paraiba, about the components of their suffering and psychic pain. Such an encounter was linked to investigations. It was an invitation for reflection, curiosity, search; not to certainty, but to multiple voices, to polyphony.[10] 1880
Methods We assembled, by means of a cartography of symptoms associated with depression, the experience of the voices that interpret. This idea can be much more understood if we refer to the notion of cartography in the sense of providing a theoretical and political reading – concepts, absences, practices and effect, new meanings, an interesting model for interpretation.[11] In addition, we reconstructed the events linked to depression and to suicide, from the perspective of the patient. The narratives, however, were the focus of attention of the study, marking and searching for channels of communication established between the individuals’ pain and psychic suffering, revealing their experiences when expressing individual and social existence. We follow, therefore, six steps for its analysis[12]: 1. Detailed transcription of verbal expressions from the subjects of the study; 2. Division of the text into indexed and non-indexed subject matter. The indexed statements have a concrete reference to “who did what, when, where and why”, whereas the non-indexed statements go beyond the experiences and express values, judgements and all manner of a generalized “knowledge of life”; 3. Use of indexed subject matter from the text, in order to analyze the order of each individual’s experiences; 4. Investigation of the non-indexed dimensions of the text, such as “knowledge analysis”; 5. Understanding of the grouping and comparison among individual trajectories; 6. Comparison of cases and individual trajectories, within the context, and determination of similarities. This process allows for the identification of collective trajectories. Universe and Sample The study universe included 324 individuals 10 years of age or greater, who sought treatment in the referred study areas for the following disorders: depression, suicidal tendencies or attempted
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
suicides. Initially the following were performed: data gathering on the subjects during medical and psychological appointments, related to principal complaints linked to pain and psychic suffering; the selection of subjects was elaborated from registered cases of depression and from a history of attempted suicides, in the medical records of the previously-mentioned Primary Health Care locations. With this information, we began mapping our sample considering: - Number of visits to the Primary Health Care Service, when the complaint was the non improvement of previously reported symptoms; - Prolonged psychotropic drug treatment, with repercussions in the present; - History of two or more recurrences in the same year; - History of suicidal tendencies; - History of attempted suicide; - Prolonged psychological treatment. We constituted from this mapping, 03 inclusion criteria for the sample, taking into account the following indicators: - Being depressive; - Having suicidal tendencies; - Having a history of attempted suicide. 150 individuals who satisfied the inclusion criteria, were selected, including adolescents and adults from both sexes. At a subsequent moment, we recovered the words themselves and their meanings in that which is learned, experienced and shared in the dynamics of health services, pertaining to psychic disease. Interviews were conducted with a medical and psychological team.as well as with family members, in order to better understand the formation of events in the flow of pain
and psychic suffering. Results The perspective of individuals about their symptoms generally reveals keywords, used to explain what the subject feels, interpret the origin and importance of suffering, as well as the effects on his behavior, functioning as conceptual remnants. In these remnants, the symptoms represent specific forms for elaborating feelings about the vicissitudes resulting from pain and/or psychic suffering, placing them in a pattern which is recognizable in the language of depression. These help to provoke and legitimize the narrative, as well as the emotional response, in trying to explain the cultural, psychic and biological context into which they are inserted. Concerning this question, the words are inserted at the center of the reflections, as conductors of feeling, which implies perceiving them in their course through listening, in the reference involved between the person, in the exchange of conversations and reactions established in diagnostic evaluations, as well as in the treatment determined for the individual. Words are only the gestures, sounds, behavior or body posture which participate as consensual elements, in the flow of consensual coordination of behavior which constitutes language. Words are, however, forms of consensual coordination of behavior.[7] In this perspective, depression and suicide share a set of responses which denounce and contribute in creating a context, an ecology of ideas which energize themes, inquiries and metaphors.[9,13,14,15] We are led, however, to a reactivation of relationally thinking[23], the network or configuration of objective relations between positions which re-
Table 1. Cartography of depression dimensions (most frequent symptoms)
BIOLOGICAL (...) fatigue, (...) dizziness, (...) stomachache, (...) headache, (...) pressure in the head, (...) out of breath, (...) weakness, (...) lack of patience, (...) shaking, (...) insomnia, (...) tiredness, (...) palpitations, (...) despondency. (...) pessimism, (...) agitation, (...) poor memory, (...) distress, (...) desire to die, (...) feeling of guilt, (...) restlessness, (...) fear, (...) sadness, (...)self-depreciation, (...) lack of financial perspective, (…) few employment options, (...) nothing to do, (...) disinterest in spouse, (...) lack of leisure, (...) constant quarrels, alcoholism.
PSYCHIC CULTURAL
Journal of Society for development in new net environment in B&H
1881
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
leases the depressive process in that which guides the narrative of the symptom. We are accentuating the things instituted, their materiality, their forms of self-organization where resistance and perverse effects, neutralization and obstruction, autonomy and creativity are generated.[16] Our focus was on defining how these themes, inquiries and metaphors guide the narratives. This aspect seems very interesting to us, especially if we consider the cartography for conception of disease, in the context that it produces an intertextuality between concurrent concepts and discourses, to show that knowledge and action are interrelated[11], in the spaces which are defined as suffering or in the reactions to psychic pain. The conception of depression as an disease brings with it fragments of daily life. These likely constitute “maps” characteristic of transformations identified over the course of suffering or of the reactions to psychic pain, influencing the manner in which they express their complaints. They become useful representations, at the same time as they seek to form the images necessary for them to accurately describe/guide their vulnerabilities. Thus, the area of suffering and psychic pain was interpreted from a repertory of languages established by order and disorder, as a structure based on their meanings. If reality is not natural
and self-evident, more structured, it can also be destroyed, investigated, questioned.[10] Following this direction, translating the words, while manifestation of areas unique for each person, that which surrounds order/disorder, has characterized “baggage- words”[17], contextualized, faced with areas of pain and suffering, into its dualities and oppositions, description and compartments of psychic life, frequently concealed in private places. This implies a tematha when promoting themes which contain impulses and existencial options, linked to the search for knowledge[17], on rethinking the presence/absence of interlocutors, when depression and suicide cause a crossing of instabilities and fragmentations in the development of words and their meanings. We call attention to the thematas used in understanding the complaints which contribute to depression at the moment that words seek to explain the impulse points of the meanings, giving them directions over the disease. Discussion It is necessary to reorganize the words which enable us to think about how and why a person became depressed or attempted suicide, which enables
Table 2. Cartography of depression dimensions (Conception of the disease)
BIOLOGICAL PSYCHIC CULTURAL (...) head exploding, (...) no nerves, (...) constant nervousness, (...) buzzing in the ears all day, (...) lack of courage. (...) sad thing, (...) long time to get well, (...) it is of no use, (...) constant fatigue, (...) crying, (...) suffer in silence, (...) much suffering, (...) ache in the soul, (...) strange thing, (...) dying inside. (...) the old blue prescription (all psychotropic prescriptions are blue), (...) never get better, (...) wandering around after medicine, (...) it is the same medication, (...) living aimlessly, (...) hardship, (...) people not understanding what is the matter with you.
Table 3. Cartography of depression dimensions (Complaints/Temathas)
(...) dizziness, (...) tremors, (...) cold sweat, (...) body fatigue, (...) imbalance, (...) frog in the BIOLOGICAL throat, (...) buzzing in the head, (...) shortness of breath, (...) weakness, (...) headache, (...) tingling in the body, (...) accelerated heartbeat, (...) nausea, (...) sleeplessness PSYCHIC (...) distress, (...), emptiness, (...) loneliness, (...) abandonment, (...) desire to die, (…) negative thinking, (...) nerves, (...) nervousness, (...) weak concentration, (...) discouragement, (...) irritation (...) sadness, (…) anxiety, (…) agitation, (…) aggressiveness, (...) lack of perspective, (...) not loved (...) husband’s drinking, (...) family problems, (...) financial hardship, (...) love problems, (...) loss, (...) no employment, (...) lack of understanding, (...) death, (...) nothing to do, (...) lack of recognition
Journal of Society for development in new net environment in B&H
CULTURAL
1882
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
us to think about the language repertory derived from the culture in which this suffering occurred, expressed in a culturally specific manner.[5,18] This repertory can be understood as a hypomnemata – solid memory of things read, heard or thought[19] to the re-reading of the words, within the possibilities of contact with their meaning and significance. Individuals, principally through their complaints, employ words which include not only personal experience, but also the meaning that these acquire in relation to one another. Following this course, the metaphors of depression operated simultaneously with things read, heard and principally thought. The words encounter a substitute to create meaning, when faced with the discovery of experiencing the disease. The idea that they represent is of something that destroys, inside or beyond the mind, incorporating the intensity of their suffering and pain within the vulnerabilities to which they are exposed, principally when the deleterious effects of pain and/or suffering are mediated by social conditions and unfavorable contexts. In this course of private places, depression and suicide prevail as a sequence of referential
systems while sharing pain and suffering. Individuals and their feelings enter into areas of order and disorder, violation and diversity, absence of self and of others- and learn that, cumulatitively, they challenge their own uncertainties, by which the value of the word and of listening is put up for discussion. Life, at all its levels, is inextricably interconnected by complex networks.[20] The strategy would be a scenario of action which can be modified in function of the information, happenings, and the unforseen which occur during the course of the action.[10] Depression, however, acquires diverse points of interpretation concerning the daily experience of the disease, reorganizing it into the very words of experienced reality, represented as an disease of the nerves, of fear, of the soul, of death, of the heart, of negative things. Discourse responds to a clearly-heard virtuality, or in other words, the understanding of interpretation as a realization of meaning.[21] This presupposes, however, a particular relation with the equilibrium of the interlocutors, for the other meanings which will arise through the medication process, invested by the desire for improvement.
Table 4. Cartography of depression. (most frequent metaphors)
FIRE EXPLOSION DRYNESS (...) it is like a brush fire, everything is on fire, (...) my head is boiling, (...) there are moments when my body is in turmoil, like fire destroying everything, (...) my life is on fire, (...) my dreams go up in smoke, (...) it is like a bonfire inside me. (...) my heart almost explodes, (...) my head seems like it is going to explode, (...) I am going to explode with fatigue, (...) my life exploded, there is nothing left, (...) explosion is part of me. (...) everything dry, nothing in bloom, (...) it is pain hurting you, (...) from so much suffering I think my life has dried up, (...) depression is like the dam near my house that was drying up, (...) my mouth gets dry. (...) there is a voice saying, die, (...) I would like to end it all, (...) disappear, (...) put an end, (...) I grabbed a rope to die, (...) I took what I had to take, (...) death is like a leap, in an instant you are there, (...) a strange thing, saying die. (...) everything destroying, (...) your dreams, your life, your desires being devoured, corroded, (...) people become like caustic soda, (...) it is the desire to destroy like caustic soda.
DEATH CAUSTIC SODA
Table 5. Cartography of depression dimensions (meaning of the medication)
BIOLOGICAL (...) my body shakes, (...)I feel weak, (...) food has no taste , (...) I think this medication leaves an alarm clock in my heart, (...)I get dizzy. (...) it is knowing how to hope, (...) it is having a lot of patience, (...) it is controlled, (...) it makes us dependent, (...) I cannot live without my diazepam, (...) it is getting angry, (...) it is only being able to sleep with the medication, (...) it is years taking the same medication, (...) it is only lexotam, (...) it is diazepam 5mg, (...) diazepam 10mg, (...) it is improvement. (...) it is trying to ease the suffering, (...) search for doctors, (...) decrease the pain, (...) question the treatment, (...) possibility of a cure.
PSYCHIC
CULTURAL
Journal of Society for development in new net environment in B&H
1883
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Individuals possess their own repertories of suffering interconnected to the use of medication, which determines meanings with respect to subjective experiences of changes to the physiological and/or emotional level, as well as recognizing the very dependence to which they are exposed. The resulting pattern of this experience delimits the connection between the time and space which lead to risk and its repercussions on psychism. It is a fundamental problem for human society, involving a practical challenge, since solutions and theories must be found, for we need to explain what occurred, how it originated and what its history is. Thus, it leads to a search for meanings, which, in order to be recognized, must be interpreted.[21,22,23] References
1. Peres UT. Depressão e melancolia. Rio de Janeiro: Jorge Zahar Editores, 2003. 2. Helman CG. Cultura, saúde e doença. Porto Alegre: Artmed, 2003. 3. Kanaan DA-B. Escuta e subjetivação: a escritura de pertencimento de Clarice Lispector. São Paulo: Casa do Psicólogo/EDUC, 2002. 4. Ballone GJ, Neto EP, Ortolani IV. Da emoção à lesão: um guia de medicina psicossomática. São Paulo: Manole, 2002. 5. Becker G. Disrupted lives. Berkeley: University of California Press, 1997. 6. Finkler K. Physicians at work, people in pain. S.L.: Westview Press, 1991. 7. Maturana H. A ontologia da realidade. Belo Horizonte: Editora da UFMG, 1997. 8. Rey FG. Sujeito e subjetividade: uma aproximação histórico-cultural. São Paulo: Pioneira Thomsom Learning, 2003. 9. Barthes R, Havas R. Escuta. In: Enciclopédia Einauide. Oral/Escrito. Argumentação. Lisboa: Imprensa Nacional, 1987;139. 10. Schnitman DF. Novos paradigmas, cultura e subjetividade. Porto Alegre: Artmed, 1996. 11. Cortesão L, Stoer SR. Cartografando a transnacionalização do campo educativo: o caso português. In: Santos BS, organizador. A globalização e as ciências sociais. 2ª ed. São Paulo: Cortez; 2002. p. 382. 12. Jovchelovitch S, Bauer MW. Entrevista narrativa. In: Bauer MW, Gaskell G. Pesquisa qualitati-
13. 14. 15. 16. 17. 18. 19. 20. 21. 22.
23.
va com texto, imagem e som: um manual prático. Petrópolis, RJ: Vozes, 2002; 91. Guatarri F. Las tres ecologías. Valencia: Prétextos, 1990. Hayles NK. Chaos and order. Chicago/Londres: The University of Chicago Press, 1991. Morin E, Bocchi G, Ceruti M. Un nouveau commencement. Paris: Editions du Seuil, 1991. Santos BS. Uma cartografia simbólica das representações sociais. Rev Crít Ciênc Soc 1988;24:139-172. Morin E. O método IV: habitat, vida, costumes, organização. Porto Alegre: Sulina,1998. Kleinman A. The illness narratives: suffering, healing & the human condition. New York: Basic Books, 1988. Foucault M. O que um autor? Lisboa: Veja, 2002. Capra F. As conexões ocultas: ciência para uma vida sustentável. São Paulo: Cultrix, 2002. Figueiredo LCM. Escutar, recordar, dizer: encontros heideggerianos com a clínica psicanalítica. São Paulo: Escuta/Educ, 1994. Barros DD. Itinerários de uma dor emissária: loucura em territórios Dogon (oeste da África [Tese de Doutorado]. São Paulo: Universidade de São Paulo,1998. Bordeau P, Wacquant LJD. Réponses: pour une antropologie réflexe. Paris: Editions du Seuil, 1992. Corresponding author Modesto Leite Rolim Neto, Programa de Pós-Graduação em Saúde Pública, Departamento de Saúde Materno-Infantil, Faculdade de Saúde Pública, Universidade de São Paulo, Brasil, E-mail: modestorolim@yahoo.com.br
1884
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The Frequency of MRSA carriers in Health care workers in Gorgan, North of Iran
Somayeh Rahimi Alang1, Abolfazl Amini2, Fatemeh Cheraghali3, Alijan Tabbaraei3, Ezzat Allah Ghaemi3
1 2 3
Young Researchers Club, Gorgan Branch, Islamic Azad University, Gorgan, Iran, Laboratory Science Research Center, Golestan University of Medical Sciences, Gorgan, Iran, Infectious Disease Research Center, Golestan University of Medical Sciences, Gorgan, Iran.
Abstract Methicillin resistant Staphylococcus aureus (MRSA) is one of the most important pathogen in hospitals. Healthcare personnel are the main source of nosocomial infections and identification and control of MRSA carriers can reduce incidence of infections. The aim of this study was to determine the frequency of methicillin resistant Staphylococcus aureus (MRSA) and their antibiotic susceptibility profile among healthcare workers in Gorgan located in northern Iran. Three hundred and thirty three of healthcare workers were participated in this cross-sectional study in 2010. Samples were taken with sterile cotton swabs from both anterior nares. Swabs were plated onto Mannitol salt agar. S. aureus were identified by Gram stain, Catalase, Coagulase and DNase tests. MIC (micro dilution broth) method was used to determine resistance of strains to methicillin. Antimicrobial susceptibility pattern to other antibiotics was performed by diffusion method. Frequency of S. aureus and MRSA carriers among healthcare workers was 24% (80.33) and 3% (10.33) respectively. MIC of isolates was varied between 0.5 and 65.31 (39%) of cases were showed MIC of intermediate that ranged between 4 and 8. Penicillin and Imipenem resistance were seen in 97.5% and 1.4% of isolated S. aureus strains, respectively. Frequency of S. aureus carriers in healthcare workers in our area was median in compare with other region in Iran but the MRSA carriage in healthy staff was lower than most part of Iran. It would be considering to monitor healthy carrier staff because of high rate intermediate MIC in this group to prevent conversion to MRSA.
Key words: Staphylococcus aureus; MRSA; Healthcare Workers; MIC, Iran Introduction Hospital infections represent an important public health problem and they possess several factors. Microorganisms that cause these infections, has changed over the years. From the decade of the 80s, the gram positive microorganisms, especially the Staphylococcus aureus, have emerged as main causes of nosocomial infections.1 The ecological niche of S. aureus strains is the anterior nasal.2 About 20% of the population are carriers of S.aureus.3,4 This organism causes wide range of infections such as, bacteremia, septicemia, skin and soft tissue infections, bone infections, and pneumonia. They can be transmitted through direct contact and fomites.5 Colonization rate of this organism is higher in health care workers (HCWs) and are one of the important sources of Staphylococcus in hospital infections.3 HCWs that are involved in hospitals, are a major source of infection transmission in patients.1 About 25% of the health care workers are permanent nasal carriers, and 30% to 50% of them also possess the bacteria on their hands.4 In usual strains isolated from the hands is typically same as that in the noses.6 Occasionally, health care workers who carry S. aureus in their nares can cause outbreaks of surgical-site infections.4 Virulence and ability to acquire resistance to antimicrobial agents of Staphylococcus aureus results in a serious worldwide problem for hospitals and health professionals.3 1885
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
MRSA is a major worldwide nosocomial pathogen with severe morbidity and mortality, and is known as a multidrug-resistant. This is a big challenge in treatment of staphylococcal infections.7 MRSA is found endemically in many hospitals. The severity of Staphylococcus aureus diseases and cost of therapy justify an investment in prevention and control of this organism. Identification and treatment of Staphylococcus aureus carriers can reduce MRSA infections.3 The aim of this study was to determine the frequency of methicillin resistant Staphylococcus aureus (MRSA) and their antibiotic susceptibility profile among healthcare workers (HCWs) in 5Azar, Talqani and Dezyani hospitals in Gorgan. Methods This cross-sectional study, performed in three hospitals, in Gorgan north of Iran in 2010. Of 728 health care workers, 333 volunteers were participated in this study. Demographic information and length of employment recorded. The people who have taken antibiotic in last three weeks were excluded from sampling. Specimens were collected from the anterior nares with sterile dry cotton swabs and inoculated immediately onto Mannitol salt agar. Hands samples also were taken and cultured on Mannitol salt agar. The samples were sent to the laboratory less than 2 hours and incubated at 37oC for 48-72 h. Mannitol fermented colonies were identified as S. aureus based on morphology, gram stain, catalase, coagulase (by both slide and tube methods) and DNase test. S. aureus is a gram positive, catalase positive, coagulase positive and DNase positive bacteria. MIC by micro dilution broth method has been used for determination of methicillin resistant S. aureus, MIC between 4-8 µg/ml and MIC≤ 16 µg/ml considered as intermediate and methicillin resistant strains (MRSA) respectively.8,9 Susebtibility test to methicillin and other antibiotics was carried out by disc diffusion method (Kirby-Bauer) according to NCLS protocol. 14 antibiotics (HiMedia) including amoxicillin (30mcg), ciprofloxacin (5mcg), cephotaxime (30mcg), chloramphenicol (30mcg), erithromysin (15mcg), gentamicin (10mcg), imipenem (10mcg), methicillin (5mcg), nalidixic Acid (30mcg), penicillin (10units), tetracycline (30mcg), 1886
trimethoprim (5mcg), vancomycin (30mcg) were used in this assay. Isolated strains were cultured on Mueller-Hinton agar and above antibiotic discs placed with appropriate distance on plate with sterile pans. Plates were incubated 24h, at 37oC. Zone sizes of each antimicrobial agent was interpreted and reported as ‘Resistant’, ‘Intermediate’ and ‘Sensitive’ strains. Statistical analysis of data performed with X2 test and ANOVA and all cases with P<0.05 was considered significant. Results Participated HCWs were aged between 20-59 years old (35±8.2 years) that 80 of them (24%) were S. aureus carriers. From those 11 cases (13.8%) isolated only from their hands and in 58 cases (72.4 %) isolation were seen only in nose of S. aureus carriers. 11 cases (13.8%) of carriers were showed S. aureus in their nose and hands simultaneously. Results revels higher frequency of S. aureus carriage among physicians (34.8%) in compare with other groups (P=0.004). Frequency of S. aureus carriers in HCWs who had cold at the time of sampling, were significantly lower than healthy carriers (P=0.016). Our data shows high level of frequency of S. aureus carriage in the operating room (42.3%) in comparison to ICU with the lowest prevalence of S. aureus carriers (7.14%) that was significantly different (P=0.047). There was no significant difference between other variables such as age, sex, hospital, years of working of S. aureus carriers and non-carriers. Previous exposure of staphylococcal infections between two groups was not statistically significant. Further data is summarized in Table 1. Of 80 carriers of S. aureus, 10 (12.5%) of them were MRSA cases by micro dilution method. Thus prevalence of MRSA carriers in the community was 3%. One of the MRSA isolated cases was from HCW's hands and rest of them was isolated from their nose. The highest rate of MRSA carriers was from Dezyani hospital personnel, in compare with other hospitals. There was no any significant differences (P=0.07). Rest of data about MRSA strains and their relation with other variables such as wards, professional activity and gender is shown in Table 1. None of them were showed any statistical significance.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 1. Distribution of Staphylococcus aureus and MRSA carrier’s according to variables studied
Variables n Carrier status S.aureus, n (%) 43 (22.5) 18 (25) 19 (27.1) 30 (27.3) 50 (22.4) 37 (33) 35 (17.7) 8 (34.8) 14 (31.1) 66 (22.9) 11 (14.3) 68 (26.7) 11 (42.3) 6 (40) 16 (29.6) 24 (26.37) 6 (22.22) 10 (18.85) 3 (15.78) 3 (9.68) 1 (7.14) MRSA, n (%) 4 (2.09) 5 (6.94) 1 (1.4) 2 (1.8) 8 (3.5) 4 (3.5) 5 (2.52) 1 (4.37) 0 0 2 (20) 8 (80) 1 (3.8) 0 2 (3.7) 3 (3.2) 1 (3.7) 3 (5.35) 0 0 0
Hospital 5Azar 191 Dezyani 72 Talqani 70 Gender Male 110 Female 223 Professional Activity * Servants, Skilled attendence 112 Nurses, Midwifes, Technicians 198 Physician 23 Previous Staphylococcal Infection Present 45 Absent 288 Common cold * Present 77 Absent 255 Ward * Operating room 26 Pediatric 15 Emergency 54 General 91 Women Section 27 Surgery 56 Infectious 19 31 Laboratory 14 Intensive care unit MRSA, methicillin-resistant Staphylococcus aureus. * Difference in this group is statistically significant
Table 2. Antibiotic resistant pattern of MRSA, MSSA strains isolated from HCWs
Antibiotic MSSA (N = 70), (%) MRSA (N = 10), (%) Vancomycin 0 0 Imipenem 1.4 0 Ciprofloxacin 1.4 0 Gentamicin 4.3 0 Trimethoprim 7.2 0 Erithromysin 14.5 10 Tetracycline 11.6 20 Nalidixic Acid 33.3 50 Methicillin 66.7 80 Cephotaxime 60.9 90 Amoxicillin 91.3 90 Chloramphenicol 94.2 90 Penicillin 97.1 100 MSSA, methicillin-sensitive Staphylococcus aureus; MRSA, methicillin-resistant Staphylococcus aureus.
Journal of Society for development in new net environment in B&H
1887
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
MIC for methicilin was assessed by microdilution method. MIC of isolates was varied between 0.5 and 65. 10 strains (12.5%) were resistant to methicilin by MIC of 16-64. 31 of cases (39%) were showed MIC of intermediate that ranged between 4 and 8. By disc diffusion method highest rate of antibiotic resistance in both MRSA and MSSA cases was observed to penicillin, and 100% of MRSA strains and 97.1% of MSSA strains were resistant to penicillin. Antibiotics has been tested and their antibiogram results in both MRSA and MSSA strains is shown in Table 2. Discussion Prevalence of Staphylococcus aureus carriers in Gorgan's health care workers was 24%. As it compared in Table 3, similar studies in Iran has been shown vary data in different parts of country. As the prevalence is differ from 12.7% in Yazd,21 to extreme 45% in Meshgin shahr's HCWs.10 Infact Gorgan's HCWs with 24% Staphylococcus aureus carriers is mean in the country. Similar foreign studies also shown vary results from 13% to 47.06% in HCW Staphylococcus aureus carriers.2,3 Result of this study reveals average range of frequency of Staphylococcus aureus carriers in the world.
In contrast with some studies such as Sherertz who has been stated respiratory infections caused by cold viruses in S. aureus carriers, increases likely release of this organism,22 our data demonstrated lower frequency of S. aureus carriers in HCWs who had cold at the time of sampling. This finding was significantly lower than people who had not cold. It is not clear whether this is an antagonistic phenomenon between Staphylococcus aureus and common cold viruses or is an accidental phenomenon? Further studies need to be done to explain this inconsistency. Prevalence of MRSA carriers among health care workers was 3% in our study similar to Saderi's study with 2.87% frequency of MRSA that performed in Iran.17 But most of Studies in Iran such as searches performed by Nikbakht,10 Nafisi16 and Khalili,21 showed higher prevalence of MRSA Carriers with 16%, 13.23% and 7.6% respectively, however Karmastaji have gained 0% MRSA strains in her investigation on HCWs.20 Prevalence of MRSA carriers in HCWs in foreign countries has been ranged between 0.5% in Tambic study,23 to 18.3% in Alghaity study.24 In study that performed by Farzana on 129 HCWs prevalence of MRSA was 14%,4 in contrast with two studies was performed on 260 HCWs25 and 100 surgery ward staff,2 showed 2% MRSA carrier in HCWs. Another study was performed on 340
Table 3. Frequency of Staphylococcus aureus carriers in different areas of personnel in health centers of Iran
City Year Number of Staff S.aureus, n (%) MRSA, n (%) Meshkin shahr 2006 200 90 (45) 32 (16) Sanandaj 2001 118 51 (43) 19 (16) Qaem shahr 2003 100 36 (36) ND Tehran 2002 774 241 (31.1) 85 (11) Mashhad 2009 90 28 (31.1) ND Shiraz 2006 600 186 (31) 32 (5.3) Tehran 2006 253 65 (25.8) ND Shahrekord 2007 204 52 (25.5) 27 (13.23) Tehran 2002 348 87 (25) 10 (2.8) Gorgan 2010 333 80 (24) 10 (3) Ahvaz 2003 240 76 (22.5) 47 (17) Rafsanjan 2007 220 44 (20) 17 (7.6) Bandar abas 2008 200 33 (16) 0 Yazd 2006 742 94 (12.7) 57 (7.6) MRSA, methicillin-resistant Staphylococcus aureus; ND, Non Determined. Reference 10 11 12 13 14 7 15 16 17 This study 18 19 20 21
1888
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
HCWs's saliva demonstrated 4.1% MRSA carrier.3 Considering to these results, it seems prevalence of MRSA carriers in our area is relatively low. There was not seen any significant relationship between MRSA prevalence and factors assessed in this study such as age, gender, wards etc. However, number of MRSA isolation in nurses, midwifes and technicians personnel's was higher than other professions (14.3%) but this difference failed to be significant. In the case of disc diffusion antibiotic resistance to penicillin, chloramphenicol, amoxicillin, cephotaxime and methicillin is very high. In fact, most of strains were multi-drug resistant. On the other hand as we expected 100% of MRSA strains and 97.1% of MSSA strains were resistant to penicillin as it has been shown in de Carvalho study 100% of the MRSA strains were resistant to penicillin.3 Other researches such as Farzana's study was shown more than 80% resistant to penicillin of S. aureus carriers. And sensitivity and specificity of disc diffusion method in determining resistance to methicillin in this study, is 80% and 34.3% respectively. Sensitivity of MRSA and MSSA strains, to vancomycin, immipenem, ciprofloxacin, gentamycin, trimethoprim, and even erythromycin, is more remarkable and their use in empirical treatment of Staphylococcus infections can be considerable. Acknowledgments This research carried by financial support of infectious disease research center of Golestan university of medical science. References
1. Silva EC, Antas MG, Monteiro B Neto A, Rabelo MA, Melo FL, Maciel MA. Prevalence and risk factors for Staphylococcus aureus in health care workers at a university hospital of Recife-PE. Braz J Infect Dis 2008; 12: 504-508. 2. Vinodhkumaradithyaa A, Uma A, Srinivasan M, Ananthalakshmi I, Nallasivam P, Thirumalaikolundusubramanian P. Nasal carriage of methicillin-resistant Staphylococcus aureus among surgical unit staff. Jpn J Infect Dis 2009; 62: 228-229.
3. de Carvalho MJ, Pimenta FC, Hayashida M, Gir E, da Silva AM, Barbosa CP, et al. Prevalence of methicillin-resistant and methicillin-susceptible S. aureus in the Saliva of health professionals. Clinics 2009; 64: 295-302. 4. Farzana K, Rashid Z, Akhtar N, Sattar A, Khan J A, Nasir B. Nasal carriage of staphylococci in health care workers: antimicrobial susceptibility profile. Pak J Pharm Sci 2008; 21: 290-294. 5. Treakle AM, Thom KA, Furuno JP, Strauss SM, Harris AD, Perencevich EN. Bacterial contamination of health care workers’ white coats. Am J Infect Control 2009; 37: 101-105. 6. Blok HE, Troelstra A, Kamp-Hopmans TE, Gigengack-Baars AC, Vandenbroucke-Grauls CM, Weersink AJ, et al. Role of healthcare workers in outbreaks of methicillin-resistant Staphylococcus aureus: a 10-year evaluation from a Dutch university hospital. Infect Control Hosp Epidemiol 2003; 24: 679-685. 7. Askarian M, Zeinalzadeh A, Japoni A, Alborzi A, Memish ZA. Prevalence of nasal carriage of methicillin-resistant Staphylococcus aureus and its antibiotic susceptibility pattern in healthcare workers at Namazi Hospital, Shiraz, Iran. Int J Infect Dis 2009; 13: 241-247. 8. Japoni A, Alborzi A, Rasouli M, Pourabbas B. Modified DNA extraction for rapid PCR detection of methicillin-resistant Staphylococci. Iran biomed J 2004; 8: 161-165. 9. Gradie E, Valera L, Aleksunes L, Bonner D, FungTomc J. Correlation between genotype and phenotypic categorization of staphylococci based on methicillin susceptibility and resistance. J clin microbial 2001; 39: 2961-2963. 10. Nikbakht M, Hasannejad S, Rezazadeh B, Naghizadeh Baghi A, Ghorbani F, Faraji F, et al. Antibiotic resistance pattern of isolated strains of Staphylococcus aureus from personnel nasal specimens in Meshgin Shahr Valiasr Hospital. J Ardabil Univ Med Sci Health Services 2009; 9: 80-88. 11. Rashidian M, Taherpoor A, Goodarzi S. Nasal carrier rates and antibiotic resistance of Staphylococcus aureus isolates of Beasat hospital staff. J Kurdistan Univ Med Sci 2000; 21: 1-7.
Journal of Society for development in new net environment in B&H
1889
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
12. Ghasemian R, Najafi N, Shojaifar A. Nasal carriage and antibiotic resistance of Staphylococcus aureus isolates of Razi hospital personnel, Qaemshahr, 1382. J Mazandaran Univ Med Sci 2003; 44: 79-86. 13. Rahbar M, Yaghoobi M, Fattahi A. Comparison of Different laboratory methods for detection of methicillin resistant Staphylococcus aureus. Pak J Med Sci 2006; 22: 442-445. 14. Naderinasab M, Ghabouli MJ, Naderi HR, Zarif R, Gholoubi A, Saeid Hedayati E, et al. Nasal carriage of Staphylococcus aureus and its relation to hand contamination of the staff of Imam Reza hospital. Iranian J Otorhinolaryngology 2009; 21: 95-99 . 15. Zohorinia M, Soleimani E, Nobari H, Ahmadi K, Jafarian S, Bahmani N, et al. Frequency comparison of nasal and hand carriage of Staphylococcus aureus among the medical and non-medical staffs in Iranian Air Force Be' saat medical center. J Army Univ Med Sci 2006; 4: 901-907 . 16. Nafisi MR, Kalhor H, Zamanzad B, Karimi A, Farokhi E, Validi M. Comparison of agar screen and duplex-PCR in determination of methicillin resistant Staphylococcus aureus (MRSA) strains isolated from nose of personnel in Hajar hospital of Shahre-kord, 2007. J Arak Univ Med Sci 2008; 11: 94-101. 17. Saderi H, Owlia P, Zafarghandi N, Jalali Nadoshan MR. Evaluation of antibiotic resistance in Staphylococcus aureus isolated from nose of two teaching hospitals staff of Shahed University. J Mazandaran Univ Med Sci 2004; 42: 69-75. 18. Alavi SM, Rajabzadeh AR, Dezfoulian A, Haghighizadeh MH. Determination of nasal carriage of Staphylococcus aureus and anti microbial resistance among hospital personnel in Razi hospital Ahwaz, spring 2003. J Ahwaz Univ Med Sci 2006; 5: 381-384 . 19. Zia Shekholeslami N, Rezaeian M, Tashakori M. Determination of the prevalence of Staphylococcus aureus nasal carriers and antibiotic resistance pattern in clinical wards staff of Ali- Ebne Abitaleb Hospital, Rafsanjan. J Rafsanjan Univ Med Sci 2009; 8: 27-36 .
20. Karmostaji A, Moradi N, Boushehri E, Jahed M, Dadsetan B, Sanginabadi F. Nasal carrier rates and antibiogram pattern of Staphylococcus aureus strains isolated from hospital staff in teaching hospitals in Bandar Abbas. J Hormozgan Univ Med Sci 2008; 12: 95-101. 21. Khalili MB, Sharifi-Yazdi MK, Dargahi H, Sadeghian HA. Nasal colonization rate of Staphylococcus aureus strains among health care service employee’s of teaching university hospitals in Yazd. Acta Medica Iranica 2009; 47: 315-317. 22. Sherertz RJ, Reagan DR, Hampton KD, Robertson KL, Streed SA, Hoen HM. A cloud adult: the Staphylococcus aureus-virus interaction revisited. Ann Intern Med 1996; 124: 539-547. 23. Tambic A, Power EG, Tambic T, Snur I, French GL. Epidemiological analysis of methicillin-resistant Staphylococcus aureus in a Zagreb trauma hospital using a randomly amplified polymorphic DNA-typing method. Eur J microbiol Infect Dis 1999; 18: 335-340. 24. Alghaithy AA, Bilal NE, Gedebou M, Weily AH. Nasal carriage and antibiotic resistance of Staphylococcus aureus isolates from hospital and nonhospital personnel in Abha, Saudi Arabia. Trans R Soc Trop Med Hyg 2000; 94: 504-507. 25. Brady RP, McDermott C , Graham C, Harrison EM, Eunson G, Fraise AP. A prevalence screen of MRSA nasal colonization amongst UK doctors in a non-clinical environment. Eur J Clin Microbiol Infect Dis 2009; 28: 991-995. Corresponding author Ezzat Allah Ghaemi, Infectious disease Research Center, Golestan University of Medical Sciences, Iran, E-mail: eghaemi@yahoo.com
1890
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Comparison of the Automated Cell Counter and Manual Method for the Assessment of Dialysis Fluids in Peritoneal Dialysis Patients
Yasemin Usul Soyoral1, Huseyin Begenik1, Mehmet Naci Aldemir2, Ali Irfan Baran3, Habib Emre1, Mustafa Kasım Karahocagil3, Reha Erkoc1
1 2 3
Yuzuncu Yil University, Medical Faculty, Nephrology Department, Van, Turkey, Yuzuncu Yil University, Medical Faculty, Internal Medicine Department, Van, Turkey, Yuzuncu Yil University, Medical Faculty, Infectious Disease Department, Van, Turkey.
Abstract Objective: To compare the accuracy of automated cell counter and the manual methods for the peritoneal fluid assessments in peritoneal dialysis patients. Material and Method: We analyzed 72 peritoneal fluid samples collected under sterile conditions from 27 patients with peritonitis (15 female; 12 male) following by the peritoneal dialysis unit of Yuzuncu Yil University Medical Faculty. The white blood cell counts of these peritoneal fluid samples were assessed by the both manual method and the automated cell counter. Results: The white blood cells were usually higher in the automated cell count method than the manual method (p<0,01). In 5 subjects, white cell counts were less than 100 cell/µL in the manual method, but were more than 100 cell/µL in the automated counter. There was a significant correlation between the manual and automated methods in terms of cell counts (p<0.01, r= 0.79). We also found good correlation between the two methods when WBC counts were greater than 300 cell/µL (r=0.87). Conclusions: There is a good correlation between the automated method and the manual methods for the assessment of peritoneal fluid samples in CAPD patients. However, in the assessment of fluids with less than 300 cell/µL, the manual method should be preferred for critical clinical decisions. Key word: Peritonitis, automated cell counter, manual cell counter, diagnosis
Introduction Peritonitis is a common and mortal complication in end-stage renal disease patients on peritoneal dialysis. The early diagnosis and the prompt treatment of peritonitis are crucial factors to reduce the mortality rate. The presence of abdominal pain and color changes in peritoneal fluid are suggestive of peritonitis. For the diagnosis of peritonitis, at least 100 cell/µL white blood cells with 50% neutrophils predominance should be shown in the peritoneal fluid analysis. The manual cell counting (with Tahoma glass) under the microscope is gold standard for the diagnosis of peritonitis (2). However, due to widely usage of the automated hemogram devices, automated cell count is preferred because it is faster and more practical than the manual method. In this study, we aimed to evaluate the correlation between the manual cell count method and the automated cell count method in the assessement of the peritoneal dialysis fluid samples. Material and Methods We recruited 27 patients with peritoneal dialysis (15 female; 12 male) following by our peritoneal dialysis unit at the Yuzuncu Yil University Faculty of Medicine. We totally collected 72 peritoneal fluid samples under sterile conditions from the patients at the onset of their clinical presentation 1891
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
and during their follow-up. The 2 cc of collected sample in EDTA tubes sent to the laboratory for the automated cell counts analysis within half an hour after collection. The samples were analyzed by Coulter LH 750 hemogram device (Beckman Coulter, Fullerton, CA, USA). At the same time, the manual cell counting (with Tahoma glass) was done with a microscope from the same samples. Then, the results of both methods were compared. The comparison of the compatibility of white blood cells counts by the automated and the manual methods was evaluated by significance test of intra-class correlation coefficient. p<0.05 was considered significant. Results The results of samples by the two methods are shown in table 1. Thirteen samples had higher white cell counts with the manual method, whereas 52 samples with the automated counter. In 5 subjects, white cell counts were less than 100 cell/ µL with the manual method, but were more than 100 cell/µL with the automated counter. The white blood cells were usually higher in the automated counter than the manual method (p<0,01). There was a significant correlation in counting between the manual and automated methods (p<0.01, r= 0.79) (Figure 1). We also found good correlation between the two methods when WBC counts of automated method were greater than 300 cell/µL (r=0.87).
Discussion Although the manual cell counting is the gold standard method, it is time-consuming, demanding, and dependent to qualified staff. Therefore, the automated cell counters replaced the place of the manual method (3, 4). However, some automated cell counters may count mesothelium cells as white blood cells that may lead to false positive result (5). Paris et all. compared the automated method (by using Sysmex XE–5000 device) and the manual methods from 174 body fluid samples and found a high correlation between the two methods (r=0.988) (6). In a similar study with Advia 120 device, it was shown a good correlation between the automated and manual methods (r=0.958) (7). Barnes et all. evaluated the performance of the Coulter LH 750 hematology analyzer and the manual method in the analysis of the body fluids. The results showed good correlation between the manual and LH 750 methods when WBC counts were greater than 300 cell/µL (8). We also found good correlation between the two methods when WBC counts were greater than 300 cell/µL (r=0.87). It should be emphasized that our results is not better as in the literature, local factors (eg technical support, qualifications of the laboratory) should be considered when interpreting the results of a certain laboratory. Brown et all. compared the accuracy of analysis for cell counts of body fluid samples between automated method (by Coulter LH 750) and manual chamber counting method (9). They recommended using the manual counting method in assessment of the majority of cerebrospinal and a small number of peritoneal fluids, which require accurate enumeration at clinical decision points between 0 to 100 cells/µL. Because the lower limit sensitivity for enumeration was 200 cells/µL in this device. In another study with Sysmex XE 5000 device, it was shown that the correlation between the automated and manual methods in the assessment of body fluids is improved when the numbers of cells increase in the fluids (10). As mentioned above, the manual method is more sensitive than the automated method in the assessment of cerebrospinal fluid, peritoneal fluids, fluids with malignancy, and the fluids with less than 300 cells/mL (8-10).
Figure 1. The correlation of automated cell count and manual method 1892
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 1. The comparison of cell counts between the automated and manual method
Numbers of case 1 Manuel (cell/µL) 200 460 770 950 970 1800 5500 75 140 150 1200 780 900 1400 1500 2100 4600 1100 1550 550 650 1100 3500 400 4500 2500 2600 3000 3500 1250 20 30 50 60 150 400 Automated (cell/µL) 200 570 900 700 800 2300 4700 300 400 400 1400 1000 1100 1600 3500 8300 6800 1400 1500 900 700 200 1600 400 7000 8200 2900 2800 9800 3400 300 200 200 300 500 400 Numbers of case 13 Manuel (cell/µL) 700 2250 4100 4200 4500 150 300 1000 1200 1950 3000 5000 15000 100 300 1200 1250 13000 150 8500 4400 6200 1100 1500 2400 150 300 450 800 1060 1100 1200 300 1500 1700 3200 Automated (cell/µL) 700 2200 3400 7980 3400 500 800 600 1800 9400 5000 9500 25300 100 300 1200 1700 14000 200 10600 7400 2900 1300 2200 2500 200 700 500 1700 2000 1600 1500 700 1650 2500 3100
14 15
2
3 4 5
16
6 7 8 9 10 11
17 18 19 20 21 22 23 24 25
12 13
26 27
In our opinion the most important reason for this difference was the equipments resolution; some devices were able to report results up to single or double-digit sensitivity in cell counting per µL. However, our equipment reported the results in triple digit sensitivity. Therefore we think the reported high correlations are related to more sensitive measurements of the employed equipment.
In the light of our results and the previous studies, the manual counting methods should be used in the assessment of peritoneal fluids having WBC less than 300 cells/mL to verify the automated counter’s results, in order to prevent false positive results and the usage of unnecessary empiric antibiotic. Before critical decisions such as removal of a peritoneal dialysis catheter and/or evaluation 1893
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
of the treatment responses, the manual method is more precise than the automated method. Technical factors such as a resolution of the hemogram device should be taken into account in the assessment of the accuracy of the automated method. In conclusion, there is good correlation between the manual and the automated methods if cell counts are higher than 300 cell/mL. However, in some cases, there may be significant differences between the two methods. Particularly in the assessments of the fluids having less then 300 cell/mL, the manual counting method should be preferred. References
1. Fried LF, Bernardini J, Johnston JR, Piraino B. Peritonitis influences mortality in peritoneal dialysis patients. J Am Soc Nephrol. 1996; 7: 2176–82. 2. Piraino B, Bailie GR, Bernardini J, et al. ISPD Ad Hoc Advisory Committee. Perıtoneal dıalysısrelated ınfectıons recommendatıons: 2005 update. Perit Dial Int 2005; 25:107–31. 3. Riggio O, Angeloni S, Parente A,et al. Accuracy of the automated cell counters for management of spontaneous bacterial peritonitis. World J Gastroenterol 2008; 14: 5689–94. 4. Oliviero Riggio, Stefania Angeloni. Ascitic fluid analysis for diagnosis and monitoring of spontaneous bacterial peritonitis. World J Gastroenterol 2009; 15: 3845-50. 5. Dursun M, Yılmaz S, Canoruc F, Canoruc N , Batun S. Is automatic method sufficiently reliable for ascitic fluid cell count? Akademik Gastroenteroloji Dergisi 2002; 1: 105-8. 6. Paris A, Nhan T, Cornet E, Perol JP, Malet M, Troussard X. Performance evaluation of the body fluid mode on the platform Sysmex XE-5000 series automated hematology analyzer. Int J Lab Hematol 2010; 32: 539–47. 7. Aulesa C, Mainar I, Prieto M, Cobos N, Galimany R. Use of the Advia 120 hematology analyzer in the differential cytologic analysis of biological fluids (cerebrospinal, peritoneal, pleural, pericardial, synovial, and others). Lab Hematol 2003; 9: 214-24.
8. Barnes PW, Eby CS, Shimer G. An evaluation of the utility of performing body fluid counts on the coulter LH 750. Lab Hematol 2004; 10: 127-31. 9. Brown W, Keeney M, Chin-Yee I,et al. Validation of body fluid analysis on the Coulter LH 750. Lab Hematol 2003; 9: 153-54. 10. Takemura H, Tabe Y, Ishii K,et al. Evaluation of capability of cell count and detection of tumor cells in cerebrospinal and body fluids by automated hematology analyzer. Rinsho Byori 2010; 58: 559-64. 11. Lee JY, Tak WT, Lee JH. Using reagent strips for rapid diagnosis of peritonitis in peritoneal dialysis patients. Adv Perit Dial 2005; 21: 69-71. Corresponding author Yasemin Usul Soyoral, Yuzuncu Yil University, Faculty of Medicine, Department of Nephrology, Van, Turkey, E- mail: yaseminsoyoral@yahoo.com
1894
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Excessive television viewing increases BMI, yet not a risk factor for childhood obesity or thinness: A cross sectional study on Thai school children
Lakkana Rerksuppaphol1, Sanguansak Rerksuppaphol2
1 2
Department of Preventive Medicine, Faculty of Medicine, Srinakharinwirot University, Thailand, Department of Pediatrics, Faculty of Medicine, Srinakharinwirot University, Thailand.
Abstract Background: Childhood obesity is a pandemic lifestyle disorder, a precursor of cardiovascular complication. TV viewing, one of the etiology of obesity encourages reduced activity and overeating. Objective: To demonstrate the effects of TV viewing for long period on nutritional status of school children of Thailand. Methods: A cross-sectional study was conducted in Ongkharak district, Nakorn Nayok province, Thailand on 1,140 school children aged 6-15 years. Baseline demographic data were measured. Children’s parents were consented and quested about average TV viewing of their children. On viewing basis, the children were categorized as per AAP recommendation. Data were presented as mean, SD and percentage. Odds ratio of nutritional status was analyzed using multiple logistic regressions, and effects of factors on BMI was measured by univariate General Linear Model. Results: 577 children were boys among 1140 enrolled, with mean age of 10.0 ± 2.1 years. Average TV viewing was 2.8 ±2.0 hrs/day. Girls were excessive TV viewer (2.9±2.2 hrs/day) than boys (2.6±1.7 hrs/day). TV viewing of ≥4 hrs/day was observed in older children with higher BMI (18.6) than< 2hrs/day TV viewers (17.3) p-value: <0.01. Odds ratio of being overweight/ obese in ≥2 hrs/ day TV viewers compared to <2 hrs/day viewers were 1.13(95%CI= 0.78 to 1.65) and 1.32(0.86 to 2.02), respectively. In same compared groups,
odds ratio of being thin were 0.96(95%CI= 0.63 to 1.45) and 1.02(0.63 to 1.65), respectively. After adjusting sex and age, TV viewing ≥ 2 hrs/day had higher BMI then lesser TV viewers with mean difference 0.72 kg/m2 (p-value=0.02) Conclusion: Excessive or lesser TV viewing did not increase risk of being overweight/obese or thin in children, as result showed no significance. However, after adjusting sex and age excessive TV viewers exhibited higher BMI than lesser TV viewers. Key words: Childhood obesity, TV Viewing, Thailand Children, Body Mass Index, Thinness Introduction Obesity is a pandemic life-style disorder. As it involves every system and shows groups of complications, it is known as metabolic syndrome. Till 1990, adults and old aged were exhibited as obese and having more complications of obesity. In 21st century, the paradigm has been transited from adults to children, making peril picture of childhood obesity. In 2010, estimated obese and overweight children prevalence is 43 million children [1]. Among them 35 million are from developing world, considering more than 80% of total world’s prevalence [1]. This has been projected as more frightening picture in 2020. The ever increasing scenario of the childhood obesity in ASIA is a contribution of rapidly growing countries like China, India and Thailand [1]. This 1895
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
has opened up eyes of government to reform health policies. Childhood obesity is major concern because of cardio-vascular complications it can bring up [2]. To eradicate this hazard, etiologies were hypothesized. One of them was TV viewing associated with increase in childhood obesity [3]. It has plausibility as TV viewing for long time leads to more stable and ultimately sedentary life style. This can be accompanied with fast food and ungraded urge of binge eating lead to vicious cycle of obesity and altered metabolism [4]. It was fairly noted that television viewing was directly proportional to lower activity. Time for playing or activity was replaced by TV. Furthermore, reduced activity and being at home make life more dormant leading to life style disorders [5, 6]. Television viewing provides a context that encourages frequent snacking or overeating. Studies have already been conducted regarding TV viewing and obesity association [7]. However, not a single studies have explored association of lesser TV viewing and thinness. There is no plausible explanation for being thin with no or less TV viewing. Therefore, the objectives of the present study were to demonstrate the association of TV viewing and being thin or overweight in Thai school children. Materials and Methods The present study was a cross-sectional study conducted in Ongkharak district, Nakorn Nayok province, Thailand on 1,140 school going children aged 6-15 years between June to September 2007. The study was approved by the Ethics committee of Faculty of Medicine of the Srinakharinwirot University. Ethics committee approved informed consent was obtained from the parents and assent was obtained from children. Trained staff was deployed for obtaining of anthropometric measurements and demographic data. Weight to the nearest 100 gram and height to the nearest millimeter were measured. BMI was calculated as weight/ (height)2 [kg/m2]. The international cut off points for BMI by gender, passing through BMI 25 and 30 kg/m2 at age 18 were used to define overweight and obesity, respectively [8]. Thinness was classified as grade 1, 2 and 3 by the international cut of points for BMI by sex and age [9]. 1896
The method of study inference collection was questionnaires prepared pertaining to TV viewing time. Parents were asked by the following question: “How many (average) hours does your child view TV per day?” With regards to the current AAP recommendation on “Children, Adolescents and Television” [10], Children who viewed TV ≥ 2 hrs/day were defined as excessive TV viewing. Excessive TV viewers then were categorized in to 2 groups (2-3.9 hr/d and ≥ 4 hr/d) for analysis [10]. Statistical analysis Demographic data, anthropometric data and nutritional status were descriptively presented as mean, SD and percentage values. Pearson chisquare was used to compare proportions among groups. Continuous variables were compared by using a student’s t-test or analysis of variance (ANOVA). Odds ratios of being overweight/obese or thin were analyzed using multiple logistic regressions. To measure the direct and proportional effects of various factors on BMI, univariate General Linear Model was used. Mean differences and 95% CI of BMI after adjusted for factors such as age, sex and TV viewing groups were descriptively presented. Statistical analysis was performed with SPSS 11.0 software package. Differences were considered as significant if p-value is <0.05. Results Demographic data Among 1140 enrolled children, 577 were boys comprising 50.6% of total study population and rest 563 (49.4 %) were girls. Mean age of participated children was 10.0 ± 2.1 years. Age range of population was 6-15 years. Mean body weight, height and BMI were 33.7 ± 12.8 kg, 134.6 ± 13.8 cm and 17.9 ± 4.2 kg/m2, respectively. Mean BMI was lied in between normal range.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Nutritional status and demographic data as per TV viewing According to the answers of their parents on hours of TV viewing, children were categorized in three groups. Participants who had habit of viewing TV <2 hrs/day were 250, while watching TV for 2-3.9 hrs and for ≥4 hr/d were respectively 598 and 292 in numbers. Among 1140, one hundred and seventy eight children were classified as thin including of 143 (12.5%), 21 (1.8%) and 14 (1.2%) as thinness grades 1, 2 and 3, respectively. Obese/ overweight individuals were 253 in numbers. Average body weight was 81.5 ± 32 in group of high TV viewers with p-value of <0.01. (Table 1) According to the International Obesity Task Force criteria for obesity, 146 (12.8%) and 107 (9.4%) of the study population were classified as overweight and obese respectively. Average TV viewing of the study population was 2.8 ±2.0 hrs/day. Time of TV viewing in girls were significantly higher than in boys (2.9±2.2 vs. 2.6±1.7 hr/d, respectively; p-value=0.01). Older children age 10.1-15 years-old had TV viewing time 3.3 ± 2.3, higher than younger children age 6.1-10 years-old, who re habitual of viewing 2.5 ± 1.7 hrs/day, respectively with p-value <0.01. Average TV viewing of thin, normal individual as per BMI and overweight/obese children were 2.8 ± 1.9, 2.7 ± 2.0 and 2.9 ± 2.0 hrs/day, respectively p-value =0.38.
Of 1,140 children, 890 (78.1%) children were classified as excessive TV viewers (≥ 2 hrs/day). Children who viewed TV ≥ 4 hrs/day were older than children who viewed TV < 2 hrs/day and 2-3.9 hrs/day (10.7 ± 2.1, 9.6 ± 2.0, and 9.9 ± 2.1, respectively; p-value <0.01). Children who viewed TV less than 2 hrs/day had no difference in age from children who viewed TV 2-3.9 hrs/ day. Furthermore, children who viewed TV ≥ 4 hrs/day had higher body weight, height and hence body mass index than the other groups as showed in Table 1 (p-value <0.01). However, intergroup variation was least among group in incidences of nutritional status classified as thin, normal and overweight /obese (p-value=0.63). (Table 1) The odd ratio of being overweight/obese or thin rather than normal nutritional status were not significantly increased by factors of excessive TV viewing after adjusted for sex and age as showed in table 2. (Table 2) A univariate General Linear Model revealed significant main effects of age (p-value <0.01) and marginally significant trend of TV viewing by 3 groups (p-value=0.056) on BMI after adjusted for other factors. Means BMI in children who viewed TV <2, 2-3.9 and ≥ 4 hrs/day after adjusting for sex and age groups were 17.59 ± 0.28, 18.26 ± 0.18 and 18.45 ± 0.24 kg/m2, respectively (p-value = 0.056). However, after subcategorize TV viewing into 2 groups, a univariate analysis of variance (Table 3) revealed a significant main effect
Table 1. Demographic data and nutritional status regarding to TV viewing groups
TV viewing group <2 hr/d (n=250) Age Male; n (%) Body weight; kg Height (cm) Body mass index; kg/m2 Nutritional status; n (%) • Thinness • Normal • Overweight/obesity Television viewing; hours (SD) 9.6 (2.0) 137 (54.8) 67.9 (23.1) 132.2 (12.7) 17.3 (3.6) 40 (16.0) 161 (64.4) 49 (19.6) 0.7 (0.5) 2-3.9 hr/d (n=598) 9.9 (2.1) 301 (50.3) 71.8 (27.3) 133.5 (13.7) 17.8 (4.0) 91 (15.2) 376 (62.9) 131 (21.9) 2.4 (0.5) ≥4 hr/d (n=292) 10.7 (2.1)1,2 139 (47.6) 81.5 (32.0) 1,2 138.9 (14.1) 1,2 18.6 (4.9) 1,2 47 (16.1) 172 (58.9) 73 (25.0) 5.3 (2.0) P <0.01 0.24 <0.01 <0.01 <0.01 0.63
Significant different from TV viewing < 2 hrs/day; p-value <0.01 2 Significant different from TV viewing 2-3.9 hrs/day; p-value <0.01
1
<0.01
Journal of Society for development in new net environment in B&H
1897
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 2. Multiple Logistic Regression of childhood overweight/obesity or thinness compared to normal nutritional status children
Parameter Overweight/obesity Interception Age (yr) Boy2 TV viewing3 • 2-3.9 hr/d • ≥4 hr/d Thinness1 Interception Age (yr) Boy2 TV viewing3 • 2-3.9 hr/d • ≥4 hr/d
1
Estimate -1.70 0.06 -0.5 0.12 0.28 -1.89 0.06 -0.18 -0.05 0.02
p-value <0.001 0.12 0.74 0.52 0.20 <0.001 0.13 0.29 0.82 0.93
OR
95% CI
1.06 0.95 1.13 1.32
0.99 to 1.13 0.72 to 1.27 0.78 to 1.65 0.86 to 2.02
1.06 0.84 0.96 1.02
0.98 to 1.15 0.60 to 1.16 0.63 to 1.45 0.63 to 1.65
Normal nutritional status was the reference. Girl was the reference. 3 TV viewing <2 hrs/day was the reference.
1 2
Table 3. Summary of univariate General Linear Model on change of body mass index regarding to sex, age groups (6-10 years and 10.1-15 years) and TV viewing (<2 hr/d and ≥2 hr/d)
Source of variation Age (A) Sex (B) TV viewing (C) AxB AxC BxC AxBxC Error Mean square 615.95 1.53 84.00 46.95 36.63 1.12 1.33 15.98 df 1 1 1 1 1 1 1 1132 F 38.54 0.10 5.26 2.94 2.29 0.07 0.08 P <0.001 0.76 0.02 0.09 0.13 0.79 0.77
Table 4. Estimated means and mean differences of body mass index
Mean Age • 6-10 yr • 10.1-15 yr Sex • Boy • Girl TV viewing • < 2 hr/d • ≥ 2 hr/d 16.97 18.93 17.90 18.00 17.59 18.31 SE 0.17 0.26 0.21 0.24 0.28 0.14 95%CI 16.63 to 17.31 18.41 to 19.44 17.50 to 18.31 17.53 to 18.47 17.03 to 18.15 18.04 to 18.58 Mean difference -1.96 SE 0.32 95%CI -2.57 to -1.34 P <0.001
-0.10
0.32
-0.72 to 0.52
0.76
-0.72
0.32
-1.34 to -0.10
0.02
1898
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
of TV viewing that children who viewed TV ≥ 2 hrs/day had significantly higher BMI than children who viewed TV <2 hrs/day (F=5.3, p-value =0.02). Mean difference of BMI between those 2 groups was 0.72±0.32 kg/m2 (95%CI 0.10 to 1.34; p-value =0.02). Estimated mean differences, standard errors and 95%CI of BMI regarding to sex, age groups and TV viewing after adjusted for other factors are detailed in table 4. Discussion In present cross-sectional study, it was aimed to demonstrate the effects of TV viewing for long period on nutritional status of school-going Thailand children. Overall 1140 school going Thai children were evaluated with a large range of age 6-15 years. Demographic data suggested that girls showed more tendencies to TV viewing than boys (2.9 ± 2.2 vs. 2.6 ± 1.7 hr/d, respectively; p-value =0.01), with significant results. The plausible reason might be that girls stay at home more than boys and hence they are exposed to TV viewing more than boys who are prone to have more physical activities outside. Older boys had more TV viewing inclination than younger school child (3.3 ± 2.3 [11 to 15 years] and 2.5 ± 1.7 [6-10 years]; p-value <0.01). Older adults have certain cognition level [11] and hence more liking towards TV viewing may be the reason [12]. Average TV viewing of thin and overweight /obese children was 2.8 & 2.9 hours higher than asthenic children (2.7 hrs/day), showing some association between TV viewing and nutritional status, as per the older studies, TV viewing was affiliated with childhood obesity [13]. Our results were having little similarity, children viewed TV ≥ 4 hrs/day had significantly higher body weight, height and body mass index than the other groups in present study. Groups who viewed TV for less than 2 hours had average BMI of 17.3 and groups who viewed TV for more than 4 hours had BMI of 18.6. There was statistical significant difference in both the groups. However, high BMI index in higher TV viewing groups could be because of older age children and more girl children. As older children have high growth than younger ones and girls have lesser height in general which strengthens BMI more in
that group. Older children are bonier and having muscle mass that impacts on BMI. This was again fortified by univariate general linear model with age as factor showed higher significance with pvalue < 0.01. However, Gender was not the confounding factor in this case as statistical significance was very poor 0.76 only. Hence more girls in any group would not be the part of high TV viewing associated obesity, which was contradictory to the study held in rural part of USA [14]. This might be because of high physical outside activities boys do than girls; however it is not associated with any genetic gender predisposition. Excessive TV viewing time had not significantly increased risks of childhood obesity in children. As present study showed that any length of TV viewing had only impact on slightly higher BMI, which was completely contradictory to the already known fact. Lesser TV viewing time had no increase risk of thinness, as it was also not known in worldwide literature. There was no where documented about any association between TV viewing and thinness. However, children who viewed TV more than 2 hrs/day had significantly higher BMI than children who viewed < 2hrs/day after adjusting for sex and age on linear model. This can be plausible by sedentary life while watching TV and binge eating. Till date only finger counted studies were conducted on Thai children obesity and their association with TV viewing. The last study of [15] used local standards of TV viewing hours, which were replaced in this study with AAP [10] standards and their categorization in three groups [10]. Present observational study also used international standards of BMI categorization for obesity [8] and adjusted them with the confounders like age and sex to get the robust results. Limitations of study Family income and socioeconomic class were not considered into analysis, which might have played major role in results. As, in higher-socioeconomic class children have more tendency to watch TV and play on computers, might have impacted on obesity [16,17]. Present study had not included time spent on computer or while playing video games, as screen 1899
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
sharing also affects on nutritional status same as TV. Perhaps, considering developing Asian country, a lack of availability of computer, it was not included as a part of study [18]. The study was only concerned about TV viewing time and obesity; however obesity leads to systemic disorders. This should have been included as complications of obesities [19]. Conclusion The prevalence rates of Childhood obesity in Thailand has increased in past decade and become the reason to worry. Till date studies were conducted on the western children and results were implicated on Thai children, as Thai studies did not meet international expectations. Present study contradicts the results of high obesity associated with TV viewing. High BMI was seen with longer TV viewing habits, but it was not associated with obesity or overweight. Author is not denying the fact that TV viewing leads to reduced activities, but its association with obesity is questionable. In future, more realistic and prospective approach on studies is needed to explore the results of such associations. Acknowledgements The present study was supported by grants from the Faculty of Medicine, Srinakharinwirot University. There is no other source of funding or relevant financial or non-financial relationship supported this work. References
1. de Onis M, Blossner M, Borghi E. Global prevalence and trends of overweight and obesity among preschool children. Am J Clin Nutr. 2010;92:1257-64. 2. Fernandes RA, Christofaro DG, Casonato J, Costa Rosa CS, Costa FF, Freitas Junior IF, et al. Leisure time behaviors: prevalence, correlates and associations with overweight in Brazilian adults. A crosssectional analysis. Rev Med Chil. 2010;138:29-35.
3. Salmon J, Campbell KJ, Crawford DA. Television viewing habits associated with obesity risk factors: a survey of Melbourne schoolchildren. Med J Aust. 2006;184:64-7. 4. Kuriyan R, Bhat S, Thomas T, Vaz M, Kurpad AV. Television viewing and sleep are associated with overweight among urban and semi-urban South Indian children. Nutr J. 2007;6:25. 5. Lowry R, Wechsler H, Galuska DA, Fulton JE, Kann L. Television viewing and its associations with overweight, sedentary lifestyle, and insufficient consumption of fruits and vegetables among US high school students: differences by race, ethnicity, and gender. J Sch Health. 2002; 72:413-21. 6. Sakamoto N, Wansorn S, Tontisirin K, Marui E. A social epidemiologic study of obesity among preschool children in Thailand. Int J Obes Relat Metab Disord. 2001;25:389-94. 7. Cole TJ, Bellizzi MC, Flegal KM, Dietz WH. Establishing a standard definition for child overweight and obesity worldwide: international survey. Bmj. 2000;320:1240-3. 8. Cole TJ, Flegal KM, Nicholls D, Jackson AA. Body mass index cut offs to define thinness in children and adolescents: international survey. Bmj. 2007;335:194. 9. American Academy of Pediatrics: Children, adolescents, and television. Pediatrics. 2001;107:4236.
10. Wang Y, Liang H, Chen X. Measured body mass index, body weight perception, dissatisfaction and control practices in urban, low-income African American adolescents. BMC Public Health. 2009;9:183. 11. Hume C, van der Horst K, Brug J, Salmon J, Oenema A. Understanding the correlates of adolescents’ TV viewing: a social ecological approach. Int J Pediatr Obes. 2010;5:161-8. 12. Langendijk G, Wellings S, van Wyk M, Thompson SJ, McComb J, Chusilp K. The prevalence of childhood obesity in primary school children in urban Khon Kaen, northeast Thailand. Asia Pac J Clin Nutr. 2003; 12:66-72.
1900
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
13. Montgomery-Reagan K, Bianco JA, Heh V, Rettos J, Huston RS. Prevalence and correlates of high body mass index in rural Appalachian children aged 6-11 years. Rural Remote Health. 2009; 9:1234. 14. Ruangdaraganon N, Kotchabhakdi N, Udomsubpayakul U, Kunanusont C, Suriyawongpaisal P. The association between television viewing and childhood obesity: a national survey in Thailand. J Med Assoc Thai. 2002;85 Suppl 4:S1075-80. 15. Dennison BA, Erb TA, Jenkins PL. Television viewing and television in bedroom associated with overweight risk among low-income preschool children. Pediatrics. 2002;109:1028-35. 16. McDonald CM, Baylin A, Arsenault JE, MoraPlazas M, Villamor E. Overweight is more prevalent than stunting and is associated with socioeconomic status, maternal obesity, and a snacking dietary pattern in school children from Bogota, Colombia. J Nutr. 2009;139:370-6. 17. Fulton JE, Wang X, Yore MM, Carlson SA, Galuska DA, Caspersen CJ. Television viewing, computer use, and BMI among U.S. children and adolescents. J Phys Act Health. 2009;6 Suppl 1:S28-35. 18. Kong AP, Chow CC. Medical consequences of childhood obesity: a Hong Kong perspective. Res Sports Med. 2010;18:16-25. 19. Saric B, Buric S, Vasilj I, Saric B, Simovic M. Analysis of risk factors in patients treated by stroke in Clinical Hospital Mostar, HealthMED,2011;5(4): 936-942 i 20. Pleho –Kapic A, Beslagic R, Pepic E, Fajkic A. Level of cholesterol anlipoprotein fractions in cardiovascular diseases, HealthMED,2008;2(3): 154-161 Corresponding author Sanguansak Rerksuppaphol, Department of Pediatrics, Faculty of Medicine, Srinakhariwirot University, Thailand, E-mail: sanguansak_r@hotmail.com
Journal of Society for development in new net environment in B&H
1901
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Turkish Mothers’ Use of NonPharmacological Methods for Relieving Children’s Postoperative Pain
Mehtap Cürcani1, Ayda Çelebioğlu2, Sibel Küçükoğlu2
1 2
Atatürk University, Faculty of Health Science, Department of Internal Medicine Nursing , Erzurum, Turkey Atatürk University, Faculty of Health Science, Department of Child Health and Disease Nursing , Erzurum, Turkey.
Abstract Objective: The experience of pain is common among children undergoing surgery. Hospitalization and surgery are stressful experiences for children and their parents. This research was conducted to investigate and analyze the non-pharmacological methods mothers use to relieve their children’s postoperative pain. Materials and Methods: The research sample consisted of 150 mothers whose children had undergone a surgical procedure at one of two hospitals in eastern of Turkey. Researchers used a questionnaire and Visual Analog Scale (VAS) to collect the data. To assess the data, descriptive statistics and the chi square test were used. Results: According to the results, 37 percent of mothers noted that their children’ postoperative pain was severe, and mothers used strategies that provided emotional support as the main non-pharmacological method for reducing their children’s pain (these strategies included being near their children constantly (70.6 percent) and touching them (81.3 percent). There was a statistically significant difference among the mothers’ education levels, working statuses, and assessments of their children’ pain levels as well as differences among their children’s genders, their children’s types of surgery, and some non-pharmacological methods used by the mothers (p<0.05). Conclusion: The experience of pain is common among children undergoing surgery, and families are overwhelmingly positive about being involved in the postoperative care of their children after day surgery. Therefore, nurses should provide information and guidance to mothers in pain management 1902
and provide them with an opportunity to be aware of their role in their children’s pain care. Key words: Postoperative pain, Children, Mother, Nursing Introduction A surgical intervention causes stress to an organism and significantly vilolates normal functioning of organs and organic systems (1). During the last two decades, despite the fact that chronic pain and its treatment have become more common, postoperative pain is a problem that still remains unresolved (2). Inadequately controlled pain is a source of significant distress for patients and their families and can have a detrimental impact on the acute postoperative outcome (3). Hospitalization and surgery are stressful experiences for children and their parents (4). Thus, the assessment and management of children’s pain constitutes an increasingly important research focus in nursing science. The experience of pain is common among children undergoing surgery (5,6). Pharmacological methods, surgical methods, and non-pharmacological methods are used in postoperative pain management. Pharmacological methods are those wherein drugs are applied at the request of a doctor in different ways (7). To ensure adequate pain relief, non-pharmacological techniques are an important part of pediatric patient care in conjunction with pain medication. Non-pharmacological methods are widely accepted as additional strategies that may be used independently or in conjunction with medication. Their effectiveness in pediatric pain relief has been demonstrated by earlier studies (8-11).
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
There is evidence that families are overwhelmingly positive about being involved in the postoperative care of their children after day surgery (6). Involving parents in the management of children’s pain improves the effectiveness of pain management strategies because parents have an existing trust relationship with their children and have knowledge and experience in detecting subtle changes in their children’s behavior (10,12). Thus, it can be assumed that parents know their children well and can assess their pain reliably (13). Most of the previous studies about postoperative pain relief were conducted in Europe and North America. However, in the Turkish literature, no studies have examined non-pharmacological interventions by mothers in the postoperative pain relief of their children. The purpose of this study was to describe what non-pharmacological methods mothers use to relieve their children’s postoperative pain. Methodology Subjects and data collection The sample consisted of 150 mothers whose children between the ages of one and twelve had undergone surgical procedure in one of four wards of two hospitals in Eastern Turkey. These four wards included pediatric surgical wards; ear-nosethroat surgical wards; a brain surgical ward and an orthopedic ward. Data collection Data collection lasted for about six months (between October 2005 and March 2006). One hundred and sixty questionnaires were distributed to parents one day after their children had undergone surgical procedures. Ten mothers refused to participate in the study. Thus, participation in the study was determined to be 93.75 percent. Inclusion criteria for mothers were that (i) they took the main responsibility of taking care of their children in the hospital; (ii) their children were one to twelve years old; (iii) their children had undergone surgical procedures; and (iv) they were able to speak
Turkish so that they could understand and answer the questionnaire. Researchers collected the data using a questionnaire. The questionnaire was filled out by the mothers; however, the researchers could help the mothers who were illiterate to fill in the questionnaires, or the illiterate mothers could have help from others. Questionnaire form The questionnaire was created in two parts. The first part measured descriptive characteristics of the mothers and children (the children’s age, gender, operation region, place of surgery, and stay time in hospital as well as the mothers’ age, profession, level of education, and hospital experience). The second part collected information about non-pharmacological methods used by the mothers after surgery. These included cognitive-behavioral methods (verbal encouragement, encouragement using awards, helping the children think happy thoughts, helping them use their imaginations, providing them with music, relaxing them, helping them take deep breaths, and reading books to them), physical methods (giving massages, keep desired item beside them, and changing their position), emotional support (constantly being nearby, touching them), and regulating their surroundings (ventilating the room, providing a quiet environment). The Visual Analogue Scale (VAS) was used by the mothers to evaluate their children’s pain. The VAS seems to be most suitable for measuring the intensity of postoperative pain because it was found to be methodologically sound, conceptually simple, easy to administer, and unobtrusive to respondents. When a 10 cm VAS was used by parents to assess their children’s postoperative pain, the intensity of pain was defined as no pain (0 cm), mild pain (0.5-3 cm), moderate pain (3.5-6.5 cm), and severe pain (7-10 cm) (14). To improve the reliability of the instrument, a pilot test was conducted with 25 mothers whose children had undergone surgery at a pediatric surgical ward in one of two university hospitals in Turkey. Some minor revisions were made to the mothers’ and children’s background factors according to the pretest results. 1903
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Ethical considerations The collected data were considered the ethical principles and verbal and written informed consents were taken related to hospitals and mothers. The aim of the study was explained to the mothers prior to filling in the questionnaire forms, which were only administered to mothers who had accepted the research. Data analysis All statistical analyses were conducted with the help of SPSS 11.5 software. Descriptive statistics were used to describe the background factors of the parents and their children as well as the mothers’ uses of non-pharmacological methods for pain relief. Differences related to background factors and mothers’ uses of non-pharmacological methods were tested using a chi-square test where p< 0.05 was considered statistically significant. Results The findings of this research established that 62.7 percent of the children were male, and children’ mean age was 7.43±3.55. The distribution of clinics showed that 70.7 percent of the data collected were from the pediatric surgery clinic, 11.4 percent were from the ear-nose-throat surgery, 10.7 percent were from the brain surgery clinic, and 7.2 percent were from the orthopedic clinic. It was determined that 53.3 percent of the children’s’ operation regions were the abdominal region, 60.7 percent of the children received emergency operations, and the average hospital stay of the children was nine days (Table 1). It was established that the average age of the mothers involved in this study was 32.35±6.71, 77.3 percent of the mothers’ education levels were at the primary school level, and 27.3 percent of them pointed out that their children had a postoperative period of severe pain (Table 1). According to their VAS assessments, 37 percent of the mothers (n: 55) indicated that their children had severe pain (Figure 1). 1904
Table 1. Distribution of sociodemographic characteristics of mothers and children
Descriptive characteristics Child’s age (7.43±3.55) Child’s gender Female Male Surgical clinic Pediatric surgery Ear-nose-throat surgery Brain surgery Orthopedic clinic Operation region Abdominal Orthopedic Craniofacial Genital Type of surgery Planned Emergency Hospital stay (days) (9.16±9.17) Child’s pain Mild Moderate Severe Mother’s age (32.35±6.71) Mother’s education level Low (primary school) High (secondary, university) Mother’s working status Working Not working Mother’s hospital experience Yes No Number %
56 94 106 17 16 11 80 35 18 17 59 91
37.3 62.7 70.7 11.4 10.7 7.2 53.3 23.3 12.0 11.3 39.3 60.7
63 46 41
42.0 30.7 27.3
116 34 11 139 49 101
77.3 22.7 7.3 92.7 32.7 67.3
Figure 1. Parental assessment of their children’s worst postoperative pain using a 10 cm Visual Analogue Scale (n: 150) It was established that among the non-pharmacological methods used to reduce their children’s pain, mothers mostly used those that provided emotional
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
support “Constantly Being Nearby” (70.6%) and “Touching” (81.3%). As well, mothers less often used cognitive-behavioral strategies, such as “Providing Music” (14.7%) and “Reading Books” (6.0%), which are very easy techniques to implement. Regarding the physical methods, the percentage of mothers who used “Massages” was 40.7 percent (Table 2). The cognitive-behavioral methods most commonly used by mothers that are more educated were “Verbal Reinforcement,” “Encouragement with Award,” “Helping Think Happy Thoughts,” “Providing Music,” “Helping with Deep Breathing,” and “Reading Books.” Mothers used “Helping with Deep Breathing” more often with girls than they did with boys (p<0.05). It was established that the mothers of children who had received planned surgeries were more attentive to their children, especially in terms of the items “Encouragement with Award,” “Helping Think Happy Thoughts,” and “Keeping a Desired Item Beside Them” (p<0.05-Table 3).
Table 2. Mothers’ use of non-pharmacological methods for children’s postoperative pain relief (n:150)
Non-pharmacological methods Cognitive-behavioral methods Verbal Encouragement Encouragement with Award Helping Think Happy Thoughts Helping Them Use Imagination Providing Music Helping Make Relaxation Movements Helping with Deep Breathing Reading Books Physical methods Giving Massages Keeping a Desired Item Beside Them Changing Their Position Emotional support Constantly Being Nearby Touching Regulation of Surroundings Ventilating the Room Providing a Quiet Environment
- More than one answer was given.
N 99 55 47 35 22 16 15 9 61 61 25 114 122 44 17
% 66.0 36.7 31.3 23.3 14.7 10.7 10.0 6.0 40.7 40.7 16.7 70.6 81.3 29.3 11.3
Table 3. Relationship between mothers’ and children’s background factors and mothers’ uses of nonpharmacological methods
Non-pharmacological Methods Cognitive-behavioural methods Verbal Encouragement Encouragement with Award Helping Think Happy Thoughts Helping Them Use Imagination Providing Music Helping Make Relaxation Movements Helping with Deep Breathing Reading books Physical methods Giving massages Keeping a Desired Item Beside Them Changing Their Position Emotional support Constantly Being Nearby Touching Regulation of Surroundings Ventilating the Room
(*p<0.05, **p<0.001)
Journal of Society for development in new net environment in B&H
Children’s and mothers’ background factors Child’s Type of Mother’s Parental assessment of Education gender surgery working status child’s worst surgical Lower/ Female/ Planned/ Not working/ pain higher male emergency working mild/midium/severe 60/85* 29/62** 27/47* 9/35** 36/9* 7/21* 3/18** 13/2*
46/31* 42/24*
11/32/26*
24/36/58* 35/62* 54/32* 4/24/20* 46/78* 62/76/87* 71/92/80*
0.0/32*
1905
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
It was observed that working mothers made their children use “Relaxation Movements,” and non-working mothers used non-pharmacological methods such as “Constantly Being Nearby” and “Ventilating the Room” (p<0.05). The most efficient non-pharmacological methods that mothers used to reduce their children’s’ pain (mild/moderate/severe) during the postoperative period were “Helping Them Use Imagination,” “Giving Massages,” “Changing Their Position,” “Constantly Being Nearby,” and “Touching.” These reduced the pain significantly, according to the mothers (p<0.05-Table 3). Values are expressed as percentages. Chi-square tests were used to compare the children’s and mothers’ background factors and the mothers’ uses of non-pharmacological methods. Only statistically significant results are presented. Discussion In this study, according to the mothers’ VASbased assessments, most of them indicated that their children had experienced “moderate” and “severe” pain. The results support many previous studies noting that hospitalized children suffer from significant postoperative pain (9,15-17). To ensure adequate pain relief, non-pharmacological techniques, in conjunction with pain medication, are an important part of pediatric patient care (8). The current study provided useful information regarding the parental use of non-pharmacological methods in their children’s pain relief regimens and the factors related to the function of pain relief. In this study, it has been established that the mothers used verbal encouragement (a cognitive-behavioral method), massage (a physical method), touching (a method of emotional support), and ventilation of the room (a method for regulating the surroundings) more than other nonpharmacological methods. Physical methods, including reading books, were used less frequently than other non-pharmacological methods. Pölkki et al. (15) indicate that parents use many nonpharmacological methods to relieve their young children’s postoperative pain during hospitalization. Hong-Gu He et al. found that the most commonly used cognitive-behavioral methods were 1906
distraction, imagery, and preparatory information. About two-thirds of the respondents reported having used techniques such as positive reinforcement and relaxation. Using breathing techniques was the only method not commonly used among parents (9). The most commonly used non-pharmacological pain alleviation methods were holding the child on the parent’s lap, comforting the child, and spending more time than usual with them. In a study by Kankkunen et al., only a few parents used physical methods, such as massage and cold or warm packs (10). In the study, in terms of the cognitive-behavioral methods used (except for “Helping Them Use Imagination” and “Helping Make Relaxation Movements”), a significant difference was found between the groups defined by the mothers’ level of education. The results are consistent with earlier findings regarding the correlation between mothers’ education and their utilizations of painrelieving methods for their children (9,17). This study indicated that the children’s genders were statistically significant regarding “Helping with Deep Breathing,” being more often used with girls than with boys. Pölkki et al. (15) found that children’s gender showed a statistically significant correlation with the use of many non-pharmacological methods. However, there is no literature correlating between “Helping with Deep Breathing” and non-pharmacological methods. The fact that the “Helping with Deep Breathing” method was utilized more often with girls than with boys is especially interesting. In the study, “Helping to Use Imagination,” “Massaging,” “Changing Their Position,” “Constantly Being Nearby,” and “Touching” were found to be statistically significant regarding the mothers’ evaluations of the children’s pain. Two Scandinavian studies highlighted the potential benefits of equipping parents with techniques such as distraction therapy, breathing exercises, and body massage, which were shown to be effective for children aged eight to twelve years (16), as well as those under six years, in pain management (10). Hong-Gu He et al. found a significant difference between the groups-similar to our findingsregarding the use of massage and the severity of pain (9).
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Conclusions and Implications This study provides new information about Turkish mothers’ uses of non-pharmacological methods on pediatric patients. The results of this study established that of the many non-pharmacological methods, mothers most often use strategies for providing emotional support in order to reduce their children’s pain. Mothers less often use cognitive-behavioral strategies, such as providing music and reading books, and physical strategies, such as giving massages, which are techniques that are easy to implement. According to these results; This study not only serves as a signal for nurses and other health professionals when they provide information and guidance to mothers in pain management, it also provides mothers with an opportunity to become aware of their role in their children’s pain care. Therefore, this study concluded that mothers should be given more guidance regarding the use of non-pharmacological methods of postoperative pain relief and emotional support during their children’s hospitalization. There is a need to continue research that examines the factors influencing parental participation in the application of pain relief measures for pediatric patients in Turkey. As well, the hospital and the place of work were also significantly related to some non-pharmacological methods, which warrants consideration by future studies regarding the reasons why.
References
1. Stanic D, Papovic N, Draskovic B, Benka UA, Katanic J, Fabri I. Cortisol and a blood sugar as a good stres ındicator during general anaesthesia with different opioid analgetics in children. HealthMED. 2010;4(4):1020-1029 2. Uyer M. Postoperatif Ağrı (Postoperative pain) Ulusal Cerrahi Kongresi. Cerrahi Hemşireliği Seksiyonu. Panel ve Bildirileri Kongre Kitabı (National Surgical Congress. Section of Surgical Nursing. Panel and Book of Proceedings of Congress). 2002; 115-130. 3. Draskovic B, Stanic D, Benka Au, Radojcic B, Grebeldinger S. Remifentalin and fentanil as a part of postoperative analgesia of newborns in the intensive care unit. HealthMED. 2010;4(4): 983-991 4. Kristensson-Hallström I..Parental participation in pediatric surgical care. Association of Perioperative Registered Nurses. 2000; 71(5):1021–1029 5. Gauthier JC, Finley GA, McGrath PJ. Children’s self- report of postoperative pain intensity and treatment threshold: determining the adequacy of medication. Clinical Journal of Pain. 1998; 14(2): 116-120. 6. Eti Aslan F, Badır A. Reality about pain control: Nurses' knowledge and beliefs about nature of pain, pain evaluation, and pain relief. Pain. 2005;17(2):44-51.] 7. Arslan S, Çelebioğlu A. Postoperative pain management and alternative applications. International Journal of Human .Sciences. 2004; 1(1): 1-7. 8. Vessey JA, Carlson KL. Non-pharmacological interventions to use with children in pain. Issues Compr Pediatr Nurs 1996; 19: 169–82. 9. He HG, Pölkki T, Pietilä AM, Vehviläinen-Julkunen K. Chinese parent’s use of nonpharmacological methods in children’s postoperative pain relief. Scand J Caring Sci. 2006;20;2-9. 10. Kankkunen P, Vehvilainen-Julkunen K, Pietila A-M, Halonen P. Parents’ use of nonpharmacological methods to alleviate children’s postoperative pain at home, Journal of Advanced Nursing 2003; 41(4):367-75
Journal of Society for development in new net environment in B&H
1907
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
11. Pölkki T. Nurses’ perceptions of parental guidance in pediatric surgical pain relief. International Journal of Nursing Studies 2002; 39(3): 319–27. 12. Pederson C. Promoting parental use of nonpharmacological techniques with children during lumbar punctures. J Pediatr Oncol Nurs 1996;13(1): 21–30. 13. Kankkunen P, Pietilä A-M, Vehviläinen-Julkunen K. Families’ and children’s postoperative pain Literature Review Journal of Pediatric Nursing. 2004; 9(2): 133-9. 14. Alex MR, Ritchie JA. School-aged children’s interpretation of their experience with acute surgical pain. J Pediatr Nurs 1992; 7: 171–80 15. Polkki T, Vehvilainen-Julkunen K, Pietila AM. Parents’ role in using non-pharmacological methods in their child’s postoperative pain alleviation. J Clin Nurs 2002; 11(4): 526–36. 16. Tarja Pölkki. Nonpharmacological methods in relieving children's postoperative pain: a survey on hospital nurses in Finland. Journal of Advanced Nursing, 2001; 34(4): 483-492. 17. Kankkunen PM, Vehvilainen-Julkunen KM, Pietila AM. Children’s postoperative pain at home: family interwiev study. International Journal of Nursing Practice. 2002; 8 (1); 32-41. Correspondence author Sibel Küçükoğlu, Atatürk University, Faculty of Health Science, Department of Child Health and Disease Nursing, Erzurum, Turkey, E-mail: s_nadaroglu@hotmail.com
1908
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
An economic evaluation of China’s new cooperative medical scheme on TB health care: a case study in five counties in Ningxia province, China
Peng Kong, Meng Qingyue, Bian Xufeng Center for Health Management and Policy, Shandong University, P.R. China
Abstract Background: This study aims to estimate the impacts of NCMS that combined demand-side measures aimed at expanding health insurance and providing financial support to the patients on TB financial burden. Methods: A village and facility questionnaire survey was conducted with 305 TB patients and 12 TB institutions. Qualitative in-depth interviews were implemented with 32 TB patients, 20 village doctors, 12 town doctors, 8 TB doctors and 8 TB program managers. Results: Data from household, there is few patients to receive NCMS benefit packages to reduce financial barrier of access and cost of seeking treatment. Little impact is detected the use of NCMS on TB health care. Conclusions: The cost of outpatient care and disease control institutions should be included into the scope of NCMS reimbursement. The operational issues of NCMS have to be well-designed, developed, and field-tested before being introduced on a large scale. China should consider changing the provider payment method from fee-for-service to a prospective payment method. Key words: NCMS; TB; Health care; Burden Background In 2003, China introduced a new communitybased rural health insurance called the New Cooperative Medical Scheme (NCMS), and enro-
llment has skyrocketed since that time, covering over 90% of the rural population by 20081. In April 2009, China finally unveiled an ambitious new health-care reform plan, entailing a doubling of government health spending as well as a number of concrete reforms2. Integration of tuberculosis (TB) care into health insurance package has already started in China under context of health system reform. By reducing the out-of-pocket payments overall, TB patients are able to enjoy NCMS to provide health benefit package and thereby effectively alleviate the burden of TB patients. NCMS implemented in all counties of Ningxia Hui Autonomous Region provided subsidy to TB patients for seeking health care to TB dispensaries. This study attempts to shed light on impacts of NCMS that combined demand-side measures aimed at expanding health insurance and providing financial support to the patients on TB financial burden. The intention was to provide an evidence for further policy making on NCMS and TB control in China. Methods This survey is one part of the Harvard University pilot program in Ningxia. Five rural counties with high TB prevalence and low case detection rates were purposely selected, to represent a range of economic and geographical circumstances within the region. The counties were already in the process of implementing the DOTS program. 1909
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
A village and facility questionnaire survey was conducted with 305 TB patients and 12 TB institutions. The age span was from 18 to 78-years old. Qualitative in-depth interviews were implemented with 32 TB patients, 20 village doctors, 12 town doctors, 8 TB doctors and 8 TB program managers. The data were gathered between May 8 and May 20, 2010. All participants gave informed consent prior to taking part in the study, by signing or making a finger-print on the consent form. Those who did not agree to take part in the interview or who did not feel comfortable during the interview were allowed to leave. This survey utilized a combined qualitative and quantitative methodology. Statistical analysis All quantitative material was analyzed with SPSS 13.0 software. The analyses performed were descriptive, using rates, averages, and medians as the key indicators; single factor analysis was performed using as the main methods statistical inference T-test and chi-square test. Qualitative interviews were organized, coded, and then imported into Nvivo software for analysis. Results Data from household, there is few patients to receive NCMS benefit packages to reduce financial barrier of access and cost of seeking treatment. Data with the great majority stems from patients’ expenditure when they first visit to hospital before diagnosis (see table 1.). Data since from second visit and after being diagnosed with TB is inadequate to conduct for statistical analysis. Most of suspects can be diagnosed after one or two seeking healthcare.
Categories Cases Total cost Out-of pocket spending The percent of personal out-of-pocket County 1 36 2659.6 829.3 31.2%
The survey suggests NCMS is identified no obviously improvement for most of TB patients on seeking care. Although, a qualitative study identified NCMS reduced out-of pocket spending, and the incidence of catastrophic spending and impoverishment through health expenses for patient who take advantage of benefit package of NCMS to a certain extent. The consumption expenditure of patients on side effect with high frequency occurrence, excluding that only for anti-TB drugs, 4 times sputum detections and 1 X-ray examination under a national policy of free tuberculosis services, made up 1/2-2/3 of their total consumption expenditure. Over-prescribing did not decline with introduction of the NCMS. Health providers tend to overprescribe more often than non-NCMS for maintaining income level. Similar behavior in other treatment settings in China has been noted3. Discussion Little impact is detected the use of NCMS on TB health care, and while the evidence points to NCMS design and the existing TB policy in China, the evidence on health outcomes is mixed. The probably more challenging issue is NCMS providing insufficient support to TB patients. NCMS in the intervention counties implemented a new in-patient reimbursement system, yet more than 90% of TB patients do not require in-patient care. Similarly, NCMS only provides reimbursement of out-patient care at the county, township and village levels, but the majority of TB patients’ everyday care is provided through CDC centers. Therefore, the financial protection provided by the scheme to these patients is limited and patient understanding of the scheme and its utility are lacking. China's TB health care system needs to address the challenge of provider incentives to over-provide expensive tests and services. For TB free
County 2 29 2501.2 1164.5 46.6% County 3 19 3035.0 1708.6 56.3% County 4 17 1504.2 732.9 48.7% County 5 7 1849.3 1277.9 69.1%
Table 1. Disbursement by category of NCMS for patients when fist seeking healthcare
1910
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
treatment, health workers are expected to make a living from selling drugs and fee-for-service payments. Fee-for-service incentives of health care providers and their ability to make a correct TB diagnosis were also perceived to influence patient access to TB care. Another, the model of collaboration between hospitals and CDC facilities provided by the tuberculosis control program is may not be the most cost-effective and sustainable model of TB care in the long-run. Conclusions The cost of outpatient care and disease control institutions should be included into the scope of NCMS reimbursement. Kidney and liver functioning tests and the related drugs for protection of these organs often damaged as a side effect of TB treatment could be included in the lists for reimbursable outpatients care. The operational issues of NCMS have to be well-designed, developed, and field-tested before being introduced on a large scale. The NCMS financing model requires further streamlining as there is still some level of fragmentation in it in terms of who pays for what, as well as what type of TB diagnostic and treatment services are included in the package. It is needed to think how to package TB care effectively into a more integrated, one-stop-shop type, primary health care services, how to ensure that various providers, whether a hospital or an outpatient clinic, use the same protocols of care for the same type of TB cases. The NCMS should be designed to exert a stronger financial influence over the health providers to improve service quality and contain costs. China should consider changing the provider payment method from fee-for-service to a prospective payment method such as DRG or capitation with pay-for-performance, and to develop purchasing agencies that represent the interests of the population so as to reduce TB patient’s burden4. It needs to further explore how hospitals should be involved in the prevention and control of infectious diseases, and has influenced the development of new policies that involve hospitals in the work of public health.
Acknowledgements This work was supported by Harvard University pilot program in Ningxia “Creating a new payment system, improving health care efficacy”We thank Pr. Winnie YIP (University of Oxford, UK) and Pr. William HSIAO (Harvard University, USA) for valuable information and comments provided. References
1. Chen, Z. Launch of the health care reform plan in China. The Lancet, 2009. 373: 1322−1324. 2. Adam Wagstaff, Shengchao Yu. Do health sector reforms have their intended impacts? The World Bank’s Health VIII project in Gansu province, China. Journal of Health Economics. 2007. (26): 505–535. 3. Jackson, S., Sleigh, A. C., Wang, G.-J., & Liu, X.L. Poverty and the economic effects of TB in rural China. International Journal of Tuberculosis and Lung Diseases, 2006. 10(10): 1104-1110. 4. Winnie YIP, William HSIAO. China's health care reform: A tentative assessment. China Economic Review. 2009. (20):613-619. Corresponding author Peng Kong, Center for Health Management and Policy, Shandong University, P.R. China, E-mail: kongpengsd@163.com
Journal of Society for development in new net environment in B&H
1911
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The Effect of Moderate Endurance Training on Cardioprotective Molecule Adaptations
Zong-Yan Cai1, Cheng-Chen Hsu2, Mei-Chich Hsu3, Mao-Shung Huang4, Chao-Pin Yang5, Yung-Yu Tsai2, Borcherng Su6
1 2
3 4 5
6
General Education Center, Tuz Chi College of Technology, Hualien County, Taiwan (ROC) Department of Anatomy, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan (ROC). Graduate Institute of Sports Science, National Taiwan Sport University, Taoyuan County, Taiwan (ROC). Department of Dentistry, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (ROC). Department of Physical Medicine and Rehabilitation, Changhua Christian Hospital, Changhua County, Taiwan (ROC). Department of Pathology, Hualien Tzu Chi medical center, Hualien County, Taiwan (ROC).
Abstract Purpose: This study aimed to investigate the effect of moderate endurance training on cardioprotective molecule adaptations, including marker of stem cell activation in the myocardium. Materials and Methods: Twenty-four Sprague-Dawley rats were randomly divided into a 4-wk exercise training (4WT) group, a 4-wk sedentary control (4WC) group, an 8-wk exercise training (8WT) group, and an 8-wk sedentary control (8WC) group (n=6 respectively). The training protocol consisted of treadmill running at 20 m/ min for 30 min on a 0% grade, for 3 days/wk. Immunohistochemistry staining coupled with image analysis, as expressed by mean optical density, was used for protein quantification. Results: The results indicated that the heat shock protein (HSP70) and stem cell marker, as evaluated by c-kit, were higher in 4WT than those in the 4WC and 8WT group (p < 0.05), and the HSP70 content in the 8WT was higher than that of the 8WC group. In addition, 4WT and 8WT groups exhibited a significantly higher hepatocyte growth factor (HGF) and c-met content compared to their respective control counterparts (p <0.05). Conclusions: This study suggests that training-induced stem cell activation in the myocardium corresponds with the cardioprotective molecular markers in the early stage of training, and then 1912
the activated stem cells in the myocardium might subject to a withdrawal before the remodeling events have completed. Additionally, training induced upregulation of cardiomyocyte HGF/c-met signaling pathway may participate in a more long lasting mechanism of exercise training-induced cardioprotection. Key words: HSP70; HGF; c-met; c-kit Introduction Cardiovascular disease (CAD) is a major health concern of the developed world and the leading cause of death. In the cardiovascular system, because the heart occupies the central role, several approaches have been used to protect the heart from CAD. Among these, Kavazis (1) highlighted that only endurance exercise is the practical and sustainable strategy that provides cardioprotection. While regular endurance exercise may serve as a cardio-protector, training at moderate intensity is widely recommended and favored for healthy adult to improve both cardiovascular health and cardioprotection (2,3). Several molecular mechanisms explain exercise-induced cardioprotection. Heat shock protein 70-kDa (HSP70) has raised the greatest attention. HSP70 acts as a molecular chaperone to prevent aggregation of severely denatured proteins (4).
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Upregulation of HSP70 in mediating cardioprotection against stress was by protecting the cardiomyocyte against ischemia-reperfusion (I/R) injury, inhibiting proinflammatory cytokines, and attenuating apoptotic cell death(5,6,7). In addition to HSP70 in regulating cardioprotective mechanism, the hepatocyte growth factor (HGF)/c-met signaling pathway has recently been noted. HGF/c-met is a potent mitogenic signaling pathway with protective properties such as various tissue repairs, and is activated in the I/R heart (8). In 2004, Yasuda et al. (9) first reported that acute exercise induced increase in circulating HGF levels and may improve cardioprotection. However, HGF/c-met signaling pathway used in cardiomyocyte following exercise is currently unknown. More recently, it has been determined that one of the cardioprotective benefits is due, at least in part, to stem cell mechanism (10,11). Stem cells are cells with unique properties of self-renewal and differentiation into one or more types of specialized cells which play a critical role in repairing tissues, and potentially precede the development of organs. Traditionally, it has been thought that postnatal cardiomyocytes were incapable of replication, repair and regeneration. Upon injury, the damaged cardiomyocytes are replaced by scar tissue. However, this concept has been partly challenged due to the discovery of circulating bone-marrow stem cells participating in cardiomyocyte formation (12). Moreover, Beltrami et al. (13) reported that the heart contains a distinct resident reservoir of stem cells implicated in myocardial repair and regeneration, and thus cells that express stem cell-related surface antigens in recipient cardiomyocyte have successively been cloned (13.14). Among these cardiac stem cell (CSC) antigens, c-kit appears to be the candidate biomarker due to its broader spectrum of differentiation potential. Also, activation of c-kit represent a potentially attractive cell source for cardiac repair (14), which would further express cardiac transcription factors, even leading to the formation of new cardiomyocytes (13,15). These inspiring findings of stem cell activation contributing to cardiac repair and regeneration suggest a more efficient and powerful factor for strengthening cardioprotection. In a recent study, Kolwicz et al. (16) indicated that endurance training showed a tendency to enhance the abundance of cardiac progenitor cells, resul-
ting in a more favorable cardiomyocyte number in hypertensive hearts. However, the treatment is only employed for clinical therapy in patients. It is not known whether endurance training can stimulate stem cell activation in the myocardium of a healthy adult. Stem cells in the myocardium may be activated by various growth factor signaling (17,18). During moderate endurance exercise, multiple physiological events and signaling cascades are activated and may act as important signaling clues to elicit stem cell activation in the myocardium, such as an increase in growth factors (19), and the activation of growth signaling pathways in the cardiomyocyte (20,21,22). This raises the hypothesis that the enhancement of cardioprotection following moderate endurance training might partly be due to the contribution of stem cells. To the best of our knowledge, the effects of exercise on the cardioprotection of healthy individuals contributed by stem cells and cardiomyocyte HGF/c-met signaling pathway has not yet explored. As well, the adaptive process to different training periods also requires clarification. Therefore, this study was to investigate the effect of moderate endurance training on HGF/c-met signaling pathway and c-kit contents. Considering the evidence of its role in training-induced cardioprotection, HSP70 content was also examined in this study. We investigated the adaptive continuum through the employment of different training stages. Various labeled-antibodies assessed for specific proteins in this study were identified by immunohistochemistry (IHC) staining, the use of specific antibodies to stain particular molecular species in situ, coupled with an image analysis method; these serve as a more precise tool for the quantification of protein expression into the cell layer (23,24). Materials and Methods Animals Twenty-four male Sprague-Dawley (SD) rats (10 wks old) obtained from the National Institute of Animal Care (Taiwan) were used in the experiment. Rats were individually housed in cages with rat chow and water supplied ad libitum, in a room controlled at 20-22 °C, and with a constant arti1913
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
ficial 12:12-h light-dark cycle. All experimental procedures were approved by the Taipei Medical University of Animal Care Committee. Study design The rats were randomly divided into a 4-wk of exercise training (4WT) group, a 4-wk sedentary control (4WC) group, an 8-wk of exercise training (8WT) group, and an 8-wk sedentary control (8WC) group (n=6 per group). Training was carried out between 10:00 and 14:00 per session. During each training session, instead of being required to run on the treadmill, the C groups were placed on a non-moving treadmill. Each of the trained groups and their control counterparts were sacrificed for tissue removal 48 h after the last exercise training period. Training protocol Exercise training included 3 days of habituation to the treadmill before the training program. Rats began at a running speed of 20 m/min, at 0% grade for 10 min for two days. The duration was then increased by 10 min until 20 min/day was achieved on the third day, followed by one day of rest. After familiarization, the training groups began a treadmill training program for 4 or 8 wks according to the group to which they were assigned. Rats ran at 20 m/min for 30 min on a 0% grade for 3 days/wk. The work rate fulfills the range of moderate intensity for SD rats as previously described (25,26). Electrical stimulation was used to motivate the rats to run. Tissue preparation Rat myocardium were removed and then were preserved freshly and fixed in 10% formalin solution until paraffin-embedded tissue blocks were made. Five-mm thick cross sections were cut using a freehand section method with a microtome (Jung SM 2000R, Leica, Nussloch, Germany) from each block, and were mounted on micro slides (Menzel-Glaser, Braunschweig, Germany) for further analysis. 1914
Immunohistochemistry (IHC) staining The procedure of IHC staining was performed according to the standard protocol as described elsewhere (23,24,27) with minor modification. First, the slides were incubated at 60°C for 10 min, followed by dewaxing using xylene, and rehydrated by passing through degraded concentrations of ethanol. Then, slides were briefly washed and immersed in phosphate-buffered saline (PBS) buffer for 5 min, and PBS was also used 5 min between all the following staining steps. After that, slides were immersed in citrate buffer solution (pH=6.0) and were heated in a digital decloaking chamber (Biocare Medical, Concord, CA, USA) for 30 min to induce antigen retrieval. Endogenous peroxidase activity was then inhibited by 15-min of incubation in 3% H2O2, followed by 3% bovine serum for 30 min in a humidified chamber to block nonspecific binding sites. Primary antibodies to c-met (dilution, 1:100; Zymed Laboratories, South San Francisco, CA, USA), anti-HSP70 (dilution, 1:100; Zymed), HGF (dilution, 1:100; Zymed) and c-kit (dilution, 1:100; Zymed) were added individually to the slides, and were allowed to incubate for 90 min. Slides were then washed and incubated in a secondary biotinylated goat anti-rabbit IgG antibody (Dakopatts, Glostrup, Denmark) for 20 min. Next, slides were incubated with streptavidin–horseradish peroxidase (HRP) (DAKO. LSAB kit, K0675, Carpinteria, CA) conjugated for 20 min. Finally, incubation for 2~4 min in diaminobenzidine (DAB) (Dako, Carpinteria, CA) substrate-chromogen for peroxidase was used to visualize the bound antibody. For slides were used for image quantification, no counterstain was applied so as to simplify image colorimetric quantification. Mean optical density measurement In this study, histological sections on slides were imaged using a Nikon 80i Eclipse E600 microscope (Nikon, Tokyo, Japan) equipped with the Nikon's Digital Sight DS-Fi1 camera system (Nikon, Kawasaki, Japan). Visualization was performed at high magnification (objective × 40). On each slide sample, 20 fields of area were chosen randomly throughout histological sections, but
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
edge areas were avoided. An image analysis using Image-Pro Plus 6.2 software for windows (Media Cybernetics, Silver Springs, MD, USA) was performed for the following quantification. To evaluate the IHC staining intensity (mean optical density, MOD) of HGF, c-met, HSP70, and c-kit, an image analysis was used following a previous protocol with minor modifications (23,28,29). First, images were converted into an eight-bit gray-scale with pixel values within the range of 0.0 (black) to 255.0 (white). On each gray image, five visually cytoplasmic stained areas were randomly selected, and a white area served as a blank reference. The pixel data were then imported to Microsoft Excel 2007 (Microsoft, Seattle, WA). The MOD value of each image was obtained according to the following formula: I 1 N MOD = - ∑ log 1 N i =1 I 0 ............... (30)
in cell layers, 20 sections per rat, corresponding to 120 values per group were obtained a mean value for statistical comparison. Statistical analysis was carried out by two-way analysis of variance (ANOVA) (stage × training) followed by Scheffe’s F test for multiple comparison to assess the differences between the trained and the control groups. Statistical significance was accepted at p <0.05 for all tests. Results HSP70 Fig. 1 shows the HSP70 contents. Representative IHC images express deeper color represent a higher protein levels (Fig. 2). As seen, the HSP70 contents showed significant training (p <0.05) effects, and significant trained group by time effect (p <0.05). The HSP70 contents were significantly higher in the trained groups than that in their control counterparts (p < 0.05), and HSP70 content in the 8WT group was significantly lower than that in the 4WT group (p < 0.05).
where N is equal to five, Ii is the intensity level of the pixel i, and Io is the intensity level of the blank background measured in each image. In this study, one person performed all counting in duplicate and was blinded to the groups’ identity until all counting was completed. There were no differences between counts of each dependent parameter, so the count was considered reliable. Averaged values from all the duplicated dependent parameters were used for statistical analysis. Data analysis All data were expressed as the mean ± standard deviation of the mean (SD). To compare the difference of dependent parameters more precisely
Fig. 1. The mean optical density of HSP70 of rat cardiomyocyte for 4 wk trained (4WT) and 8 wk trained (8WT); and controls for 4 wks (4WC) and 8 wks (8WC). Each column represents the mean±SEM of 120 values (six rats, 20 values per rat). *Significantly differs of trained groups when compared to its control counterparts (p < .05). †Significantly differs between 4WT and 8WT groups (p < .05).
Fig. 2. Representative IHC images of HSP70 from rat cardiomyocyte,which include example for 4 wk control (4WC), 4 wk trained (4WT), 8 wk control (8WC), and 8 wk trained (8WT) groups. Images were acquired using 40×magnification objectives. The bar represents 10 μm
Journal of Society for development in new net environment in B&H
1915
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
HGF/c-met signaling pathway Fig. 3 shows the HGF (A) and c-met (B) contents. Representative IHC images are shown in Fig. 4. Taken together, the HGF and c-met contents showed significant training (p <0.05) effects, the trained groups exhibited significantly greater HGF and c-met contents in comparison with their respective control counterparts (p < 0.05). However, there were no significant differences in HGF and c-met contents between 4WT and 8WT groups.
C-kit C-kit content showed significant training effect (p <0.05) in wk 4, and significant trained group by time effect (p <0.05). The 4WT group was higher than those of the 4WC and 8 WT groups (p < 0.05), whereas no significant difference occurred in the c-kit content between the 8WT and 8WC groups (Fig. 5 and 6).
Fig. 3. The mean optical density of HGF (A) and c-met (B) of rat cardiomyocyte for 4 wk trained (4WT) and 8 wk trained (8WT); and controls for 4 wks (4WC) and 8 wks (8WC). Each column represents the mean±SEM of 120 values (six rats, 20 values per rat). *Significantly differs of trained groups when compared to its control counterparts (p < .05)
Fig. 5. The mean optical density of c-kit of rat cardiomyocyte for 4 wk trained (4WT) and 8 wk trained (8WT); and controls for 4 wks (4WC) and 8 wks (8WC). Each column represents the mean±SEM of 120 values (six rats, 20 values per rat). *Significantly differs of trained groups when compared to its control counterparts (p < .05). †Significantly differs between 4WT and 8WT group (p < .05) Discussion This study investigated molecules with potential cardioprotective properties, including stem cell activation marker in the myocardium in response
Fig. 4. Representative IHC images of HGF and c-met from rat cardiomyocyte, which include example for 4 wk control (4WC), 4 wk trained (4WT), 8 wk control (8WC), and 8 wk trained (8WT) groups. Images were acquired using 40×magnification objectives. The bar represents 10 μm 1916
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Fig. 6. Representative IHC images of c-kit from rat cardiomyocyte,which include example for 4 wk control (4WC), 4 wk trained (4WT), 8 wk control (8WC), and 8 wk trained (8WT) groups.Images were acquired using 40×magnification objectives. The bar represents 10 μm to 4 and 8 wks of moderate endurance training. The principal findings of this study were that 4 wks of moderate endurance training could improve cardioprotection, as demonstrated by the higher HSP70, HGF/c-met and c-kit contents in trained groups compared with their control counterparts. The training effect of the HGF/c-met signaling pathway lasted for 8 wks, but the HSP70 and c-kit responses were attenuated at wk 8. Endurance exercise has been confirmed as a pragmatic and a non-clinical countermeasure capable of improving cardiovascular health and cardioprotection, particularly training at moderate intensity is mostly favored and recommended (2,3). Proposed molecule serving as the main criterion for accessing exercise-induced cardioprotection is the induction of myocardial HSP70, which strengthen cardioprotection when exposed to stress (5,6,7). In this study, HSP70 content increased as a result of 4 wks of training. Our data are consistent with the hypothesis and those of Lennon et al. (31) who concluded that moderate intensity exercise training is effective in preceding the increase of HSP70. While at wk 8, the training effect of the increased HSP70 content was slightly attenuated although the HSP70 content remained higher relative to its control counterpart. The results may reflect the fact that HSP70 content was gradually downregulated from 4-8 wks of training. HSP70 content in response to exercise has shown to be exercise intensity-dependent (32), suggesting that trained animals may adapt to a chronic exercise program, and thus a smaller workload may be placed on the heart during each training session. In addition to HSP70, enhanced HGF/c-met signaling pathway has recently emerged as important molecular clues in regulating exerciseinduced cardioprotection (8,9,33). As far as we can ascertain, this is the first study to examine the HGF/c-met signaling pathway of cardiomyocytes in response to training, in particular, to moderate endurance training. Data obtained in the study reveals that a 4 wk moderate endurance training regimen per se, was demonstrated to be a useful approach for elevating HGF content. In addition, c-met, the HGF signal receptor was also upregulated parallel to the HGF increase. Moreover, the training effects for both lasted through the 8 wks once the training protocol was continued. Compared with previous studies which found that acute exercise significantly increases circulating HGF production (9), our study provides further evidence that repeated bouts of moderate intensity exercise not only increased cardiomyocytes HGF content but also its receptor, c-met. Upregulation of the HGF/c-met signaling pathway may target downstream signaling cascades as various physiological events proceed; these include wound healing, tissue repair and regeneration (8). Furthermore, HGF/c-met signaling pathway shares an overlap mechanism with HSP70 in protecting cardiomyocytes against ischemia/infarction (33). Coupled with the HSP70 responses in our findings, the results revealed that the training effects of HGF/c-met signaling lasted longer than those of HSP70, which implies that the effect of training-induced cardiomyocytes against damage may persist for a period even if adaptation to exercise intensity occurred. In addition to the repairing capacity of the HGF/ c-met signaling pathway, the contribution of stem cells on specific tissue including both the resident reservoir of stem cells and other stem cell sources were more efficient for tissue remolding (10,11). 1917
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The candidate biomarker represented by CSC, ckit, is expressed not only by cardiac stem cells but also by cardiomyocytes, attracting cell sources for cardiomyocyte repair and regeneration, coincident with the onset of cardiomyocyte terminal differentiation (10.13). In the present study, specific staining for the c-kit was observed to be higher in 4 wk trained rats relative to the control rats in the cytoplasm of the cardiomyocyte. While the exact mechanisms for the induction of stem cell activation in the myocardium following exercise remain unclear, the c-kit in 4 wk trained rats presented here reveals that a potentially mobilized source of stem cells is directly or indirectly implicated in cardiomyocytes repair and regeneration. However, an interesting finding is that the training effect of the c-kit was no longer apparent at wk 8; this may reflect the fact that training-induced c-kit activation is primarily in the early phase of training and is easily subject to reverse when a training period is elongated, possibly due to adaptation to exercise intensity. Taken together with all of the molecular markers detected, the phenomenon that the c-kit content in the 8 wk trained rats exhibited no resultant change while the HGF/c-met signaling pathway and HSP70 content were increased at wk 8, may be attributed to stem cell properties. Stem cell is characterized by unique cell that possess the capacities to both self-renew and give rise to multiple differentiated progenies (13). Beltrami indicated that a heart harbors stem cell regenerative response stops before the repair process is completed (34). Accordingly, it raises the possibility that the training induced an increase in stem cell activation in the myocardium might be subject to withdrawal once it has accomplished remodeling regardless of the cardioprotective and repair physiological capacity consequences remain proceeded. Take the fusogenic myocyte for example. Training-induced muscle stem cell activation is subject to a return to baseline level while the increased muscle fiber area and improved aerobic fitness persist as the training plan proceeds (35). This study has some limitations. First, we assessed stem cells in the myocardium using the IHC staining of a c-kit antigen, as opposed to establishing these phenomena with an isolated cardiac resident reservoir of stem cell sorting techniques. Second, our data is limited to only two time courses of 1918
measure points, 4 and 8 wks. A more prolific time course alteration may be observed in the future. Conclusion In conclusion, this study suggests that moderate endurance training may be a useful approach for the activation of stem cells in the myocardium and cardiomyocyte HGF/c-met signaling pathway. Training-induced stem cell activation in the myocardium corresponds to the cardioprotective molecular markers in the early phase of training. The activated stem cells in the myocardium might be subject to a withdrawal before the remodeling events have been completed. Additionally, the training induced upregulation of cardiomyocyte HGF/c-met signaling pathways may participate in a longer lasting mechanism for exercise traininginduced cardioprotection. Acknowledgements This work was supported by the Shin Kong Wu Ho-Su Memorial Hospital, ROC (SKH-FJU-9507) and National Science Council, ROC (NSC932413-H-038-001). We greatly appreciate Ms. HsinLung Lu for skillful laboratory assistance.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
References
1. Kavazis AN. Exercise preconditioning of the myocardium. Sports Med 2009;39,923-34. 2. American College of Sports Medicine Position Stand. The recommended quantity and quality of exercise for developing and maintaining cardiorespiratory and muscular fitness, and flexibility in healthy adults. Med Sci Sports Exerc 1998;30, 975-91. 3. Chandrashekhar Y, Anand IS. Exercise as a coronary protective factor. Am Heart J 1991;122,1723-39. 4. Kiang JG, Tsokos GC. Heat shock protein 70 kDa: molecular biology, biochemistry, and physiology. Pharmacol Ther 1998;80,183-201. 5. Selkirk GA, McLellan TM, Wright HE, Rhind SG. Expression of intracellular cytokines, HSP72, and apoptosis in monocyte subsets during exertional heat stress in trained and untrained individuals. Am J Physiol Regul Integr Comp Physiol 2009;296,575-86. 6. Starnes JW, Taylor RP. Exercise-induced cardioprotection: endogenous mechanisms. Med Sci Sports Exerc 2007;39,1537-43. 7. Thorp DB, Haist JV, Leppard J, Milne KJ, Karmazyn M, Noble EG. Exercise training improves myocardial tolerance to ischemia in male but not in female rats. Am J Physiol Regul Integr Comp Physiol 2007;293,363-71. 8. Conway K, Ruge F, Price P, Harding KG, Jiang WG. Hepatocyte growth factor regulation: an integral part of why wounds become chronic. Wound Repair Regen 2007;15,683-92. 9. Yasuda S, Goto Y, Takaki H, Asaumi Y, Baba T, Miyazaki S, Nonogi H. 10. Exercise-induced hepatocyte growth factor production in patients after acute myocardial infarction: its relationship to exercise capacity and brain natriuretic peptide levels. Circ J 2004;68,304-7. 11. Barile L, Messina E, Giacomello A, Marbán E. Endogenous cardiac stem cells. Prog Cardiovasc Dis 2007;50,31-48. 12. Behfar A, Terzic A. Cardioprotective repair through stem cell-based cardiopoiesis. J Appl Physiol 2007;103,1438-40.
13. Bittner RE, Schöfer C, Weipoltshammer K, Ivanova S, Streubel B, Hauser E, Freilinger M, Höger H, Elbe-Bürger A, Wachtler F. Recruitment of bone-marrow-derived cells by skeletal and cardiac muscle in adult dystrophic mdx mice. Anat Embryol (Berl) 1999;199,391-6. 14. Beltrami AP, Barlucchi L, Torella D, Baker M, Limana F, Chimenti S, Kasahara H, Rota M, Musso E, Urbanek K, Leri A, Kajstura J, Nadal-Ginard B, Anversa P. Adult cardiac stem cells are multipotent and support myocardial regeneration. Cell 2003;114,763-6. 15. Linke A, Muller P, Nurzynska D, Casarsa C, Torella D, Nascimbene A. Castaldo C, Cascapera S, Böhm M, Quaini F, Urbanek K, Leri A, Hintze TH, Kajstura J, Anversa P. Stem cells in the dog heart are self-renewing, clonogenic, and multipotent and regenerate infarcted myocardium, improving cardiac function. Proc Natl Acad Sci U S A 2005;102,8966-71. 16. Anversa P, Kajstura J, Leri A, Bolli R. Life and death of cardiac stem cells: a paradigm shift in cardiac biology. Circulation 2006;113,1451-63. 17. Kolwicz S C, MacDonnell SM, Renna BF, Reger PO, Seqqat R, Rafiq K, Kendrick ZV, Houser SR, Sabri A, Libonati JR. Left ventricular remodeling with exercise in hypertension. Am J Physiol Heart Circ Physiol 2009;297,H1361-8. 18. Gude N, Muraski J, Rubio M, Kajstura J, Schaefer E, Anversa P, Sussman MA. 19. Akt promotes increased cardiomyocyte cycling and expansion of the cardiac progenitor cell population. Circ Res 2006;99,381-8. 20. Urbanek K, Rota M, Cascapera S, Bearzi C, Nascimbene A, De Angelis A, Hosoda T, Chimenti S, Baker M, Limana F, Nurzynska D, Torella D, Rotatori F, Rastaldo R, Musso E, Quaini F, Leri A, Kajstura J, Anversa P. Cardiac stem cells possess growth factor-receptor systems that after activation regenerate the infarcted myocardium, improving ventricular function and long-term survival. Circ Res 2005;97,663-73. 21. Poehlman ET, Rosen CJ, Copeland KC. The influence of endurance training on insulin-like growth factor-1 in older individuals. Metabolism 1994;43,1401-5.
Journal of Society for development in new net environment in B&H
1919
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
22. Iemitsu M, Maeda S, Jesmin S, Otsuki T, Miyauchi T. Exercise training improves aging-induced downregulation of VEGF angiogenic signaling cascade in hearts. Am J Physiol Heart Circ Physiol 2006;291,H1290-8. 23. Scheinowitz M, Kessler-Icekson G, Freimann S, Zimmermann R, Schaper W, Golomb E, Savion N, Eldar M. Short-and long-term swimming exercise training increases myocardial insulin-like growth factor-I gene expression. Growth Horm IGF Res 2003;13,19-25. 24. Zhang QJ, Li QX, Zhang HF, Zhang KR, Guo WY, Wang HC, Zhou Z, Cheng HP, Ren J, Gao F. Swim training sensitizes myocardial response to insulin: role of Akt-dependent eNOS activation. Cardiovasc Res 2007;75,369-80. 25. Hsu CC, Hsu MC, Huang MS, Chen CS, Shiang TY, Wang CH, Borcherng Su. The HSP expression of passive repetitive plyometric trained skeletal muscle. Res Commun Mol Pathol Pharmacol 2005;117-118,91-103. 26. Mausset-Bonnefont AL, de Sèze R, Privat A. Immunohistochemistry as a tool for topographical semi-quantification of neurotransmitters in the brain. Brain Res Brain Res Protoc 2003;10,14855. 27. Armstrong RB, Laughlin MH, Rome L, Taylor CR. Metabolism of rats running up and down an incline. J Appl Physiol 1983;55,518-21. 28. Starnes JW, Taylor RP, Ciccolo J.T. Habitual lowintensity exercise does not protect against myocardial dysfunction after ischemia in rats. Eur J Cardiovasc Prev Rehabil 2005;12,169-74. 29. Vesna S, Slobodanka M, Snezana J, Milan K, Goran A, Irena T. Correlation of p53 expression levels with the degree of histological differentiation histological stages of colorectal carcinomas. HealthMED 2011;5,151-64. 30. Charalambous D, Kitchen PR, Stillwell RG, Smart PJ, Rode J. A comparison between radioligand and immunohistochemical assay of hormone receptors in primary breast cancer. Aust N Z J Surg 1993;63,637-41. 31. Kobori H, Ozawa Y, Suzaki Y, Nishiyama A. Enhanced intrarenal angiotensinogen contributes to early renal injury in spontaneously hypertensive rats. J Am Soc Nephrol 2005;16,2073-80.
32. Shaw MJ, Shennib H, Bousette N, Ohlstein EH, Giaid A. Effect of endothelin receptor antagonist on lung allograft apoptosis and NOSII expression. Ann Thorac Surg 2001;72,386-90. 33. Lennon SL, Quindry JC, French JP, Kim S, Mehta JL, Powers SK. Exercise and myocardial tolerance to ischaemia-reperfusion. Acta Physiol Scand 2004;182, 161-9. 34. Milne KJ, Noble EG. Exercise-induced elevation of HSP70 is intensity dependent. J Appl Physiol 2002;93,561-8. 35. Jin H, Wyss JM, Yang R, Schwall R. The therapeutic potential of hepatocyte growth factor for myocardial infarction and heart failure. Curr Pharm Des 2004; 10,2525-33. 36. Beltrami AP, Urbanek K, Kajstura J, Yan SM, Finato N, Bussani R, 37. Nadal-Ginard B, Silvestri F, Leri A, Beltrami CA, Anversa P. Evidence that human cardiac myocytes divide after myocardial infarction. N Engl J Med 2001; 344,1750-7. 38. Olesen JL, Aagaard P, Kadi F, Tufekovic G, Verney J, Olesen JL, Suetta C, Kjaer M. Creatine supplementation augments the increase in satellite cell and myonuclei number in human skeletal muscle induced by strength training. J Physiol 2006; 573(Pt 2),525-34. Corresponding author Borcherng Su, Department of Pathology, Hualien Tzu Chi medical center, Taiwan, R. O. C. E-mail: pathology@email.com
1920
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Measuring health care quality with the Servqual method: a comparison in public and private hospitals
Oğuz Işık1, Dilaver Tengilimoğlu2, Mahmut Akbolat1
1 2
Sakarya University, Vocational School of Health Sciences, Sakarya, Turkey, Gazi University, Faculty of Commerce and Tourism, Ankara, Turkey.
Abstract Hospitals are increasingly realizing the need to focus on service quality as a measure to improve their competitive position in today’s highly competitive environment. The aim of the study is to evaluate the service quality of hospitals from the customers’ perspective and comparing public and private hospitals. In this study, a total of 610 customers were selected randomly and asked to complete a questionnaire that was designed according to SERVQUAL methods. This questionnaire measured customers' perceptions and expectations in five dimensions of service quality that consists of tangibles, reliability, responsiveness, assurance and empathy. The quality gap of hospital services was determined based on differences between customers' perceptions and expectations. In general, the evaluation of the service quality of the hospitals that the customers preferred are negative (SERVQUAL Score= -0,328). When we examine the hospitals’ SERVQUAL scores according to their type of property, public hospitals (SERVQUAL score= -0,394) are negatively evaluated by consumers in comparison to private sector hospitals (SERVQUAL score= -0,246). The results of this research suggest that the SERVQUAL instrument is a useful measurement tool in assessing and monitoring service quality in hospitals, enabling the staff to identify where service improvements are needed from the customers' perspectives. Key words: SERVQUAL, hospital, healthcare, healthcare quality.
Introduction Avedis Donabedian, a leader who shapes the understanding of quality in health care, defines high quality service as: “the care expected to maximize the comprehensive level of the wellness of the patient after calculating the gains and losses balance that are expected during all parts of the care process”. On the other hand, “quality” in health, according to Donabedian, is a very difficult, perhaps impossible, concept to define entirely. However, it is suggested that six features scope most of the quality concept; these are effectiveness, efficiency, optimality, acceptability, legitimacy and equality (1). When these are considered one by one or in various combinations they form the definition of quality and provide the degree of quality when they are measured in some way (2). Grönroos (1984) examined the concept of service over two concepts; technical quality and functional quality. Consequently, health care also has two different perspectives; Technical quality (it is also, namely, quality) and functional quality (3). Although functional quality in the healthcare field are a result of the approach of healthcare providers, technical quality means medical diagnosis and the correctness of procedures and is usually understood by professionals (4). Therefore it is difficult for technical quality to be evaluated by consumers within a healthcare scope and this situation leads to many patients evaluating healthcare from only a functional perspective (5). Accordingly, patients generally perceive the functional quality that comprise of the service that is provided. The perception of functional quality may 1921
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
affect future decisions of the patients in returning to the facility for further care. However, some empirical evidence shows that as a reflect of output such as assessing the mortality risk among patients that are admitted to hospital due to medical conditions, the quality opinion of the patients can be positively correlated with technical quality (6). The concept of quality, carrying different perceptions and meanings for each person, comprises constantly developing (bettering) the service given to provide the expectations and needs of the served society, payers, employees, doctors and patients (7). There is an increasing interest towards collecting feedback from patients in order to point out the perspectives of healthcare that needs betterment and to track its performance and care quality. Assessing healthcare, which has been based on implementing professional standards for a while, has increasingly begun to include the measurements of the patients’ perceptions. Measuring the patients’ perceptions is supported by further including the patients in decisions made about themselves, better behavior towards them or desires to assess the affect of budget restrictions on accessibility and quality (8). Consequently, healthcare quality and its measurement compose a great significance in health managements. Scientific research conducted in this field show that the perceived quality is a significant factor in patients recommending the hospital they went to others and prefer going to the same hospital again when they need to (9, 10, 11). Measuring Healthcare Quality The quality of healthcare has mainly been defined as a subjective and physiological notion. Measuring and researching such subjective notions may sometimes lead to some difficulties (12). Especially features of care such as intangibility, heterogeneity, concurrence (13) and not being able to be stocked differentiates measuring, controlling and managing healthcare service from managements that produce physical goods, requires it to be examined (14). Healthcare having different perceptions also leads to various service quality measurement models (15). The first model developed for measuring healthcare quality is the “Perceived Service 1922
Quality” by Grönroos (16). Later, the SERVQUAL model, developed by Parasuraman, Zeithaml and Berry, (17) and SERVPERF by Cronin ve Taylor (18) that only takes the perceptions of the customer as a basis in measuring the quality of the service was developed. In addition to these, recently, the “Critical Event Technique”, which is based on the most positive or negative events that customers encounter during the purchasing of service, has been used among the models for the measurement of service quality. SERVQUAL is the most prevalent scale known to measure the quality of the service according to the opinion of the receiver (19). SERVQUAL was developed based on a marketing perspective with the support of the Marketing Science Institute (20, 21). The purpose of the scale is to ensure a tool to measure service quality with small changes in the scale within a large range of services (21). The scale has been designed to be used in measuring service quality by considering the concept of gap and service quality extents together (22). The model defined as the service quality model (Figure 1), has four gaps at the bottom part for customer dissatisfaction resulting from management/service providers and a fifth gap on the top named the customer space (23): - Gap 1 Management’s perception towards customers’ expectations: Management may not always understand what the customer wants correctly. - Gap 2 Features of the service in view of the management’s perceptions: Although management perceives the desires of the customer it may sometimes not be able to ensure the standards to provide the customer’s needs. - Gap 3 Providing service in view of new service designs and standards: The personnel may be badly educated, insufficient or unenthusiastic towards providing standard service. Personnel may sometimes be idle or insufficient in listening to the customers and providing them with rapid service. - Gap 4 External communication in view of providing service: Customers’ expectations are affected by the announcements and advertisements made by management representatives.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
- Gap 5 Expected service in view of perceived service: This gap is created when the service quality is misperceived by the customer. If the management can completely minimize the 1st to 4th gaps, they will have also decreased the 5th gap. Accordingly, the 5th gap is a result of the other four gaps; SERVQUAL has been developed as a numerical definition of this fifth gap. SERVQUAL’s five aspects comprise shortly of the below matters (17, 25): - Tangibles: Physical features, equipment and the personnel’s appearance. - Reliability: Ability to perform the assured service in a reliable and correct manner. - Responsiveness: To be enthusiastic to assist and rapidly provide service to the customer. - Assurance: The politeness and knowledge of the personnel so it can provide assurance.
- Empathy: Special attention that the management shows towards its own customers. SERVQUAL’s areas of use have been determined by Zeithaml et al. (26) as the articles below: - Comparing the expectations and perceptions of customers at different times, - Comparing the management’s SERVQUAL score with the competitor management’s SERVQUAL score, - Examining different customer segments that have different perceptions of quality, and - Evaluating the quality perception of internal customers. When SERVQUAL is examined in terms of healthcare managements, it also serves as a tool in measuring the functional quality of hospital managers in their own organization. Consequently, one of the
Figure 1. Conceptual Model of Service Quality
Source: (24, 23)
Journal of Society for development in new net environment in B&H
1923
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
greatest contributions of SERVQUAL to the healthcare industry is pre-defining the indicators for the examination of the problems that prevent providing good-quality service and developing the ability of the sector in order to create a starting point (21). Because consumers mostly use different criteria while evaluating healthcare services. They consider components that are not technical, such as the distribution of services, the benefits and values expected from these services, to be important. These benefits take place as the consumer’s opinion within the technical parts of healthcare services. Within these non-technical benefits are the desires and expectations of consumers from healthcare services such as easily benefitting from services, being able to effectively interact with staff, physical comfort, good appearance, etc (27). During this study, we have used the SERVQUAL scale, out of the other service quality measurement models, to evaluate the quality of the hospital services. Materials and Methods This is a descriptive study and is based on field research. These types of studies aim to present the current situation on an event. The aim of the study is to evaluate the service quality of hospitals from the customers’ perspective and comparing public and private hospitals. A survey form prepared for this evaluation has been used. The data was collected on September 22nd to October 10th with faceto-face interviews with consumers. In the first part of the survey form, which comprises of two parts, there are the socio-demographical characteristics of the consumers and an open-ended question of what affects their decision in choosing a hospital. In the second part of the survey, however, is the SERVQUAL scale which comprises of 44 statements developed by Parasuraman, Zeithaml and Berry (17) and prepared according to the 7 point Likert scale (1=Strongly disagree –7=Strongly agree); 22 measure the consumers’ expectations from healthcare services and the other 22 measure the consumers’ perceptions regarding healthcare services. The main mass of the study is comprised of healthcare service consumers that reside within the borders of Sakarya Metropolitan Municipality. According to the population registry system based 1924
on addresses of 2008, the number of people residing within the borders of Sakarya Metropolitan Municipality is 555.313. However, due to it being difficult reaching all of the provinces population, sampling has been selected. The sampling of the study was selected by using the stratified random sampling method of the probability sampling methods and the greatness of the sampling, which was calculated according to the n=[N*p*q*Z2]/ [(N-1)*t2]+(p*q*Z2) (28) formula, was 384. 625 surveys were collected during the study and 610 surveys, which were in accordance to the analyses, were used. The alpha value method was used to test the reliability of the scale used in this study. As a result of the analysis conducted, the Cronbach Alpha value of the expectation statements in the first part concerning the SERVQUAL was calculated as 0,829 and Cronbach Alpha value of the perception statements in the second part was calculated as 0,890. These results show that the scale is highly reliable. Factor analysis was used in order to test the validity of the scale used in the study. There are two types of factor analysis: exploratory factor analysis (EFA) and confirmatory factor analysis (CFA) (29). In exploratory factor analysis, the factor elements are not known beforehand and it aims to define these elements; confirmatory factor analysis aims to confirm the previously known factor elements (30). Accordingly, the confirmatory factor analysis was used in defining the perception and expectation statements concerning the SERVQUAL scale used in the study. The 22+22 statements (4 for tangibles, 5 for reliability, 4 for responsiveness, 4 for assurance and 5 for empathy) that comprise the perception and expectation scales of the SERVQUAL scale have been subjected to a confirmatory factor analysis by means of using AMOS. As a result of the analysis, four statements that caused disruptive effect on both the perception and expectation scale was omitted. These statements were “Although hospital personnel are very busy it is appropriate that they quickly respond to the needs of the customers” in means of responsiveness, “Hospital staff should be sufficiently supported in order to be able to perform their work well” in means of reassurance” and “hospital staff cannot be expected to show the customers personal interest” in
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
means of empathy; in terms of perception it was the statements of “Xxx hospital staff work hard to quickly respond to the needs of customers”, “Xxx Hospital staff should be sufficiently supported in order to be able to perform their work well”, “Xxx hospital staff cannot show the customers personal interest” and “Xxx hospital’s working hours are not appropriate for all customers” statements that correspond to the same expectations. From the analyses conducted hereinafter, 18 statements were used for service quality in hospitals; 4 for tangibles, 5 for assurance, 3 for responsiveness, 3 for assurance and 3 for empathy (Figure 2).
Results The socio-demographic features of the healthcare consumers that participated in the study and their distribution according to the hospitals they preferred have been presented in Table 1. According to this table, 52.6% of the participants prefer public and 47.4% prefer private hospitals. In addition to this, in this study, the consumers have been asked what affected their decision in choosing the hospital they preferred and a large part of these consumers (31.4%) stated it to provision of high-quality service. The other reasons that the
Figure 2. Confirmatory Factor Analysis for SERVQUAL Scale
Journal of Society for development in new net environment in B&H
1925
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
consumers expressed to affect their preferences was trust (23.6%), satisfaction (18.5%), accessibility (13.2%), high-technology (9.5%), upon recommendation (2.5%) and advertisement (1.4%). The participant’s evaluations regarding the terms that comprise the service quality have been presented in Table 2. When we examine the levels of the expectations of consumers regarding the presentation of the services we see that the highest expectation is in terms of “Reliability (6,82±0,46)”. Along with the level of expectation in the reliability perspective, in which there are four statements, being very high, the highest expectation was in “Reliability-5 (6,84±0,56) “Hospitals must perform the examination and treatment services on time of the appointment”. The consumers’ perception on reliability is also very high (6,15±0,97). However, it is not high as to provide their expectations. The highest perception for the term of reliability regarding perceptions is Reliability-9 (6,35±1,11) “X hospitals take records correctly”. The second highest expectation level within these terms was the term of “Assurance (6,56±0,72)”. The highest expectation in terms of assurance was the statement of Assurance-16 (6,62±0,88) “Hospital personnel must be polite”. The highest perception in terms of assurance regarding perception was in the statement of Assurance-16 (6,09±1,23) “Xxx hospital’s personnel are polite”. Table 1. Socio-demographic Features
Gender Female Male Marital Status Married Single Education Status Primary School High School Associate’s Degree Bachelor’s Degree Master’s Degree Income Status (TL) ≤750 751-1500 1501-2250 2251-3000 ≥3001 n 252 358 n 432 178 n 120 221 113 131 25 n 100 240 183 40 47 % 41,3 58,7 % 70,8 29,2 % 19,7 36,2 18,5 21,5 4,1 % 16,4 39,3 30,0 6,6 7,7
One other term, “Tangibles (6,43±0,75)” had the third highest expectation level. The highest expectation in terms of tangibles was the statement of Tangibles-1 (6,87±0,66) “Hospital equipment must be modern”. This statement has the highest expectation among all statements. The consumers’ perception in terms of tangibles is (6,14±0,93) also rather high. However, it was not as high to provide their expectations. The highest perception in terms of tangibles was the statement of Tangibles-1(6,47±1,00) “Xxx hospital’s equipment is modern”. This statement also has the highest perception level among all perception statements. The term which is fourth among expectation levels is the term “Responsiveness (5,44±1,64)”. The highest expectation in the responsiveness term which comprises of three statements was the statement of “Responsiveness-12 (5,66±2,02) “Hospital personnel do not always have to be enthusiastic to help the patients”. The consumers’ perception in terms of responsiveness is higher (5,30±1,63) than the average. However, not as high as to provide expectations. The highest perception in terms of responsiveness regarding perceptions was the statement Responsiveness-12 (5,49±1,97) “Xxx Hospital personnel are not always enthusiastic to help the customers”. Ultimately, the lowest term in means both of expectation (4,66±1,81) and perception (4,63±1,67)
Occupation Worker Merchant Officer Educator Pensioner Housewife Technical Staff Farmer Student Age ≤25 26–35 36–45 ≥46 Hospital Pref. Public Private n 174 103 89 60 46 43 34 31 30 n 95 226 178 111 n 321 289 % 28,5 16,9 14,6 9,8 7,5 7,0 5,6 5,1 4,9 % 15,6 37,0 29,2 18,2 % 52,6 47,4
1926
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 2. Consumers’ Evaluations on the Quality of Hospital Services
SERVQUAL Dimensions and their Items Tangibles-1 Tangibles-2 Tangibles-3 Tangibles-4 Tangibles Reliability-5 Reliability-6 Reliability-7 Reliability-8 Reliability-9 Reliability Responsiveness -10 Responsiveness -11 Responsiveness -12 Responsiveness Assurance -14 Assurance -15 Assurance -16 Assurance Empathy-18 Empathy -20 Empathy -21 Empathy Mean S.D. Mean 610 6,87 0,66 6,47 610 5,84 1,54 5,77 610 6,53 0,89 6,17 610 6,46 1,07 6,16 610 6,43 0,75 6,14 610 6,84 0,56 6,03 610 6,75 0,67 6,10 610 6,83 0,55 6,27 610 6,83 0,62 6,00 610 6,83 0,64 6,35 610 6,82 0,46 6,15 610 5,56 2,06 5,22 610 5,09 2,17 5,20 610 5,66 2,02 5,49 610 5,44 1,64 5,30 610 6,54 0,90 6,04 610 6,52 0,93 5,99 610 6,62 0,88 6,09 610 6,56 0,72 6,04 610 4,63 2,31 4,50 610 4,43 2,32 4,81 610 4,92 2,29 4,59 610 4,66 1,81 4,63 SERVQUAL Score= -0,328 SERVQUAL Score -0,28 -0,29 -0,75 -0,57 -0,26 0,02 -0,58 -0,45 -0,10 0,06 -0,394 -0,246 n Expectation Perception S.D. 1,00 1,41 1,09 1,13 0,93 1,29 1,22 1,14 1,26 1,11 0,97 1,97 1,90 1,97 1,63 1,20 1,24 1,23 1,08 2,18 2,09 2,15 1,67 Service Quality Mean -0,40 -0,07 -0,37 -0,30 -0,29 -0,81 -0,65 -0,56 -0,82 -0,49 -0,67 -0,33 0,11 -0,17 -0,13 -0,50 -0,54 -0,53 -0,52 -0,13 0,38 -0,33 -0,03 S.D. 1,00 1,61 1,20 1,29 0,90 1,29 1,24 1,13 1,31 1,13 0,94 2,19 2,32 2,32 1,67 1,29 1,36 1,25 1,07 2,67 2,39 2,41 1,68
Table 3. Analysis of Consumers’ Evaluation of Service Quality in Terms of Hospital Property
SERVQUAL Dimensions Tangibles Reliability Responsiveness Assurance Empathy Hospital Property Public Private Public Private Public Private Public Private Public Private n 321 289 321 289 321 289 321 289 321 289 Public Private S.D. 0,94 0,86 1,01 0,83 1,72 1,59 1,10 1,03 1,76 1,58 t ,130 -2,446 -2,061 -1,469 -1,154 p 0,218 0,012 0,100 0,114 0,324
SERVQUAL Score
levels was Empathy. The highest expectation in terms of empathy was the statement “Empathy-21 (4,92±2,29) “It is not realistic to expect the hospital to prioritize the interest of the customers”; the highest perception level was the statement “Empa-
thy-20 (4,81±2,09) “Xxx hospital personnel do not know the needs of the customers”. In general, the evaluation of the service quality of the hospitals that the customers preferred are negative (SERVQUAL Score= -0,328). 1927
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
No statistically significant difference has been found in terms of evaluating the customers’ expectations and perceptions on service quality according to the property of the hospital they preferred (p>0,05). While the expectation in terms of “tangibles” and “reliability”, which are terms that comprise the service quality, were high for private hospitals; the expectations of “responsiveness”, “assurance”, and “empathy” were higher for public hospitals. On the other hand, the only term of consumers’ perception that was higher in public hospitals in comparison to private hospitals was “empathy”. As it has been presented in Table 3, only the term of “reliability” showed a statistically significant difference in the evaluation of the terms that compose the consumers’ preferred hospitals service quality (p<0,05). According to this, consumers evaluate public hospitals (-0,75±1,01) more negatively in comparison to private hospitals (-0,57±0,83) in terms of reliability. An interesting matter is that public hospitals have been evaluated to be better, even a little, than private hospitals only in terms of “tangibles”. In all other terms, especially in terms of “responsiveness” and “empathy”, it could be said that consumers have evaluated private hospitals more positively in comparison to public hospitals (Table 3). Consequently, when we examine the hospitals’ SERVQUAL scores according to their type of property, public hospitals (SERVQUAL score= -0,394) are negatively evaluated by consumers in comparison to private sector hospitals (SERVQUAL score= -0,246). Discussion Besides technologic developments that rapidly change every day, the changes in political and economical environments also make it necessary to implement new strategies in order for hospitals to proceed with their activities. In addition to this, there are great difficulties experienced in means of payments due to the majority of the budget being appropriated to inpatient treatment facilities; this causes the deficient amounts in social security to increase. As a result, public hospitals are being transformed to have a similar structure as private hospitals and work on covering their own in1928
comes and expenses. Public and private hospitals working under similar conditions will ensure the formation of an intense competitive environment. Accordingly, developing the competitive power of hospitals is significantly effected by creating positive perceptions in the customers’ minds. Because quality perception of a brand is an effective element in creating a reason to purchase (31). According to the results of the study, the hospitals level of development, quality of the service they provide, the trust they feel for the hospital and satisfaction of services are significant reasons among consumers’ preferences. Accordingly, it could be said that hospitals which develop their service strategies on customer satisfaction, high quality service and mutual trust with consumers will be preferred more than their rivals. In addition to this, the statements in relation with the terms of tangibles, reliability, responsiveness, assurance and empathy that comprise the quality of the service have been analyzed in detain by taking the expectations and perceptions of the consumers as a basis. According to the results of the analysis none of the terms (Tangibles=-0,29, Reliability=-0,37, Responsiveness=-0,13, Assurance=-0,67 and Empathy =-0,03) in relation with the quality of the service entirely respond to the expectations of the consumer. The expectation perception gap (Gap 5) of the term assurance is the greatest. In a similar study conducted in Bangalore, it has been found that none of the terms (Tangibles=-0,37, Reliability =-0,41, Responsiveness =-0,27, Assurance =-0,09 and Empathy =-0,31) in relation with the hospitals’ service quality do not entirely respond to the expectations of patients (32). On the other hand, in a study conducted on 82 patients undergoing elective cardiac surgery, operated by midsternal thoracotomy, in Brazil it has been found that only the terms of reliability (reliability=-0,02), of the service quality terms, did not entirely meet the expectations of the patients, however, the perceptions were higher than the expectations of the other terms (33). The highest expectations of consumers on the service quality of the hospital were the statements of Tangibles-1(6,87±0,66) “Hospitals must have modern equipment”, Reliability-5 (6,84±0,56) “Hospitals must perform diagnosis and treatment services on time of the appointment” and Reliabi-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
lity-9 (6,83±0,64) “Hospitals must have correct records”. In an empirical study conducted by Babakuş and Mangold (21) on using the SERVQUAL scale on hospital services, the highest expectation was for the statement “Hospitals must have modern equipment” (4,86±0,41). In a study conducted in Taiwan on 1085 kidney patients, it has been found that the patients had the highest expectations in the statements E9 "Did the screening insist on error free records?" (6,68±0,69) and E14 "Did the staff instill confidence in you?" (6,67±0,69) (34). Consequently, it could be suggested that hospitals could take actions that would earn the trust of the consumers and leave a positive impression on them in order to ensure customer satisfaction. These actions could be, for instance, the hospitals having modern medical technology, giving in-service training regarding how the communication between patients and medical personnel should be, abiding by the times of appointments given to patients and providing a comfortable environment. As a result of the analysis conducted on the type of property regarding the service quality of hospitals, it has been observed that private hospitals (-0,246) were better at meeting the expectations of consumers when compared to public hospitals (-0,394), however, neither service quality of both types of hospitals in each group entirely met the expectations of consumers. On examining the service quality by means of its terms, while public hospitals were not able to meet expectations of consumers on any term, it has been seen that private hospitals meet consumers’ expectations in the terms of responsiveness and empathy. It is thought that the personal interest that private hospital personnel show towards individuals from their admittance to hospital until they are discharged affect this result. Accordingly, public hospitals could be recommended to work on reducing their waiting time during the treatment process, making patients feel their personal interest and learning what the needs of the patients are.
References
1. Donabedian A, The Process Of Quality Assurance, Hacettepe Journal Of Health Administration, 1992; 1(1): 17–52. 2. Kaya S, Sağlık Hizmetlerinde Sürekli Kalite İyileştirme, Pelikan Publications, April 2005. 3. Lin HC, Xirasagar S and Laditka JN, Patient Perceptions Of Service Quality In Group Versus Solo Practice Clinics, International Journal For Quality In Health Care, 2004; 16(6): 437-45. 4. Bopp K.D, How Patients Evaluate The Quality Of Ambulatory Medical Encounters: A Marketing Perspective, J Health Care Mark, 1990; 10: 6-15. 5. Lin DJ, Sheu IC, Pai JY, Bair A, Hung CY, Yeh YH and Chou MJ, Measuring Patient's Expectation And The Perception Of Quality In Lasik Services, Health And Quality Of Life Outcomes, 2009; 7: 6370. 6. Jaipaul CK., Rosenthal GE, Do Hospitals With Lower Mortality Rate Have Higher Patient Satisfaction? A Regional Analysis Of Patients With Medical Diagnoses, Am J. Med Qual, 2003; 18: 59–65. 7. Nelson EC, Larson CO, Hays RD, Nelson SA, Ward D, Batalden P, The Physician And Employee Judgment System: Reliability And Validity Of A Hospital Quality Measurement Method, Quality Review Bulletin, 1992; 18(9): 284-92. 8. Kaya S, Yiğit Ç, Peker S, Cankul Hİ, Bir Askeri Hastanenin Dahiliye Polikliniğini Kullanan Hastaların Kalite Algıları, Hacettepe Sağlık İdaresi Dergisi, 2003; 6(1): 89-113. 9. Headley DE., Mıller S, Measuring Service Quality And Its Relationship To Future Consumer Behavior, Journal Of Health Care Marketing, 1993; 13(4): 32-42. 10. Lım PC, Tang NKH, A Study Of Patients’ Expectations And Satisfaction İn Singapore Hospitals, International Journal Of Health Care Quality Assurance, 2000; 13(7): 290-99. 11. Mangold WG, Babakus E, Monitoring Service Quality, Review Of Bussiness, 1990; 11(4): 21-33. 12. Snoj B, Measurement Of The Services Quality From The Customers Perspective, Systems Research, 1994; 11(1): 155-65.
Journal of Society for development in new net environment in B&H
1929
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
13. Parasuraman A, Zeithaml Valarie A, Berry LL, A Conceptual Model Of Service Quality And Its Implications For Future Research, Journal Of Marketing, 1985; 49(4): 41-50. 14. Çatı K, Şahin S, Perakendecilik Hizmetlerinde Kalite, Hacettepe Üniversitesi İktisadi ve İdari Bilimler Dergisi, 2007; 25(2): 129–49. 15. Gürbüz E, Büyükkeklik A, Avcılar MY, Toksarı M, The Effect Of Perceived Service Quality On Satisfaction And Behavioral Intentions: An Empirical Study On Supermarkets In Niğde, Ege Academic Review, 2008; 8(2): 785–812. 16. Grönroos C, A Service Quality Model And Its Marketing Implications, European Journal Of Marketing, 1984; 18(4): 36-44. 17. Parasuraman, A., Zeithaml Valarie A., Berry, Leonard L.; "Servqual: A Multiple-Item Scale For Measuring Customer Perceptions Of Service Quality", Journal Of Retailing, 1988; 64(1): 12-40. 18. Cronin JJ, Taylor SA, Measuring Service Quality: A Reexamination And Extension, The Journal Of Marketing, 1992; 56(3): 55–68. 19. Piligrimiene Z, Buciuniene I, Different Perspectives On Health Care Quality: Is The Consensus Possible?, Economics Of Engineering Decisions, 2008; 1(56): 104–10. 20. Parasuraman A, Zeithaml VA, Berry LL, Servqual: A Multiple-Item Scale For Measuring Customer Perceptions Of Service Quality, Technical Report, Report No. 86-108, Marketing Science Institute, Cambridge, Ma, 1986. 21. Babakuş E, Mongold WG, Adapting The Servqual Scale To Hospital Services: An Empirical Investigation”, Health Services Research, 1992; 26(6): 767–86. 22. Wisniewski M, Wisniewski H, Measuring Service Quality In A Hospital Colposcoply Clinic, International Journal Of Health Care Quality Assurance, 2005; 18(3): 217-28. 23. Chowdhury MU, Customer Expectations And Management Perceptions In Healthcare Services Of Bangladesh: An Overview, Journal Of Services Research, 2008; 8(2): 121-40. 24. Zeithaml VA, Bitner MJ, Services Marketing: Integrating Customer Focus Across the Firm, McGraw Hill, 2003.
25. Kilbourne WE, Duffy JA, Duffy M, Girarchi G, The Applicability Of Servqual In Cross-National Measurements Of Health-Care Quality, The Journal Of Services Marketing, 2004; 18(7): 524-33. 26. Zeithaml VA, Parasuraman A, Berry LL, Delivering Quality Service: Balancing Customer Perceptions And Expectation, Free Perss. Usa, 1990. 27. Flexner WA, Berkowitz EN, Marketing Research In Health Services Planning: A Model, Public Health Reports, 1979; 94(6): 503-13. 28. Bal H, Bilimsel Araştırma Yöntem ve Teknikleri, Süleyman Demirel Üniversitesi Basımevi, Isparta, No:20, 2001. 29. Loehlin JC, Latent Variable Models; An Introduction To Factor, Path, And Structural Equation Analysis, Fourth Edition, Lawrence Erlbaum Associates, London, 2004. 30. Altunışık R, Coşkun R, Bayraktaroğlu S, Yıldırım E, Sosyal Bilimlerde Araştırma Yöntemleri SPSS Uygulamalı, Sakarya Kitabevi, Sakarya, 2005. 31. Aaker D. A, Managing Brand Equity: Capitalizing On The Value Of A Brand Name, The Free Press, 1991. 32. Rohini R and Mahadevappa B, Service Quality in Bangalore Hospitals-An Empirical Study, Journal of Services Research, 2006; 6(1): 59-84. 33. Borges JBC, Carvalho SMR and Silva MAM, “Quality Of Service Provided To Heart Surgery Patients Of The Unified Health System-Sus”, Rev Bras Cir Cardiovascular, 2010; 25(2): 172-182. 34. Lin DJ, Li YH, Pai JY, Sheu IC, Glen R, Chou MJ and Lee CY, Chronic Kidney-Disease Screening Service Quality: Questionnaire Survey Research Evidence From Taichung City, Bmc Health Services Research, 2009; 9: 239-50. Corresponding author Oğuz Işık, Sakarya University, Vocational School of Health Sciences, Sakarya, Turkey, E-mail: healthmedjournal@gmail.com
1930
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Economic Costs of Domestic Violence: A Community Study in South Africa
Koustuv Dalal1, Suraya Dawad2
1 2
Department of Public Health Science, School of Life Sciences, University of Skovde, Sweden, HEARD, University of KwaZulu Natal, South Africa.
Abstract The present study estimated economic costs of domestic violence against women who sought help from a community care centre in South Africa. It aimed to relate the victims’ income and victims’ family income to violence related injuries and related costs. This was a cross sectional study with face-to-face interviews in a community care center in which victims of domestic violence sought various kinds of assistance. In total, 261 women were interviewed. The average economic cost of each domestic violence incidence was 691 USD while average cost for medical expenditure was 29 USD and average loss of income due to domestic violence was 2092 USD. Larger families and higher individual and family incomes were protective factors for severity of violence related injuries. Pain and discomfort due to domestic violence emerged as expensive for both medical costs and productivity losses. Considering the average monthly income of 482 USD, domestic violence averaged a cost per incident of 691 USD during the previous month, indicating a deficit in household budget. We found that domestic violence against women resulted with expensive injuries, pain and discomforts. Key words: economic costs, violence against women, IDDO model, South Africa. Introduction Violence is one of the most expensive public health problems globally 1 – 5. Low- and middle-income countries account for more than 90% of violence related health and socioeconomic burden6. The WHO and others have indicated that cost calculation and economic analysis of violence,
particularly in low-income countries, should be a prioritized task in the policy-making process3,6. In addition, health economists have strongly advocated for methodological improvements in the cost calculation of violence, particular in lowincome countries3, 7. Furthermore, WHO’s multicountry study advocates for more studies due to the gaps in research on violence against women, particularly in relation to intimate partner violence in developing countries8. Stopping violence against women is a social responsibility and not doing this is a violation of women’s human rights9. Societies are obligated to provide protection of their women and to provide counseling for them10. Furthermore, societies are expected to provide police servcies, as well as justice systems for these women11. Domestic violence results in different physical and psychological health problems. A high number of physically abused women have injuries (depending on severity and frequencies) including bruises, wounds, pelvic pain, back pain, headaches and fractured bones12 -14. Physically abused reproductively active women also encounter gynaecological problems including terminated pregnancies, low-weight babies, peri-natal deaths and sexually transmitted diseases such as HIV/AIDS 8, 13, 15 -17 . Psychological consequences of women victims of domestic violence are depression, anxiety, low self-esteem, fear of intimacy and posttraumatic stress disorder 12, 13, 18, 19. Besides physical and psychological problems, female victims of violence exhibit risk-taking behaviours like unhealthy feeding habits, substance abuse, alcoholism and even suicidal behaviours12, 19, 20. Abused women also use higher proportion of community and healthcare services4, 12, 19. However few studies have examined the economic consequences of domestic violence3, 6, 8, 21. 1931
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
In South Africa, a ‘culture of violence’ is a strong pervasive feature of post-apartheid legacy, which often induce violence against women22. Studies suggest that there are relatively high levels of acceptance of domestic violence in South Africa23. One in every four women has experienced physical violence at some stage in her life24. Those subjected to violence, particularly violence against women, are often afraid to report this to legal authorities or friends and family because of fear of social stigma and the wide level of social acceptance of violence4, 25. Domestic violence and gender-based violence aimed at women is high across all economic and racial groupings26. Several studies have reported on risk factors and social consequences of domestic violence1-5, 27- 29 . However, less information is available on the economic costs of domestic violence against women, though policy makers may be better convinced by monetary values for adopting preventative strategies3, 4. In particular, knowledge is lacking about the cost of domestic violence in relation to injuries. Yodanis and his colleagues argue that the cost for acts of physical, sexual, and psychological abuse against women and children falls on the victims, their friends, relatives, and employers 9. Furthermore, governments also “incur” expenses in terms of their justice and legal systems, medical and social systems, refuge and support, re-housing and public assistance9, 1. Several studies have indicated that identifying the victims of domestic violence, especially in the developing countries is a methodological problem for studying the subject of the field of domestic violence2 -4. Furthermore, the victims of domestic violence in the developing countries are reluctant to disclose the information regarding their victimization in absence of regular screening at the health care facilities3. The Chatsworth Community Care Centre (CCCC), Durban, South Africa has provided the unique opportunity to study the victims of domestic violence. CCCC is the only community care centre at the big community, Chatsworth, providing services to the victim women for more than a decade and is well acquainted with the trust of the women regarding their private issues30. This current study aimed to estimate economic costs of domestic violence against women who sought help from a community care centre in Sou1932
th Africa. It also aimed to relate the victims’ income and victims’ family income to violence related injuries and related costs. Methods This was a cross-sectional study that was undertaken in Chatsworth, KwaZulu-Natal, South Africa. For this study, only related costs and injuries due to violence against women were considered in the current study. The study was conducted during August – October 2008. Study Area Chatsworth is a large township within the Durban Metropolitan area, which was created during the apartheid regime, as an area for housing people of ‘Indian’ population. It remains predominantly inhabited by the Indian population, and informal settlements in and around Chatsworth provide housing for refugees and other black urban populations. The total population of Chatsworth is approximately 750 000. Chatsworth Community Care Centre In 2002 the Institute for Security Studies published Violence Against Women, exploring women’s experiences of gender-based violence in South Africa 26. This highlighted the limited support women received from police, government departments and the healthcare sector and the crucial role non-governmental organisations (NGOs) play in providing counseling and support for survivors of domestic violence 26. Chatsworth Community Care Centre (CCCC) is one such NGO which provides counseling and a wide range of support for victims of domestic violence in Chatsworth 30. Study population In absence of registry data a complete list of women who have been victims domestic violence is unavailable in South Africa. All female victims of domestic violence who visited CCCC for rendering any sort of service constituted the study population. Average number of women who sought assistance from CCCC per month is between 500 and 550. We used the WHO guidelines and terminologies to define the victim of domestic violence2.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Sampling technique To identify their economic losses and severity of injuries as a result of domestic violence, victims who sought the services of CCCC were interviewed. Every second female victim who visited CCCC was selected for the study and interviewed and constituted the study sample (n = 261). Research Instruments Structured pre-tested questionnaires with close-ended questions were administered by CCCC volunteers. Questions were asked regarding victims’ age, education, number of family members, income, severity of injuries, expenditure for treatment, victims/relative’s loss of income due to the incidence and source of financing for treatment costs. Questions were asked about family income, mode of income and family economic issues. Severity of injuries was pre-defined to the respondents. The severity options were: not injured; injured but did not visit any medical doctor; injured and visited medical doctor or hospital emergency department; and injured with risk of life and admitted to hospital2. However in absence of health care set up including trained nurses and physicians, we had relied on victim’s report on injuries, pain and discomfort and could not use established instruments such as Injury Severity Scale (ISS) to measure injuries. The questionnaire regarding economic elements was validated and used in published literatures3, 31. Data collection procedures Data were collected by the volunteers at CCCC over a period of 3 months (August – October 2008). The volunteers were providing services and counseling to the victims of domestic violence at CCCC for the previous 10 years. They were further trained to administer the questionnaire and conducting the face-to-face interviews. Variables of interest The following variables were used: age group, education, number of family members, victims income, family income, mode of income, per capita family income, total medical costs, income loss due to victimization of domestic violence. Severity of injury due to domestic violence was categorized into five strata: Injured but did
not visit medical doctor; Injured and visited medical doctor and/or hospital emergency department; Injured and visited medical doctor and admitted to hospital; Injured and had pain and discomfort but did not visit medical doctor. In South Africa the education system has the following grades: No education, Primary education (Grades 1 – 7); Secondary Education (Grades 7 – 12) and Tertiary education (university, technician, colleges). Cost calculations As the study consisted of a sample of women who had experienced domestic violence, the costs accounted for here were based on their injury severity, pain and discomfort. For each category the victims were asked about the amount spent for treatment and related loss of income. As South Africa has no registry system like the Scandinavian countries, the authors had to rely on self reported information. The counselors of CCCC were regarded as trustworthy in the eyes of victims who sought assistance for handling such personal information for more than a decade30. Therefore, maximum disclosure of fact by the victim was highly expected. According to researchers, there different methodologies are use to measure direct and indirect costs: proportionality, econometric and accounting3, 32. The current study employed accounting methods for estimating the costs3. The average amount (arithmetic mean) deducted was per domestic violence incidence. Cost elements in the study were for previous 30 days from the date of interview. All the monetary units were expressed in South African Rand, ZAR (1USD = 7.04 ZAR). Statistical analysis Health economic analysis of violence and injuries had not developed many instruments to measure the costs. Most commonly used instrument is arithmetic mean of the cost elements. Literatures suggest that no amount of statistical analysis is probably able to compensate for poor quality of cost data presented in simple statistics33, 34. Therefore for cost estimation we mainly used arithmetic mean, mode and standard deviation. After estimating the cost elements, the study grouped them 1933
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
according the quartile distribution for better statistical analysis. Cross-tabulations (with chi-square tests) were performed to examine the relationship between severity of injuries due to violence and demographic and economic variables. A pie-diagram was used to represent the sources of money for treatment of victims of violence. SPSS version 18 was used for statistical analysis. Ethical permission The study received ethical permission from the Human and Social Sciences Ethics Committee of the University of KwaZulu-Natal. Furthermore, the research adhered to the strict guidelines set out for research into domestic violence by the World Health Organization35.
Every measure was put in-place to make certain that respondents granted us informed consent before being interviewed. Verbal consent was obtained from the respondents. Due to literacy problem we could not seek written consent from the respondents. In all cases, autonomy, privacy and rights of withdrawal were maintained. CCCC was involved in all aspects of arranging and managing interviews and was available to provide counseling to any of those interviewees who required it. Results Among the 261 respondents, 44% of the women had minor injuries (injured but did not visit medical doctor), 26% had moderate injuries (injured and visited medical doctor and/or hospital
Table. 1. Demographics of violence related injuries, pain and discomforts
Variables Age group Below 19 years 20 – 24 years 25 – 29 years 30 – 34 years 35 – 39 years 40 – 44 years 45 – 49 years 50 – 54 years 55 – 59 years Above 60 years Total = 261 χ2 p=0.04 (14) (37) (38) (51) (44) (33) (10) (10) (08) (16) Injured but did not visit medical doctor % of n 57 12 47 55 34 45 70 40 25 37 Injured and visited medical doctor and/or hospital emergency dept. % of n 29 8 21 28 29 30 20 20 25 37 Visited medical doctor and admitted to hospital % of n 7 6 13 6 21 18 10 13 13
Education χ2 p=0.01 No Education (69) Primary (23) Secondary (165) Higher Education (4) Total = 261 No. of family members χ2 p=0.05 2 members (34) 3 members (71) 4 members (72) 5 members (34) 6 members (11) Total = 222
52 30 43 25
13 44 29 50
13 13 13
13 34 31 16 6
11 34 34 16 5
13 38 33 12 4
1934
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
emergency department), 13% had severe injuries (visited medical doctor and admitted to hospital) and 17% had pain and discomfort due to violence. The average cost per incidence for visiting a physician was 265.34 USD (186 ZAR; SD. 251.78; Min. 12, Max. 2000), average cost for medical drug/s was 15.29 USD (108 ZAR; SD. 125.62; Min. 30, Max. 1000) and average transport cost was 6.37 USD (45 ZAR; SD. 67.51; Min. 12, Max. 500). On average, the cost for total medical expenditure per incidence was 28.89 USD (204 ZAR; SD. 354.31). The average loss of income due to victimization of domestic violence incidence was 2091.71 USD (14766 ZAR; SD. 62815.12; Min. 420, Max. 35000). On average, the total cost of domestic violence incidence was 691 USD (4875 ZAR). Women in their thirties were most affected by domestic violence (Mean Age = 35.58, SD = 12.68). However, as far as violence related injuries are concerned, women in their late forties (45 -49 years) had the highest proportions (70%) of minor injuries; women aged 60 years and above had hi-
ghest proportions (37%) of moderate injuries; women in their late 30s (35 – 39 years) have highest proportions (21%) of severe injuries and women in their 50s (50 – 54 years and 55 – 59) have highest proportions (30%and 37% respectively) of pain and discomforts from violence (Table 1). Women with no education suffered the most from violence related minor injuries; women with primary education suffered most from moderate injuries; women with higher education suffered most from violence related pain and discomforts. Average size of families was 3.68 (Mode = 4). Majority (> 64%) of the respondents had three or four members’ in their families. More than 70% of women responded about their family income and almost 58% provided responses about their personal income. Respondents’ monthly average income was 481.64 USD (3400 ZAR) with a minimum of 59.47 USD (420 ZAR) and a maximum of 4958 USD (35000 ZAR). The mode average monthly income was 133.16 USD (940 ZAR) for 25 women). The minimum per capita family income (= total family income/ number
Injured and had pain and discomforts (no visit to medical doctors) % of n 49 27 11 13 44 30 10 16 40 15 30 15 44 28 11 17
Table 2. Victims individual and family income per month and injury victimization
Injured but did not visit medical doctor % of n 41 27 10 22 46 26 3 25 48 22 16 14 50 26 7 17 Injured and visited Visited medical medical doctor doctor and admiand/or hospital tted to hospital emergency dept. % of n % of n 37 26 26 11 40 29 14 17 40 30 13 17 36 29 13 22 45 34 7 14 49 28 10 13 27 28 8 17 50 24 9 17
Variables
Victims income pm p=0.04 Up to 999 (41) 1000 – 2499 (35) 2500 – 4999 (29) 5000 & above (45) n=150 Family income pm p= 0.02 Up to 2999 (36) 3000 – 5999 (54) 6000 – 9999 (47) 10000 & above (50) n= 137 Mode of income p= 0.04 Sole earner (50) Jointly with husbands (104) Husband/others (87) Do not know (20) n=261 Per capita family income p=0.08 Up to 939 (42) 940 – 1749 (45) 1750 – 2665 (42) 2666 & Above (48) n=137
Journal of Society for development in new net environment in B&H
1935
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
of family members) was 33.28 USD (235 ZAR) and the maximum was 2361 USD (16667 ZAR); mean 297.18 USD ( 2098 ZAR). Women with higher family size had proportionally less exposure to violence related injuries, pain and discomforts. The lower was the income, higher was the proportions of injuries (Table 2). The same proportional inverse relation between family income and injury and utilization of medical facilities was observed. Women who were sole providers in the family were affected the most in terms of violence. With regards to medical costs that victims had to pay themselves, the average, was 28.89USD ( 204 ZAR); minimum 2.83 USD ( 20ZAR), maximum 49.58 USD ( 3500ZAR). For medical costs, the victims of domestic violence paid (out of pocket payments) in the following categories: 39%
for physicans, 30% on purchasing medicines, 7% on medical investigations such as x-rays, blood tests, 24% on transport to visit medical facilities. The majority of the victims had spent up to 16.85 USD (119 ZAR). Loss of income due to violence incidence was high enough with an average loss of income of 2049 USD (14466 ZAR); minimum 28.33 USD (200ZAR), maximum 61196 USD (432000ZAR). Among the respondents, 150 women had some monthly income, while 47 (31%) had income loss. Table 3 indicates that 54 – 92% of female victims lost their income of up to 212.34USD (1499 ZAR). Women from higher income groups had spent proportionally more for higher amount of medical costs (Table 4). An obvious trend was observed as women from higher average family income had
Table 3. Relationship between economic losses and injury severities
Variables Total medical costs Up to 61 (37) 62 – 119 (33) 120 – 246 (44) 247 & above (38) Income loss Up to 749 (11) 750 – 1499 (11) 1500 – 7999 (13) 8000 & above (12) p= 0.00 Injured but did not visit medical doctor % of n 27 46 16 11 27 27 9 37 Injured and visited Visited medical Injured and had medical doctor doctor and pain and discomforts and/or hospital admitted to (no visit to medical emergency dept. hospital doctors) % of n % of n % of n 82 6 3 9 46 18 18 18 63 14 0 23 31 61 8 0 24 47 13 16 41 18 41 0
n= 152 p=0.02
n= 47
Table 4. Relationship between economic losses and per capita family income of the victims
Variables n Total medical costs Up to 61 (28) 62 – 119 (25) 120 – 246 (27) 247 & above (27) Income loss Up to 749 (8) 750 – 1499 (6) 1500 – 7999 (9) 8000 & above (5) p= 0.01 Per capita family income: Up to 939 % of n 28 32 18 22 25 37 25 13 Per capita family income: 940 – 1749 % of n 40 28 24 8 0 17 33 50 Per capita family income: 1750 – 2665 % of n 19 15 33 33 11 11 11 67 Per capita family income: 2666 & Above % of n 11 11 22 56 20 0 0 80
n= 107 p= 0.03
n=28
1936
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
highest proportions of income loss due to domestic violence. Almost half of the victims (48%) financed their own medical costs. Only 20% victims had received treatment costs from their husbands (Figure 1).
Figure 1. Financing sources of medical treatments for injuries due to domestic violence Discussion This study tried to estimate the cost burden of domestic violence from a community care centre where victims of violence seek assistance. Average economic cost of each domestic violence incident was 691 USD, while average cost for medical expenditure was 29 USD and average loss of income due to domestic violence was 2092 USD. Women in their 30s were most affected by domestic violence. This could possibly be attributed to the fact that these women are ages when they are reproductively active, and need to negotiate issues around contraceptive use, protected versus unprotected sexual intercourse etc. This, at times could become quite contentious resulting in violence. This finding is in line with other findings from Africa and Asia4, 13, 26, 27, 36, 37. Proportionally, women with no education suffered most from violence-related minor injuries; those with primary education suffered most from moderate injuries; those with higher education suffered most from violence related pain and discomfort. This is in line with previous studies in which higher education was associated with less
violence4, 8, 27, 36. We concur with the reasons offered by those findings i.e. women with higher education might have more choice in partners and might be able to choose to either get married or not, and are probably able to negotiate more control and autonomy within the marriage. Women with higher education might be able to view things in a different light compared to those who were not well-educated. Furthermore, reasons could be: (i) those with higher education are more literate and are able to voice their opinions easily; and/or (ii) those with lower education do not perceive certain acts to be violence against them and hence do not report them as such. Hence, it appears that education has a protective effect not only on violence incidence also on economic losses due to violence. The study also considered the number of family members in the household. It appears that as the number of family members in the household increases, the number of incidences of violence decreases. This could be that too many people or senior members in the household serves as a deterrent to perpetrators of violence. Those who reported lower personal and family income were more likely to report being victims of violence. The main reason here was that lack of finances as well- known contributing factor to violence2, 4, 8, 19, 36, 37. Usually, lack of money leads to frustration, which may translates into violent attacks. In the home, victims of these violent attacks are usually women. The finding is in line with previous findings that violence affects women in poorer families more than it affects their richer counterparts2, 4, 8, 24. Women who are sole earners in the family were at highest risk of being victims of domestic violence. When the husband can not earn or receive economic support from his wife, the situation might hurt his ego which induces violence. This finding is in line with a previous study from India 38. Since Chatsworth is predominantly occupied by people of Indian origin, similar socio-cultural beliefs might be adopted among those families where economic empowerment of women is not willingly warranted. Pain and discomfort were major problem for victims of domestic violence. Proportionally they constitute highest numbers for both medical expenditures and for income loss. However, psychological aspects of domestic violence have multipl1937
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
ying effects on economic fronts. This finding has a long-term policy implication because economic loss for pain and discomfort generated from domestic violence were also financed mostly by the victims themselves or by relatives. This study also indicates that 20% of medical treatments were financed by perpetrators. This study had some limitations. The answers to questions might have been affected by recall bias. The study has also potential social desirability bias, and response bias particularly for the SES measures. Economic elements of domestic violence are not normally distributed as the high values of standard deviations indicated large variation. Also health economic analysis of cost elements support the concept that as health impact varies among human beings, cost elements do not exhibit normal distribution 39. The study did not consider the societal costs such as hospital costs, judicial costs and police costs. The study was conducted in a suburb of Durban. A nationwide study is required in South Africa to estimate the economic costs of domestic violence better. The study used a convenience, help-seeking sample, and was thus not representative of female violence victims. Furthermore, we do not know what percentage of those women approached for participation in the study refused and if any significant differences were apparent between participants and non-participants; an unavoidable problem in absence of registry data. Actual prevalence of violence against women is unknown in the study area or even in South Africa in general. In the absence of registry or household survey the best way to estimate domestic violence and related cost identifying victims from hospital records, police records, and women service centers 3, 4. However, such samples may well not be representative of the female population in South Africa, or even of all abused victims. Given the focus of the research, it is especially important that this was a highly economically marginalized sample who sought help as victim. Surveillance of violence and injuries at health care facilities and community service centers is recommended which is effective for better estimation of incidence and cost41.
Conclusion Considering average monthly income of 482 USD (3400 ZAR), domestic violence against women seems to be very expensive as the average cost per incident was 691 USD (4875 ZAR), thus indicating a deficit in household budget. With the home being the place where most violence against women takes place; it is no more a safe haven for women. Steps need to be taken to revert to the home being a safe haven. It has been evidenced that economic empowerment with higher education of the women are protective factor 2, 8, 40. Therefore policy makers can emphasize on those protective issues. The cumulative effect of abuse and violence was noted in the WHO study in which the recent experience of ill-health was associated with a lifetime of violent experiences 8. This adds to the notion that violence does not have a once time price to be paid, but rather the effects can be felt years down the line. Hence, one act of violence today could lead to various episodes of ill-health in the future. Studies looking at economic costs of violence, like this study, can aid in the promotion of social policy and reduction of violence against women. Findings of studies like these illustrate how violence against women has the potential to adversely affect governments, businesses and families finances. Furthermore, these findings have the potential to encourage policy makers and decision makers to address the issue of violence against women, thereby reducing their own costs as well.
1938
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
References
1. Krug E. World Health Assembly resolutions on violence and injury prevention: new opportunities for national action. Injury Control and Safety Promotion 2004; 11(4): 259-263. 2. WHO. World report on violence and health. Geneva: WHO, 2002. 3. Dalal K, Jansson B. Cost calculation and economic analysis of violence in low-income country: a model for India. African Safety Promotion: A Journal of Injury and Violence Prevention, 2007; 5(1): 45 - 56. 4. Dalal K. Causes and Consequences of Violence Against Child Labor and Women in Developing Countries. Stockholm: Karolinska Institutet, 2008. 5. McCaw B, Golding JM, Farley M, Minkoff JR. Domestic Violence and Abuse, Health Status, and Social Functioning. Women Health 2007; 45(2): 1-23. 6. WHO. The economic dimensions of interpersonal violence. Geneva: WHO, 2004. 7. Conference Report. 1st Safe Community Conference on Cost Calculation and Cost-Effectiveness in Injury Prevention and Safety Promotion. Viborg County: Denmark. 2001. 8. WHO. Summary Report: WHO Multi-country Study on Women’s Health and Domestic Violence against Women. Geneva: WHO, 2005. 9. Yodanis C L. Gender inequality, violence against women, and fear: a cross-national test of the feminist theory of violence against women. Journal of Interpersonal Violence 2004; 19: 655–75. 10. Dobash ER, Dobash RP. Women violence, and social change. London; New York: Routledge, 1992. 11. Stanco Stanko EA. Women, crime, and fear. Annals of the American Academy of Political and Social Sciences 1995; 539: 46-58. 12. Plichta SB. Intimate partner violence and physical health consequences: policy and practice implications. Journal of Interpersonal Violence 2004; 19(11): 1296–323. 13. Campbell J, Jones A, Dienemann J, Kub J, Schollenberger J, O’Campo P, et al. Intimate partner violence and physical health consequences. Archives of Internal Medicine 2002; 162 (10): 1157–63.
14. Koenig MA, Ahmed S, Hossain MB, Khorshed AB. Women's status and domestic violence in rural Bangladesh: individual and community-level effects. Demography 2003; 40: 269-288. 15. Kishor S, Johnson K. Profiling violence: A multicountry study. Measures DHS, ORC Marco; 2004. pp 53-63. 16. Rose L, Campbell J, Kub J. The role of social support and family relationships in women’s responses to battering. Health Care of Women International 2000; 21(1): 27-39. 17. Jejeebhoy S. Association between wife- beating and infant death: Impression from a survey in rural India. Studies in Family Planning 1998; 29(3): 300-308. 18. Seedat S, Stein MB, Forde DR. Association between physical partner violence, posttraumatic stress, childhood trauma, and suicide attempts in a community sample of women. Violence & Victims 2005; 20(1): 87-98. 19. Heise L, Garcia-Moreno C. Violence by intimate partners. In Krug E, Dahlberg LL, Mercy JA, et al., (ed). World report on violence and health. Geneva: WHO. 2002. 20. Silverman JG, Decker M R, Kapur NA, Gupta J, Raj A. Violence against wives, sexual risk and sexually transmitted infection among Bangladeshi men. Sexually Transmitted Infections 2007; 83: 211–215. 21. Waters H, Hyder A, RajkotiaY, Basu S, Butchart A. The costs of interpersonal Violence - an international review. Health Policy 2005; 73: 303–315. 22. Lau U. Intimate Partner Violence. URL http:// www.mrc.ac.za/crime/intimatepartner.pdf (accessed 10th December-2010). 23. HRW. Violence against Women in South Africa: State Response to Domestic Violence and Rape. New York: Human Rights Watch, 1995. 24. Jewkes R., Penn-Kekana, L, Levin J. Risk factors for domestic violence: findings from a South African cross-sectional study. Social Science & Medicine 2002; 55: 1603-1720. 25. Tolan P, Gorman-Smith D, Henry D. Family Violence. Annual Review of Psychology 2006; 57: 557-83.
Journal of Society for development in new net environment in B&H
1939
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
26. Rasool S, Vermaark K, Pharoah R, Louw A, Stavrou A. Violence Against Women: A national Survey. Institute for Security Studies. Pretoria, 2002. 27. Abrahams N, Jewkes R, Martin J, Mathews S., Vetten L, Lombard C. Mortality of women from intimate partner violence in South Africa: a national epidemiological study. Violence & Victims, 2009; 24(4): 546-56. 28. Christofides N, Jewkes R. Acceptability of universal screening for intimate partner violence in voluntary HIV testing and counseling services in South Africa and service implications. AIDS Care 2010; 22(3): 279-85. 29. Fox AM, Jackson SS, Hansen NB, Gasa N, Crewe M, Sikkema KJ. In their own voices: a qualitative study of women's risk for intimate partner violence and HIV in South Africa. Violence Against Women 2007; 13(6): 583-602. 30. Dawad S, Dalal K, Gibbs A. Evaluation of Chatsworth Community Care Centre. Final Report. Durban: .HEARD, University of KwaZulu-Natal. 2009. 31. Davoudi-Kiakalayeh A, Dalal K, YousefzadeChabok S, Mohammadi R, Jansson B. Costs related to drowning and near drowning in northern Iran (Guilan province), Ocean & Coastal Management 2011; 54(3), 250-255. 32. Duvvury N, Grown C, Redner J. Costs of intimate partner violence at the household and community level. An operational framework for developing countries. http://www.icrw.org/docs/2004_paper_costingviolence.pdf (accessed 25th February 2011) 33. Graves N, Walker D, Raine R, Hutchings A, Roberts JA. Cost data for individual patients included in clinical studies: no amount of statistical analysis can compensate for inadequate costing methods. Health Economics 2002; 11(8):735-9. 34. Frick KD. Micro-Costing Quantity Data Collection Methods. Medical Care 2009; 47(7): S76–S81. 35. WHO. Putting Women First: Ethical and Safety Recommendations for Research on domestic Violence against Women.Geneva: WHO, 2005. 36. Dalal K, Rahman F, Jansson B. Wife abuse in rural Bangladesh. Journal of Biosocial Science 2009; 41(5): 561–573.
37. Jewkes, R., Penn-Kekana, L., Levin, J., Ratsaka, M. & Schreiber, M. (2001). Prevalence of emotional, physical, and sexual abuse of women in three South African provinces. South African Medical Journal, 91, 421-428. 38. Dalal K, Lindqvist K. A national study of the prevalence and correlates of domestic violence among women in India. Asia Pacific Journal of Public Health 2010 (e-pub ahead). 39. Folland S, Goodman A, Stano M. Economics of Health and Health Care. Prentice Hall, NY. 2010. 40. Dalal K. Does economic empowerment protect women from intimate partner violence? Journal of Injury and Violence Research 2011; 3(1): 35-44. 41. Wang S, Zou J, Yin M, Yuan D, Dalal K. Injury Epidemiology in a Safe Community Health Service Center in Shanghai, China. HealthMed 2011; 5(3): 479 -485. Corresponding author Koustuv Dalal, Department of Public Health Science, School of Life Sciences, University of Skovde, Sweden, E-mail: koustuv2010@hotmail.com
.
1940
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Hepatitis B Prevention for the Nurses- A Review Article
Mitra Zandi1, Seyed-Moayed Alavian2, Kamran Bagheri-Lankarani3
1 2 3
Tarbiat Modares University, Tehran, Iran, Baqiyatallah University of Medical Sciences, Baqiyatallah Research Center for Gastroenterology & Liver Disease (BRCGL), Tehran, Iran, Gastroenterohepathology Research Center, Nemazee Hospital, Health Policy Research Center, Shiraz University of Medical Sciences, Shiraz, Iran.
Abstract Hepatitis B virus infection is a serious health problem worldwide. This risk of acquisition of infection appears to be great in health care workers, especially in nurses and particularly during training, when exposure is maximal. Nurses have an important role in disease control. It is recommended that greater awareness is needed in society about the ways of transmission of hepatitis B infection and preventive measures should be improved. An increase in awareness of the population of the risks of HBV infection and of potential preventive measures will definitely improve the control of HBV infection nationwide and will eventually decrease the associated health care costs. Searches were applied to the following electronic databases: The Cochrane Hepato-Biliary Group Controlled Trials Register, Blackwell, MEDLINE, PUBMED and ELSEVIOR. Five Iranian journals and conference proceedings were hand searched. You also needed to explain the methods you used for your literature review, including data bases searched, criteria or keywords for searches, number of articles chosen and so forth. Key words: Hepatitis B; Needle stick; Nurse; Occupational Exposure; Prevention. Introduction Hepatitis B, a viral infection of the liver, is a major global public health problem. It is estimated that about 30% of the world’s population, i.e. about 2 billion people, have serological eviden-
ce of infection with hepatitis B virus (HBV) and approximately 350 million of them are chronically infected with HBV. These chronically infected persons are at high risk of death from cirrhosis of the liver and liver cancer, diseases which kill almost a million persons annually worldwide (1, 2). The prevalence of HBV infection varies widely, with rates ranging from 0.1% to 20% in different parts of the world. HBV is 10th leading cause of death worldwide (3-7). The regions of the world can be classified into areas of high, intermediate and low HBV endemicity. Prevalence of HBsAg in developed countries is around 0.1% to 0.5%. In endemic areas it may rise to 3% to 5%, and in hyperendemic areas up to 30% (8, 9). Most countries in the Middle East region are still in intermediate to high endemicity for HBV infection (10). Iran has intermediate endemicity for HBV (11, 12). Hepatitis B virus (HBV) prevalence has decreased dramatically in Iranian population during the last decade, and now it is classified as having intermediate to low endemicity for hepatitis B infection (11, 13). Evaluation of risk factors in HBV infected people is important for designing the strategies for disease control. Campaigns to increase the people’s awareness will decrease the incidence rate of new infections (1). Hepatitis B is preventable with safe and effective vaccine which has available for decade. Introduction of vaccine in infants and high risk groups have decreased the incidence rate of diseases in the world (11). The number of acute cases of hepatitis B, deaths related to cirrhosis and hepatocellular carcinoma due to hepatitis B had decreased (14, 15). Despite the availability of an effective vaccine, hepatitis B still continues to be problematic worldwide. 1941
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The majority of the infections are subclinical and undiagnosed. The nurses and other healthcare providers frequently encounter cases with chronic HBV infection. There is no doubt that every nurse should be alert about this infection and the protocohol of prevention. The disease is preventable, if we recognize and follow the standard of health in our activities. All patients in hospitals should be regarded as potential HBV carriers. This article summarizes the risk factors, prevention and self-care protection, post exposure prophylaxis, and follow-up in needle-stick personals. Risk Factors This virus is transmitted by percutaneous or permucosal exposure to infectious body fluids, sexual contact with an infected person, and perinatally from an infected mother to her infant (16-23). It is claimed that horizontal transmission usually occurs via inapparent percutaneous routes, through cuts and lesions (24, 25). The health care workers (HCW) have long been recognized to be at risk for hepatitis infection through occupational exposure (OE) to blood and blood contaminated objects (26-32). The annual incidence of occupational exposure to blood and blood fluids is reported to be 3.5/100 HCWs (33). They risk getting infected with various infectious agents at a greater rate than the general population, and transmission of hepatitis B virus (HBV) from infected health care workers (HCW) to patients has repeatedly been reported in the past 30 years (34). This risk appears to be greatest during the beginning years of a HCW’s career, particularly during training, when exposure is maximal, and experience/ awareness of infection risk minimal (35). For these reasons, the Advisory Committee on Immunization Practices (ACIP), as well as multiple professional societies, has recommended hepatitis B immunization for all HCWs, with a particular emphasis on immunizing students training in HCW professions. Occupational exposure in health-related work with direct blood exposure accounts for the third largest group of infections after injecting drug use and sexual transmission. Occupational infection fo1942
llowing accidental blood exposure (ABE) has been described for over 60 pathogens. The occupational risk due to ABE depends on various factors: the prevalence of pathogens and viral loads among patients (For example, the risk of acquiring HBV or HCV from a contaminated needle stick is greater than for HIV); the frequency of ABE; the severity of ABE; and the availability of post exposure prophylaxis (36). The incidence of seroconversion following an OE is approximately 2% to 40% for HBV, 2.7% to 10% for HCV and 0.3% for HIV (27-30). Type of job, years of experience and specific hospital wards were the risk factors for exposure. In Hadadi study nurses had the highest rate of exposure (26%), and there was a significant difference between nursing and other job categories. HCWs with a job experience of more than ten years had 0.5 times the odds of exposure compared to those with less than five years job experience (37). Also Clarke shows that Nurses with less than 5 years of experience, peri-operative nurses, and those performing routine venipuncture for blood draws were more likely to be injured (38). Nursing students are in high risk of experienced exposure to blood borne pathogens. Drexler, Schmid, and Schwager reported that one half of all medical students and nursing students have experienced an exposure to blood or body fluids during the final two years of study (39). McCarthy and Britton reported that 27% of the nursing students they studied experienced exposure to blood borne pathogens through needle sticks. They suggested that a high risk for non-sterile occupational injuries existed because these students were doing invasive procedures with minimal experience. Knowledge deficit regarding reporting practices seemed to be a major reason that students do not report an injury (40). Nurses working in hospitals with the most favourable working environments were one-third less likely to be injured (38). The HIV patients are at higher risk for HBV infection and the nurses should be aware in contact with them in the hospitals (41). Hemodialysis departments are important places for nosocomial transmission risks (28, 42-47). Also HCWs in settings outside the hospital are at risk for needle stick injuries and AEB and that they and their employers have not fully realized the importance for being vaccinated against hepatitis B (26).
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Unfortunately, HCWs have not paid adequate attention to the prevention of infections especially among nursing assistants, was not vaccinated for hepatitis B (26) (26, 48). Most reported needle stick injuries involved nursing staff (45%), followed by attendants (33%), doctors (11%) and technicians (11%) (27). The importance of nursing professionals is based on two elements: 1) many nurses are at high occupational risk of exposure to hepatitis B and C viruses (because of their greater number, more extensive contact with patients, and greater risk of needle-stick injuries); and 2) nurses provide an important leverage point for educating others because they are in constant contact with patients. Nurses’ ability to conduct a comprehensive and accurate risk history with patients is a critical step in controlling the epidemic due to the lack of specific symptoms among infected individuals (49). Accidental needle-stick injury is the most common route of transmission for acute care nurses (and others with direct patient contact) (50). The Center for Disease Control (CDC) estimates that about 600,000 to one million needle-stick injuries occur each year in the world. Unfortunately, about half of these needle-stick injuries go unreported (27). The American Nurses Association (ANA) estimates that of the numerous needle-stick injuries only about 1,000 healthcare workers actually contract an infection. Although the risk of contracting these blood-borne pathogens is low the psychological trauma that follows the injury can be considerable (27). Over one-third (34.5%) of nurses reported at least one needle-stick injury from 1993 to 1997 (50). The risk factors involved in needle-stick injuries have been extensively studied. Many of the needlestick injuries occur during needle recapping (51). Vos et al shows that incorrect procedures while disposing of a used needle (26%) and recapping (15%) were the most frequent circumstances under which needle stick injuries happened (26). Another study focused on working conditions, short staffing, and the influence on increases in accidental injuries (51). Perry and Jagger and reported that critical care areas have a high risk of having needle-stick injuries, and suggested that this is related to the pressure involved in crisis situations and the fast response that is needed from staff (52).
Blood splashes into the eye and other orifices account for another potential route of transmission. Splashes had occurred among 58 (40.8%) nurses responding to the Detroit study (49). The outcome of HBV infection mainly depends on the immune response of the host but is also influenced by the capability of the virus to escape defence mechanisms by integration into the genome of the host’s hepatocytes. These factors affect whether HBV infection leads to acute hepatitis or remains asymptomatic, whether the infection resolves to immunity or becomes chronic and whether chronic clinical sequelae such as chronic hepatitis, liver cirrhosis or hepatocellular carcinoma develop (53). It should be reinforced that despite no known history of disease, patients may still be infected with a blood borne pathogen. The prevention of ABE in HCWs and their safety must therefore be considered as a public health issue. The safety of HCWs will help to warrant the continued delivery of quality health care for all patients as they progressively, albeit slowly, benefit from improved therapeutic and diagnostic means in these resource-scarce settings (36). Reused syringes have been identified as a major risk factor for hepatitis B in some in developing country (54, 55). Interventions to limit injections to those who are safe and clinically indicated are needed to prevent injection-associated infections (56). The use of glass syringes in administering therapeutic injections was common in the past, and is still in practice in most of the low socioeconomic settings in developing countries. The nurses can help to change these malpractices (55). Prevention & Self Protection from HBV Prevention and control of viral hepatitis depends on overcoming unique communication challenges. Most infected individuals have no symptoms or awareness of their infection status. Misinformation about the adverse effects of the vaccine is widespread. Viral hepatitis awareness is typically low. Medical providers express confusion about vaccine effectiveness, the meaning of antibody tests, and the vaccine schedule for patients (57). Many providers fail to provide viral hepatitis counselling, even to patients at risk (58). 1943
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
However, given the high seropositivity rates of HBV infection, education about blood borne infections and vaccination of high-risk groups/ infants will not be adequate alone to control the HBV infection. Nor it is practical to advocate universal HBV screening or vaccination of all susceptible people. However, patients admitted to hospitals for any reason could be tested for HBV and if they are found to be positive, examinations could be extended to their family members. Screening of pregnant women for HBV infection should be routinely conducted during prenatal care in hospitals (24). It is recommended that greater awareness is needed in society about the ways of transmission of hepatitis B infection and preventive measures should be improved (24). Unfortunately no systematic and organized educational program is now existed for these chronic patients. Zandi et al. evaluated the effects of an educational program on cirrhotic patients about the ways of transmission, complications and the ways of control of complications in these patients. The results of this study confirmed the beneficial effects of educational programs especially on the health related quality of life (59). Planning short and simple educational programs has a significant effect on the patient's control on his/her disease and its' side effects; and can improve quality of life, life satisfaction feeling, and coping with treatment in patients with viral hepatitis (59). The risks of horizontal transmission of hepatitis B should be emphasized in the health education programmes in countries of the Eastern Mediterranean Region. An increase in awareness of the population of the risks of HBV infection and of potential preventive measures will definitely improve the control of HBV infection nationwide and will eventually decrease the associated health care costs (24). All nurses should be familiar with the prevention and management of blood and body fluids exposures, both for their own protection and their patients (29). Transmission of these potentially infectious blood-borne pathogens can be minimized by adopting effective precautionary measures. This requires constant education of HCWs at all levels (27). Especially nursing students should be reassured that a needle stick injury would not result in punitive action, and that any sharp injury received should be reported to the appropriate personnel so 1944
that necessary post-exposure prophylaxis may be provided (57). Educational talks must be given to health care workers on hazards, prevention, and post-exposure prophylaxis to needles tick injuries, vaccination efficacy, obligated number of vaccination times, usefulness of checking anti-HBs, and wearing double gloves. Active monitoring, repeated educational programs with different methods, and facilitating the HCWs in reporting their needle sticks, vaccination, and checking the situation of their antigens/antibodies is necessary (60). A written exposure control plan should be developed and effective HCW training should be performed. These issues help HCWs adopt standard precautions in hospitals. Several investigators have attempted to assess the efficacy of standard precautions (28). Unfortunately, in many places, HCWs may not use the preventive equipment provided by their workplace (28). A number of Internet resources have recently been released to improve medical providers’ access to current data on transmission, prophylaxis and serologic testing (e.g. the CDC website, http://www.cdc.gov/hepatitis; the University of California, San Francisco website, http://www. epicenter.ucsf.edu; and HEPEXPERT-III, http:// www.swun.com/hepax) (29, 49). Repeated studies have demonstrated that single interventions alone are not enough to produce significant, sustained changes in health knowledge, attitudes and practices for any health topic or audience (29, 49). The nurse participants in Keller study expressed a strong opinion about having a multilateral approach to any hepatitis education that involves 1) nurse education, 2) nurse empowerment, and 3) healthcare administrator education (29, 49). Health care workers can reduce exposure to blood-borne pathogens through the use of barrier measures such as gloves, gowns, masks, and goggles. The CDC has issued guidelines for universal precautions to be used when caring for patients. The use of protective equipment to prevent blood and body fluid exposures is mandated for health care workers by the Occupational Safety and Health Administration (OSHA). Despite regulations and educational programs promoting use of universal precautions, it has been shown repeatedly that compliance with universal precautions is low in many hospital settings (29). Use of safer devices
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
should be considered as one of the main approaches, together with educational and immunization programmes for needle stick injuries, in order to reduce the occupational risk of infection (27, 29) Use of safety equipment is required by the CDC, as are universal precautions for nurses to protect themselves from blood borne infections (49). The hospital should have a functioning built-in infrastructure to report and administer post-exposure prophylaxis (PEP) to workers at any time (27). In addition, a comprehensive needle stick prevention program might include the following: - Creating a multidisciplinary team to investigate and assess needle stick incidents. - Defining prevention priorities on the basis of collection and analysis of an institution’s injury data. - Developing design and performance criteria for product selection according to needs for patient care and health care worker safety. - Planning and implementing an evaluation of products in clinical settings (61). Exposed HCWs must have knowledge about the process of evaluating occupational exposures and their ability to determine the need for PEP and wound care. Rapid evaluation has allowed us to avoid unnecessary initiation of PEP, which enables HCWs to avoid treatment that is expensive and associated with potential side effects. It is also important to note that follow-up care is an essential component of dealing with an occupational exposure. For reasons of continuity, cost containment, emotional support, and record keeping, follow-up care and serial testing is best done through the exposed HCW’s employee health provider. The current recommendations from the Center for Disease Control and Prevention (CDC) state that PEP is ideally provided within hours of an exposure (30). Definition of post-exposure prophylaxis (PEP) Post-exposure management includes first aid, serological testing and counselling in all cases (27). Because PEP is more likely to be effective when started early, exposed persons should be encouraged to present for evaluation and treatment
immediately after exposure, and triage should be expedited (Table1) (29). After a suspicious contact to eyes, HCWs should wash eyes with clean water or saline. The incident should also be reported to a supervisor immediately (28). Table 1. Outline for management of exposures to blood or body fluids (Moran, 2000)
• Expedite triage • Irrigate exposed areas. • Obtain history regarding exposure circumstances, source patient, and vaccination history of exposed. • Obtain blood samples for laboratory studies (using consents when required) from exposed person. Obtain urine pregnancy test for women of childbearing potential. • Order laboratory studies from source patient, if known. • Determine need for tetanus immunization. • Determine need for hepatitis B PEP. • Determine need for HIV PEP. • Counsel exposed person regarding risk of specific blood-borne pathogens and discuss risks/benefits of available treatment options. • Review dosing and side effects of recommended treatments. • Arrange follow-up through employee health clinic or other resource.
Exposed areas or wounds should be immediately irrigated copiously with sterile saline solution or water (28, 29) Mucous membranes should be flushed with water (28). If a wound or puncture is present, then wound management should proceed as usual. There is no evidence that the use of antiseptics for wound care or expressing fluid by squeezing the wound further reduces the risk for transmission of HIV or other viruses. The application of caustic agents (eg. bleach) or the injection of antiseptics or disinfectants into the wound is not recommended (29). The key elements in an assessment of a potential blood and body fluid exposure include circumstances of the exposure, medical history of the person who was the source of the blood or body fluid, and medical history of the exposed person. To reduce future exposures, infection control personnel may find it helpful to collect detailed information on the circumstances of the exposure, including the specific devices used and the manner of use. 1945
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Although collection of information on the source regarding risk factors for blood-borne pathogens can be helpful when making decisions regarding PEP, the limitations of this information must be recognized (29). It is helpful to develop a packet for management of blood and body fluid exposures, including standardized data collection sheets, standard orders for testing the source and exposed, written information for the exposed person, and guidelines for PEP (29). Serologic testing of the source patient is the most reliable means of assessing the risk of transmitting blood-borne infections. If known, the source patient should be tested for hepatitis B surface antigen (HBsAg), antibody to hepatitis C (antiHCV), and antibody to HIV (29). Frequently, the source of the exposure is not known (eg, housekeeping personnel stuck by a needle found in the trash). In such situations, an assessment of the likelihood of the presence of a blood-borne pathogen must be made based on the epidemiology of these pathogens in the treatment setting. Risk is obviously greater in a drug dependency unit or dialysis unit than in a general pediatric ward. Unfortunately, the best that can be hoped for in these situations is a reasonable guess. Generally, the risk of transmitting a blood-borne pathogen is higher from a needle or device with visible blood than from a needle used only for injection or an object with only dried material (29). Persons who believe they may have been exposed to blood-borne viruses are often anxious and upset after the exposure. Fear of contracting HIV usually causes the greatest anxiety after accidental exposures (even though many more health care workers have died of occupational HBV infection than of HIV). It is important to address the psychological effects of such an exposure during evaluation and treatment. Anxiety can usually be reduced with a thorough and realistic explanation of the low risk of transmission by such exposures. Exposed persons should be provided with written information on blood-borne pathogens, including HBV, HBC, and HIV. Exposed persons must also have information on the risks and benefits of available PEP treatments to participate in an informed decision regarding their treatment. Inclusion of these written materials in a packet to be used 1946
for blood and body fluid exposures can be helpful (29). Hospital management should establish policies and procedures for testing HCWs for HBV after percutaneous or mucosal exposures to blood, and ensure that all personnel are familiar with those policies and procedures. HCWs should observe the protective precautions of their workplace (28). Hepatitis B post-exposure prophylaxis (PEP) HBsAg can be found in the blood as early as 1 to 2 weeks after infection, and symptomatic hepatitis (if it occurs) begins approximately 4 weeks after the appearance of HBsAg. As HBsAg disappears after several weeks, antibody to HBsAg appears (anti-HBsAg) and typically persists for life. In some patients, there is a “window period” up to several weeks between the disappearance of HBsAg and the appearance of anti-HBsAg in which the only serologic evidence of infection is the presence of antibody to the core antigen (anti-HBc). Most HBV infections are subclinical and are detected only by serologic or other testing. If HBsAg is not detected in blood from the source, then transmission of hepatitis B is extremely unlikely. The risk of hepatitis B from other body fluids appears to be much less than from blood (29). The first vaccine to protect against the hepatitis B virus (HBV) was licensed in the United States in 1981. In their initial recommendations, the CDC indicated that HCWs who were most at risk for occupational exposure to blood-borne pathogens (e.g., laboratory workers, emergency workers, and intensive care and operating room personnel) should be offered the vaccine (62). All health care workers who are not known to be immune to hepatitis B should receive a vaccine series. The series is given in 3 doses as 1 ml in the deltoid muscle at 0, 1, and 6 months (Moran, 2000). Also, considering the fact that in some subjects’ vaccination may not provide immunity, it seems useful to encourage HCWs who have already received HBV vaccinations to check their immunity status (Moran, 2000). They should have antibody titers tested 1 to 2 months after completing the hepatitis B vaccine series. A titer of 10 mIU/mL or higher is protective. Primary immunization is very effective; more than 90% of properly vaccinated
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
individuals develop an adequate titer, but some do not. Approximately 25% of individuals in whom the vaccine fails have a response after subsequent revaccination. Risk factors for failure to respond to vaccine include obesity, immunospuression, age older than 50 years, and smoking. Those who do not respond to the initial series should be given a second series of 3 doses or be evaluated to determine whether they are HBsAg-positive (27, 29) Those who do not respond to vaccination should be counselled that they are susceptible to hepatitis B, and should receive hepatitis B immune globulin (HBIG) for protection after hepatitis B exposure. Antibody (anti-HBs) levels will decrease with time after vaccination, and it appears that persons with higher initial antibody levels have longer persistence of detectable antibody. Almost all persons with low antibody levels after a prior documented protective titer have a rapid increase after a booster dose of vaccine, indicating that an anamnestic response is present. Regular booster doses of hepatitis B vaccine are not recommended, nor are subsequent periodic testing for antibody levels (29). Decisions regarding PEP for hepatitis B are based on the HBV infection status of the source, as well as the vaccination status of the exposed. PEP with HBIG (passive immunization), vaccine (active immunization), or both measures should be used when indicated (30). PEP for HCWs who are anti-HBs negative and who have sustained injuries from an HBV-positive patient includes hepatitis vaccination and a full course of immunization with hepatitis B immunoglobulin (HBIG), preferably within 24 h. The option of giving one dose of HBIG (0.06 mg/kg of body weight) and re-initiating the vaccination series is preferred for non-responders who have not completed a three-dose vaccination series. For people who completed a second vaccination series but failed to respond, two doses of HBIG are preferred. People who have been infected with HBV previously are considered to be immune to re-infection and are not given PEP (27). If serologic results from the source patient will be available within approximately 48 to 72 hours, then treatment can be deferred until results are known. HBIG is given to provide protection to non-immune persons until vaccine-induced antibody appears. It is the only protection available for exposed per-
sons who did not respond to previous vaccination (30). These persons should receive a second dose of HBIG 1 month after the initial dose (27, 30) HBIG is prepared from pooled plasma containing high titers of anti-HBsAg and is processed to destroy infectious viruses. When given as a single intramuscular dose, HBIG has a mean biologic half-life of 22 days (range, 5.9 to 35 days). HBIG treatment should be started as soon as possible after exposure; the efficacy declines if treatment is postponed for 3 or more days after exposure. The effectiveness of HBIG when given more than 7 days after percutaneous or permucosal exposures is unknown. HBIG and vaccine can be given simultaneously, but should be given at separate injection sites. Because of recognition that the protective effects of hepatitis B vaccine appear to persist despite declining antibody levels, recommendations regarding post-exposure antibody testing have recently been revised. Prior recommendations were that persons exposed who had not had an antibody level checked within 24 months should be retested, and those with a titer less than or equal to 10 mIU/mL should receive a booster dose of vaccine even if they had a prior documented protective antibody level. The CDC now recommends that those persons who have ever had an adequate antibody response documented do not need to be retested or receive a booster vaccine after exposure (29, 30) For occupational exposures, the treatment of non-immune pregnant health care workers is no different from that for non-pregnant health care workers, ie, administration of immune globulin and vaccination series. If clinical HBV infection develops in the mother, hepatitis in the mother is not expected to be any more severe than usual. At birth, the newborn should receive HBV immunoglobulin and the HBV immunization series. Breast-feeding is not contraindicated (63). Occupational health services for health care workers may wish to maintain records of employee hepatitis B immunity to reduce unnecessary testing after exposures. Health care workers who are immune-suppressed should be retested after exposure. Although CDC recommendations do not address post-exposure treatment of immune-suppressed health care workers, it would be reasonable to provide a vaccine booster and HBIG to those with inadequate antibody levels (29). 1947
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Follow-up recommendations It is also important to note that follow-up care is an essential component of dealing with an occupational exposure (28). Health care workers who are not known to be immune at the time of exposure should have follow-up within 48 to 72 hours. At that time, results of serologic studies from the exposed and the source can be used to determine the need for further treatment (Moran, 2000) (30). If the source is found to be HBsAg-positive and the exposed individual is anti-HBsAg–negative, then HBIG can be given (if not already given at the initial visit) and completion of the vaccine series can be scheduled. Health care workers who are vaccinated after exposure should be tested for anti-HBsAg 1 to 2 months after completing the series. Exposed health care workers who are given appropriate prophylaxis are very unlikely to become infected with HBV. No special precautions should be necessary with household contacts, sexual contacts, or with patient care (Moran, 2000). For reasons of continuity, cost containment, emotional support, and record keeping, follow-up care and serial testing is best done through the exposed HCW’s employee health provider (30). Exposed health care workers should be advised to seek medical evaluation for any acute illness that occurs during the follow-up period, particularly if characterized by symptoms suggestive of acute retroviral infection such as fever, rash, myalgia, fatigue, malaise, or lymphadenopathy (29). It is recommended that greater awareness is needed in society about the ways of transmission of hepatitis B infection and preventive measures should be improved. The risks of horizontal transmission of hepatitis B should be emphasized in the health education programmes in Iran and countries of the Eastern Mediterranean Region. An increase in awareness of the population of the risks of HBV infection and of potential preventive measures will definitely improve the control of HBV infection nationwide and will eventually decrease the associated health care costs.
References
1. Alavian SM. Ministry of Health in Iran Is Serious about Controlling Hepatitis B. Hepat Mon. 2007;7(1):3-5. 2. Uyar Y, Cabar C, Balci A. Seroprevalence of Hepatitis B Virus among Pregnant Women in Northern Turkey. Hepat Mon. 2009;9(2):146-9. 3. Lavanchy D. Hepatitis B virus epidemiology, disease burden, treatment, and current and emerging prevention and control measures. J Viral Hepat. 2004;11:97-107. 4. Azarkar Z, Sharifzadeh G. Evaluation of the Prevalence of Hepatitis B, Hepatitis C, and HIV in Inmates with Drug-Related Convictions in Birjand, Iran in 2008. Hepat Mon. 2010;10(1):26-30. 5. Ataei B, Tayeri K, Kassaeian N, Farajzadegan Z, Babak A. Hepatitis B and C among Patients Infected with Human Immunodeficiency Virus in Isfahan, Iran: Seroprevalence and Associated Factors. Hepat Mon. 2010;10(3):188-92. 6. Nokhodian Z, Kassaian N, Ataei B, Javadi AA, Shoaei P, Farajzadegan Z, et al. Hepatitis B Markers in Isfahan, Central Iran: A Population-Based Study. Hepat Mon. 2009;9(1):12-6. 7. Hajiani E, Hashemi S, Masjedizadeh A. Seroepidemiology of Hepatitis B Virus Infection in Khuzestan Province, Southwest of Iran. Hepat Mon. 2009;9(1):34-8. 8. Merican I, Guan R, Amarapuka D, Alexander MJ, Chutaputti A, Chien RN, et al. Chronic hepatitis B virus infection in Asian countries. J Gastroenterol Hepatol. 2000 Dec;15(12):1356-61. 9. Jeremiah ZA, Tony-Enwin EO. Seroepidemiology of Transfusion Transmissible Viral Infection among University Fresh Students in Port Harcourt, Nigeria. Hepat Mon. 2009;9(4):176-281. 10. Andre F. Hepatitis B epidemiology in Asia, the Middle East and Africa. Vaccine. 2000;18:S20-2. 11. Alavian S, M, Fallahian F, Bagheri-Lankarani K. The Changing Epidemiology of Viral Hepatitis B in Iran. J Gastrointestin Liver Dis. 2007;16(4):4036. 12. Alavian SM, Hajariazdeh B, Ahmadzad Asl M, Kabir A, Bagheri Lankarani K. Hepatitis B Virus Infection in Iran: A Systematic Review. Hepat Mon. 2008;8(4):281-94. 13. Hashemi SA, Moghadami M, Lankarani KB, Alborzi A, Mahboudi A. The Efficacy of Hepatitis B Vaccination among School Age Children in Southern Iran. Iran Red Cres Med J. 2010;12(1):45-8. 14. Hsu HM, Lu CF, Lee SC, Lin SR, Chen DS. Seroepidemiologic survey for hepatitis B virus infection
1948
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
15.
16.
17.
18.
19.
20. 21.
22. 23.
24.
25.
26.
in Taiwan: the effect of hepatitis B mass immunization. J Infect Dis. 1999 Feb;179(2):367-70. Zampino R, Lobello S, Chiaramonte M, VenturiPasini C, Dumpis U, Thursz M, et al. Intra-familial transmission of hepatitis B virus in Italy: phylogenetic sequence analysis and amino-acid variation of the core gene. J Hepatol. 2002 Feb;36(2):24853. Ghanaat J, Sadeghian A, Ghazvini K, Nassiri MR. Prevalence and risk factors for hepatitis B virus infections among STD patients in northeast region of Iran. Medical Science Monitor. 2003;9(2). Alavian S, M,, Mostajabi P, Malekzadeh R, Azimi K, Vosough H, Sarrafi M, et al. Evaluation of Hepatitis B Transmission Risk Factors in Tehran Blood Donors [in persian]. Govaresh. 2004;3(9):169-75. Alavian SM, Mostajabi P, Malekzadeh R, Azimi K, Vosough H, Sarrafi M, et al. Evaluation of Hepatitis B Transmission Risk Factors in Tehran Blood Donors [In Persian]. Govaresh. 2004;3(9):169-75. Jahani MR, Alavian SM, Shirzad H, Kabir A, Hajarizadeh B. Distribution and risk factors of hepatitis B, hepatitis C, and HIV infection in a female population with "illegal social behaviour". Sex Transm Infect. 2005 Apr;81(2):185. Sali SH, Bashtar R, Alavian SM. Risk Factors in Chronic Hepatitis B Infection: A Case-control Study. Hepat Mon. 2005;5(4):109-15. Vahid T, Alavian SM, Kabir A, Kafaee J, Yektaparast B. Hepatitis B Prevalence and Risk Factors in Blood Donors in Ghazvin, IR.Iran. Hepat Mon. 2005;5:117-22. Salkic NN. Intrafamilial Transmission of Hepatitis B: Experience and Lessons Learned in Bosnia and Herzegovina. Hepat Mon. 2009;9(3):169-70. Saleh-Gargari S, Hantoushzadeh S, Zendehdel N, Jamal A, Aghdam H. The Association of Maternal HBsAg Carrier Status and Perinatal Outcome. Hepat Mon. 2009;9(3):180-4. Guven R, Ozcebe H, Cakir B. Hepatitis B prevalence among workers in Turkey at low risk for hepatitis B exposure. East Mediterr Health J. 2006 Nov;12(6):749-57. Mahboobi N, Agha-Hosseini F, Safari S, Lavanchy D, Alavian SM. Hepatitis B virus infection in dentistry: a forgotten topic. J Viral Hepat. 2010 May 1;17(5):307-16. Vos D, Gotz HM, Richardus JH. Needlestick injury and accidental exposure to blood: the need for improving the hepatitis B vaccination grade among health care workers outside the hospital. Am J Infect Control. 2006 Nov;34(9):610-2.
27. Mehta A, Rodrigues C, Ghag S, Bavi P, Shenai S, Dastur F. Needlestick injuries in a tertiary care centre in Mumbai, India. J Hosp Infect. 2005 Aug;60(4):368-73. 28. Hosoglu S, Celen MK, Akalin S, Geyik MF, Soyoral Y, Kara IH. Transmission of hepatitis C by blood splash into conjunctiva in a nurse. Am J Infect Control. 2003 Dec;31(8):502-4. 29. Moran GJ. Emergency department management of blood and body fluid exposures. Ann Emerg Med. 2000 Jan;35(1):47-62. 30. Kallenborn JC, Coleman RD, Carrico R, Smith AM, Ferriell K. Occupational exposure: organizing ED care to determine rapid postexposure prophylaxis within hours instead of days. J Emerg Nurs. 1999 Dec;25(6):505-8. 31. Alavian SM, Gholami B, Masarrat S. Hepatitis C risk factors in Iranian volunteer blood donors: A case-control study. J Gastroenterol Hepatol. 2002;17(10):1092-7. 32. Khedmat H, Fallahian F, Abolghasemi H, Alavian SM, Hajibeigi B, Miri SM, et al. Seroepidemiologic Study of Hepatitis B Virus, Hepatitis C Virus, Human Immunodeficiency Virus and Syphilis Infections in Iranian Blood Donors. Pak J BioI Sci. 2007;10(24):4461-6. 33. Needlestick injuries: nurses at risk. . Mich Nurse. 2000;73:8-9. 34. Buster EH, van der Eijk AA, Schalm SW. Doctor to patient transmission of hepatitis B virus: implications of HBV DNA levels and potential new solutions. Antiviral research. 2003 Oct;60(2):79-85. 35. Mast EE, Alter MJ, Margolis HS. Strategies to prevent and control hepatitis B and C virus infections: a global perspective. Vaccine. 1999 Mar 26;17(13-14):1730-3. 36. Tarantola A, Koumare A, Rachline A, Sow PS, Diallo MB, Doumbia S, et al. A descriptive, retrospective study of 567 accidental blood exposures in healthcare workers in three West African countries. J Hosp Infect. 2005 Jul;60(3):276-82. 37. Hadadi A, Afhami S, Karbakhsh M, Esmailpour N. Occupational exposure to body fluids among healthcare workers: a report from Iran. . Singapore Med J. 2008;49(6):492 -6. 38. Clarke SP. Hospital work environments, nurse characteristics, and sharps injuries. Am J Infect Control. 2007 Jun;35(5):302-9. 39. Schmid K, Schwager C, Drexler H. Needlestick injuries and other occupational exposures to body fluids amongst employees and medical students of a German university: incidence and follow-up. J Hosp Infect. 2007 Feb;65(2):124-30.
Journal of Society for development in new net environment in B&H
1949
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
40. McCarthy GM, Britton JE. A Survey of Final-Year Dental, Medical and Nursing Students: Occupational Injuries and Infection Control. J Can Dent Assoc. 2000 Nov;66(10):561. 41. Davarpanah MA, Darvishi M, Mehrabani D. The Prevalence of HBS antigenemia in patients with HIV infection, Shiraz, Southern Iran. Iran Red Cres Med J. 2007;9(4):224-5. 42. Alavian SM, Bagheri-Lankarani K, MahdaviMazdeh M, Nourozi S. Hepatitis B and C in dialysis units in Iran: Changing the epidemiology. Hemodial Int. 2008 Jul;12(3):378-82. 43. Alavian SM. Hepatitis C, Chronic Renal Failure, Control Is Possible! Hepat Mon. 2006;6(2):51552. 44. Alavian SM. A shield against a monster: Hepatitis C in hemodialysis patients. World J Gastroenterol. 2009;15(6):641-6. 45. Mahdavimazdeh M, Hosseini-Moghaddam SM, Alavian SM, Yahyazadeh H. Hepatitis B Infection in Hemodialysis Patients in Tehran Province, Iran. Hepat Mon. 2009;9(3):206-10. 46. Mehrabani D. Seroprevalence of Hepatitis B Virus among Hemodialysis Patients in Bushehr Province, Southern Iran. Hepat Mon. 2011;11(3):200-2. 47. Joukar F, Besharati S, Mirpour H, Mansour-Ghanaei F. Hepatitis C and hepatitis B seroprevalence and associated risk factors in hemodialysis patients in Guilan province, north of Iran. Hepat Mon. 2011;11(3):178-81. 48. Alavian SM, Akbari H, Ahmadzad-Asl M, Kazem M, Davoudi A, Tavangar H. Concerns regarding dentists' compliance in hepatitis B vaccination and infection control [1]. Am J Infect Control. 2005;33(7):428-9. 49. Keller S, Daley K, Hyde J, Greif RS, Church DR. Hepatitis C prevention with nurses. Nurs Health Sci. 2005 Jun;7(2):99-106. 50. Gordon GP. Practice behaviors of RNs related to hazardous risks within the clinical setting. Medsurg Nurs. 1999 Jun;8(3):174-7. 51. Aiken LH, Sloane DM, Klocinski JL. Hospital nurses' occupational exposure to blood: prospective, retrospective, and institutional reports. Am J Public Health. 1997 Jan;87(1):103-7. 52. Perry J, Jagger J. Cutting sharps risks in ICUs and CCUs. Nursing. 2005 Aug;35(8):17. 53. Grob P. Introduction to epidemiology and risk of hepatitis B. Vaccine. 1995;13 Suppl 1:S14-5. 54. Janjua NZ, Akhtar S, Hutin YJ. Injection use in two districts of Pakistan: implications for disease prevention. Int J Qual Health Care. 2005;17:4018.
55. Alavian SM, Fallahian F, Lankarani KB. Comparison of Seroepidemiology and Transmission Modes of Viral Hepatitis B in Iran and Pakistan. Hepat Mon. 2007;7(4):233-8. 56. Khan AJ, Luby SP, Fikree F, Karim A, Obaid S, Dellawala S, et al. Unsafe injections and the transmission of hepatitis B and C in a periurban community in Pakistan. Bull World Health Organ. 2000;78(8):956-63. 57. Massari V, Retel O, Flahault A. How do general practitioners approach hepatitis C virus screening in France? Eur J Epidemiol. 1999 Feb;15(2):119-24. 58. Margolis HS, Handsfield HH, Jacobs RJ, Gangi JE. Evaluation of office-based intervention to improve prevention counseling for patients at risk for sexually acquired hepatitis B virus infection. Hepatitis B-WARE Study Group. Am J Obstet Gynecol. 2000 Jan;182(1 Pt 1):1-6. 59. Zandi M, Adib-Hajbagheri M, Memarian R, Kazem Nejhad A, Alavian SM. Effects of a self-care program on quality of life of cirrhotic patients referring to Tehran Hepatitis Center. Health Qual Life Outcomes. 2005;3. 60. Moghimi M, Marashi SA, Kabir A, Taghipour HR, Faghihi-Kashani AH, Ghoddoosi I, et al. Knowledge, Attitude, and Practice of Iranian Surgeons About Blood-Borne Diseases. J Surg Res. 2008 Feb 1. 61. Sharp G, Pearse J, Chiarello L. Sharps-related injuries in the health care setting: impact and prevention strategies. Asepsis. 1995;17(1):14-21. 62. McEwen M, Farren E. Actions and beliefs related to hepatitis B and influenza immunization among registered nurses in Texas. Public Health Nurs. 2005 May-Jun;22(3):230-9. 63. Nori S, Greene MA, Schrager HM, Falanga V. Infectious occupational exposures in dermatology--a review of risks and prevention measures. II. The pregnant dermatologist. J Am Acad Dermatol. 2005 Dec;53(6):1020-6. Corresponding author Seyed-Moayed Alavian, Gastroenterology and Hepatology, Baqiyatallah Research Center for Gastroenterology and Liver Disease, Tehran, Iran, E-mail: Alavian@thc.ir
1950
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Periodontal condition of pregnant women assessed by CPITN and the role of the nurses according to the needs of treatment
Ayfer Tezel1, Adnan Tezel2
1 2
Ankara University, Faculty of Health Sciences, Department of Nursing, Ankara, Turkey, Kırıkkale Mouth and Dental Health Centre, Director of Health Centre, Kırıkkale, Turkey.
Abstract Background: Periodontitis is an infection of the supporting structures of the teeth and quite common in the general population. If periodontitis is untreated, teeth can become loose and ultimately lost. Objective: The purpose of this study was to determine the existing periodontal condition of pregnant women and treatment needs (CPITN). Methods: The investigation was carried out on 193 pregnant women. Clinical examinations were carried out under natural light by a mouth mirror and a World Health Organization (WHO) probe. The data were statistically investigated using paired t-test. Results: Code 2 was found to be in the highest ratio. Code 4 was in the highest ratio among the oldest pregnant group. The need of oral hygiene (TN1) rate alone was higher young pregnant women. In contrast, TN3 increased with the increase of age. The severity of the bleeding in gingival increased with the period of increasing trimester. The mean probing depth for 3rd trimester was higher than those of both 1st trimester and 2nd trimester. Conclusion: The data confirmed that there was a possible relation between periodontal disease severity and terms of pregnancy. The findings of CPITN index illustrated the importance of a simple preventive oral hygiene programs. The duty both for nurses or dentists during pregnancy is to give good oral hygiene instruction to the candidate mother, and to direct her to advanced therapy in complex situations.
Key words: nursing, pregnancy, oral health status, CPITN Introduction Periodontitis is an infection of the supporting structures of the teeth. It spreads into peridontal ligament and alveolar bone by causing the destruction of the collagen fibers, which attach the tooth to the bone, and the resorption of the supporting bone. It is an inflammatory process initiated by bacterial plaque around the teeth, which may progress with deepening of the gingival sulcus to form a “pocket “that harbors the bacteria and metabolic debris. If periodontitis is untreated, teeth can become loose and ultimately lost [1]. Periodontitis is quite common in the general population. According to the American Dental Association, 75% of the general population in the USA over the age of 35 has some forms of periodontal disease. This is 78 to 83% in Turkey [2]. Although the primary etiologic agent in periodontitis is bacterial plaque, predisposing conditions (Such as: diabetes mellitus, smoking, pregnancy, malnutrition, low socioeconomic status) play a significant role on severity and progression of periodontitis [1,3]. There is an established literature on relationships between pregnancy and periodontal conditions [4-9]. There also is a growing literature on the relationship between periodontal disease in pregnant and premature birth, which includes low-birth weight for 1951
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
gestational age and fetal growth restriction [10-19]. The main way to avoid from periodontal breakdown in pregnant is effective mouth care. The prevention of periodontal breakdown in pregnant is mostly based on education of the individual. Thus patients should be informed about the importance of oral health for pregnancy, and should be taught that the main symptom of periodontal disease is gingival bleeding [1]. Plaque and calculus deposits which are the most important pathogenic factors of periodontopathy in the oral cavity should be removed through careful self-care and regular professional care to reduce the risk of periodontitis in pregnancy. Patients should also learn how to brush his teeth correctly, which should be carried out at least twice a day, and how to use dental floss and sometimes chlorhexidine digluconate 0.2 % [1,2]. There are not dental hygienists in our country. However, nurses work with dentists as a dental hygienist. Whereas the dentist is responsible for the periodontal tissue repair primarily in pregnant, nurses as well as dentists are responsible for maintaining the structure or providing survival after periodontal tissue repair. As know, nurses help the patients who cannot care for their mouths independently according to their needs. Besides, they instruct patients in order to provide good oral hygiene [20]. As it is known, oral health of some patients is at risk. Those whose health conditions are serious, and who have a mobility restriction due to paralysis or a plaster cast in extremities; who can not be fed orally; are under restriction of liquid intake; who mouth breath or take oxygen treatment; have undergone oral or jaw surgery; receive radiotherapy or chemotherapy; and who are pregnant may experience various oral problems [21,22]. The purpose of this study is to determine the existing periodontal condition of pregnant women using CPITN, to investigate between the periodontal conditions and pregnancy, and to evaluate the role of nurses according to the needs of treatment. Methods This investigation is a descriptive study to investigate the periodontal conditions in pregnancy period. The research was carried out in a place 1952
where we could reach the pregnant women (Health Centers and Child Health Center etc). At the beginning of study, all pregnant were selected 1st trimester of pregnancy and enrolled 2nd and 3rd trimester. We did not change their oral habits. The pregnant women were informed about the method and purpose of the study, and agreed to participate. At the end of pregnancy, all of the pregnant were treated professional periodontal care. 2.1 Selection of Subjects Criteria for inclusion were: pregnant women aged 19-40 years, with singleton gestation, any weeks’ gestation. Pregnant women were divided into four age groups: 19-25; 26-30; 31-35; and 36-40. Exclusion criteria were: multiple gestation, high-risk gestation, chronic hypertension, HIV/ AIDS, pre-gestational diabetes, heart murmur, mitral valve prolapse and any systemic disease. The nurses who attended the prenatal care clinics identified potential participants. A total of 193 volunteer pregnant were entered in the study after giving written consent. 2.2 Recording of pregnant characteristics A nurse administered a structured questionnaire before clinical examination. The following variables were recorded for each pregnant women : age, height, education level, previous pregnancy history-number carried to full term, number of previous pregnancies aborted, tobacco consumption, alcohol consumption, use of illicit drugs, domestic violence, gestational age, the number of pregnancy, the month of the pregnancy, socio- economic and oral hygiene habits. 2.3 Clinical Examination The occlusal adaptation conditions, such as open bite on anterior teeth, tongue thrust, lip biting, occupation-related peculiarities (holding nails or pins between the teeth, for example) and tipping of adjacent teeth into an extraction site resulting in occlusal imbalances, were considered.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The following criteria were excluded: the use of a drug to affect the mouth flora (such as povidineiodine, chlorhexidine, listerine). All clinical examinations were conducted outdoors under natural light by a mouth mirror and a World Health Organization (WHO) probe [23] with the pregnant woman seated on a chair. The same dental clinician who had been calibrated prior to the commencement of the study carried out all periodontal examination. Thus, a further examination was carried out according to the same periodontal indices and performed by the same clinician. The maximum periodontal pocket depth (mm) and level of inflammation of the periodontal tissues (based on bleeding index scored 0-3) were recorded for each tooth. The periodontal status and periodontal treatment needs of pregnant in different age groups were assessed by means of Community Periodontal Index for Treatment Needs (CPITN scored 0-4) [24]. CPI: The index scores (codes) describe the severity of disease, some aspects of the etiology (calculus), as well as symptoms such as bleeding upon probing. The absolute probing depth in millimeter (mm) is determined only secondarily; any gingival recession that might be present is not recorded. TN: The index code prejudices the necessary treatment in as much as the absolute index score (4) does not correlate with the code from the “treatment package” (3). Code 2 and 3 demanded identical therapy. The scores for the CPITN index are: CPI- codes; 0, Healthy; 1. Bleeding on probing; 2. Supra and/or subgingival calculus, Iatrogenic marginal irritation; 3. Shallow pockets up to 5 mm; 4. Deeper pockets from 6 mm. TN- codes; 0, none, (in CPI-code 0); 1. Oral hygiene instruction (OHI), (in CPIcode 1); 2. OHI and calculus removal, (in CPI-codes 2 and 3); 3. OHI , calculus removal, complex treatment (in CPI-code 4).
2.4 Statistical analysis The forms filled in for each patient were evaluated statistically. The data were analyzed by percentage. Also, analysis included descriptive statistics (mean and standard deviation of all variables). Quantitative variables were analyzed with paired t-test to compare the clinical results obtained from pregnant in different trimesters of pregnancy. For CPITN index, the data were subject based on bleeding and probing depth, 3. Results The investigation was carried out on 193 pregnant. Table 1 summarized the characteristics of the sample. The mean age of the pregnant was 25.3±0.48 years, with the majority of the study population in the 19-25 years old category (48.4 %). Only 16 (8.3 %) pregnant women had secondary or higher education. More than 53.9 % of the pregnant women had not received dental treatment during the last year. Table 1. Characteristics of the pregnant women (n=193)
Variable Age (years) 19-25 26-30 31-35 36-40 Mean±SD Educational level None Primary Secondary or higher Previous dental treatment During last year 2-3 years before Never Number Percentage 93 62 27 11 25.3±0.48 135 42 16 104 70 19 48.4 32.1 13.9 5.6
69.9 21.8 8.3 53.9 36.3 9.8
Pregnancy numbers of individuals according to different age groups is given in Table 2. A fifth of the subjects were first-time mothers, and approximately 15 % had had five or more previous pregnancies.
Journal of Society for development in new net environment in B&H
1953
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Oral hygiene habits of pregnant were evaluated and the findings concerning brushing frequency are given in Table 3. It was observed that most of the pregnant did not have good oral hygiene habits. In fact, 66.8 % of pregnant in the study never brushed their teeth. The periodontal status of CPITN index in pregnant women surveyed was assessed at the 1st, 2nd and 3rd trimester, and the distribution of CPI scores at 1st trimester is given in Table 4. As each age group was taken individually, healthy gingiva reduced with respect to age increase. The highest rate of code 2 was found in the19-25 and 26-30 age groups. The highest rate of code 3 was found in the oldest age group. There was a high level of periodontal disease: 30 % of the mothers had at least one sextant with CPI 4. All of these scores was getting the worst 2nd and 3rd trimester. Distribution of periodontal treatment needs is given in Table 5
Age Groups 19-25 26-30 31-35 36-40 TOTAL N 93 62 27 11 193 1 68 27 95 2 14 16 6 36 3 11 8 5 24 4 7 5 8 20
according to the analysis of periodontal conditions for different age groups. The oral hygiene instruction, need in TN1, was higher in young pregnant. However, the need for complex treatment rose with age. The assessment of gingival inflammation and pocket depth according to trimester periods of pregnancy is given in Table 6. The severity of gingival bleeding increased with the of trimester period. The mean bleeding on probing for the 3rd trimester (2.64±0.53) was higher than those of both the 1st trimester (1.30±0.48) (p<0.001) and the 2nd trimester (1.52±0.50) (p<0.001). The mean bleeding on probing for 1st trimester (1.30±0.48) was lower than for the 2nd trimester (1.52±0.50). But, there were no differences between trimester 1 and 2 (p>0.05). The mean probing depth for the 3 rd trimester (2.18±0.19) was higher than that of both the 1st trimester (1.89±0.11) (p<0.001) and the 2nd trimester (1.96±0.14) (p<0.001).
Number of pregnancy 5 3 9 3 15 6 1 2 3 7 8 9 10 -
Table 2. Pregnancy numbers of individuals according to different age groups
Table 3. Brushing habits of pregnant women
Age Groups 19-25 26-30 31-35 36-40 TOTAL N 93 62 27 11 193 n 54 47 17 11 129 None % 58.0 76.7 62.9 100.0 66,8
Brushing Habits Once a day n 29 13 8 0 50 % 31.0 20.0 29.7 00.0 25,9 Twice a day n 10 2 2 0 14 % 11.0 3.3 7.4 00.0 7,3 3 times a day n 0 0 0 0 0 % 00.0 00.0 00.0 00.0 00
Table 4. The distribution of 1st trimester CPI values of pregnant women according to different age groups (whole mouth scores)
Age Groups 19-25 26-30 31-35 36-40 TOTAL N 93 62 27 11 193 Code 0 n 9 4 0 0 13 % 9.6 6.5 0.0 0.0 6,8 Code 1 n 19 10 4 0 33 % 20.4 16.3 14.7 0.0 17,0 Code 2 n 39 23 8 2 72 % 42.0 37.0 30.0 18,7 37,4 Code 3 n 2 8 4 3 17 % 2.2 12,9 14.7 27.1 8,8 Code 4 n 24 17 11 6 58 % 25,8 27,3 40,6 54.2 30,0
Code 1: Bleeding on probing; Code 2: Supra and/or subgingival calculus, Iatrogenic marginal irritation, Code 3: Shallow pockets up to 5 mm; Code 4: Deeper pockets from 6 mm.
1954
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 5. Periodontal treatment needs (TN) of pregnant women according to different age Groups (whole mouth scores)
Age Groups 19-25 26-30 31-35 36-40 TOTAL N 93 62 27 11 193 n 0 0 0 0 0 TN0 % 00 00 00 00 00 n 29 13 4 0 46 TN1 % 31.1 20.0 15.0 0.0 23,8 n 62 43 17 7 129 TN2 % 66.7 70.9 62.8 63.6 66,9 n 2 6 6 4 18 TN3 % 2.2 10.0 22.2 36.4 9,3
TN0: no treatment , TN1: Oral hygiene instruction, TN2: OHI and calculus removal, TN3: OHI , calculus removal, complex treatment
Table 6. Comparison of probing depth and bleeding on probing values obtained pregnant women (whole mouth scores)
Bleeding on probing Terms 1.Trimester 2.Trimester 3.Trimester n 193 193 193 Mean±SD 1.30 ± 0.48 ┐┐ §ú 1.52 ±0.50 ┐ ┘ ï† †ú
§ p> .05 † p< .001
Pocket Depth Mean±SD 1.89 ± 0.11 ┐ ┐ §ú 1.96 ±0.14 ┐ ┘ ï† †ú 2.18 ± 0,19 ┘ ┘
2.64 ± 0,53 ┘ ┘
Bleeding on probing of 0.0-1.0 indicates mild gingivitis, 1.1-2.0 indicates moderate gingivitis and 2.1-3.0 indicates and 2.1-3.0 indicates severe gingivitis. Pocket depth of 0.0-3.0 indicates mild periodontitis, 3.1-6.0 indicates moderate periodontitis and 6.1 and above indicates severe periodontitis. 4. Discussion and Conclusion 4.1 Discussion In this study, the effects of pregnancy on periodontal health were evaluated using clinical findings. Volunteer pregnant in four different age groups formed according to standard age group norms of WHO were included in the study. In order to increase the participation some facilities were provided. For example, the research was carried out in a place where we could reach the pregnant (Health Centers, Mother and Child Health Center etc.) Clinical examination of the pregnant was carried out in a standard position under the natural lighting. The pregnant were seated chairs and their heads
were leaning against a wall. Other research done outside the clinic a similar method also used [25]. The World Health Organization (WHO) recommends using the CPITN index system instead of many other systems used in the determination of gingiva diseases. Because it allows cooperation studies conducted among around the world [26]. The most important aspects of the index are not only determining the periodontal condition but also giving the proposed treatment needs. Our choice of periodontal indices was essentially determined by the need to carry out the clinical examination on the ward. CPITN [26] was seen to provide the most appropriate screening system for the chosen setting. Pregnancy constitutes a special physiological state characterized by a series of temporary adaptive changes in body structure, as the result of an increased production of estrogens, progesterone, gonadotropins, and relaxin, among other hormones. The oral cavity is also affected by such endocrine actions, and may present both transient and irreversible changes as well as modifications that are considered pathological [27]. Pregnancy-associated gingivitis, a type of sex steroid hormone gingival 1955
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
disease most common in the second trimester of pregnancy, is characterized by an exaggerated response to plaque biofilm. The gingiva may appear fiery red at the marginal gingiva, and interdental papillae, edematous and enlarged, have a loss of tissue resiliency and have an absence of bone and attachment apparatus. Tissues may be edematous, smooth and shinly, bleed easily, and display increased probing depths. These gingival changes occur earlier and more frequently in the anterior than in the posterior areas, and may progress to a pregnancy granuloma. Pregnancy-associated gingivitis usually reaches maximum severity during the eighth month, and is less severe after childbirth [28,29]. Sex steroid hormones, estrogen and progesterone increase gingivitis during pregnancy. Human gingiva has receptors for progesterone and estrogen. When plasma levels of estrogen and progesterone increase, these hormones accumulate in gingival tissues [27]. Progesterone causes a dilatation of the gingival capillaries, increasing their permeability and thus increasing gingival exudates, edema, and accumulation of inflammatory cells. It was reported that levels of estrogen and progesterone increased during the second trimester of pregnancy and reached the highest level in the 3 rd. trimester, and fell immediately before birth [28, 29]. This increase occurs even with good plaque control, but it may be substantial when plaque control is marginal or poor. The influence of hormonal changes on the risk of developing periodontal disease has been the subject of much discussion. According to Stamm [30], gingival diseases increase especially in the first trimester. However, according to a majority of authors, pregnant sufferings from hormonal changes are at increased risk for the development of periodontal disease [27-29]. Our research provides further confirmation, this idea that the severity of gingival bleeding and the depth of pockets increased with the as pregnancy progresses. After all, it was indicated that the gingival problems experienced in pregnancy are not different from the ones due to plaque [28,28 ]. In recent studies, it was suggested that endogen factors (such as; open bite on anterior teeth, lip biting) can be inactivated through a good oral hygiene when the exogenous factors (such as; the use of drug to effect the mouth flora) are eliminated [25]. In another section of our research, the characteristics of pregnant women were evaluated. It was 1956
observed that the marriage age is young and the fecundity number is high. Among the individuals included in our research, the idea that teeth and gingival problems are unavoidable during pregnancy was very common. In addition, pregnant women do not want to go the dentists because they believe that their fetuses will be harm. In this respect, the nurses have a great responsibility to observe all skin and mucous membranes in and about the oral cavity, including the periodontium, and to record and call to the attention of the dentist and the pregnant women those areas that evidence disease. A variety of skin and oral mucosal lesions may be observed that may or not be symptomatic. Recognition, treatment, and follow-up of specific lesions may be of great significance to the general and oral health of the pregnant women. Nurses use their extraoral and intraoral examination and interviewing skills to identify nutritional problems and provide sound counseling or appropriate referral. Nurses are in an excellent position to recognize signs of poor nutrition and to take steps to initiate change. Regular contact with continued-care pregnant women at 1-or 3-month intervals enables nurses to make observations of the pregnant women’ physical status, food intake, and response to dental hygiene care. Nurses should inform dentists of observations that indicate nutritional problems and should incorporate approaches to solving the problem in their care plans. In our study, according to 1st trimester’s CPITN index findings, the rate of pregnant women with healthy gingiva decreases as age increases. There were no pregnant women with healthy gingiva after the age of 31. As each age group was taken individually, Codes 1 and 2 were found highest in younger pregnant women and code 4 was the highest in older pregnant women. This is a descriptive score because we know that periodontal diseases increase with age, and we do not know their oral condition before pregnancy. But, at the end of the 3rd trimester, we found that their CPITN score was the worst then 1st trimester (table 6). According to this score, we can say that if oral habits do not change and not take professional oral care during pregnancy, oral condition goes to worsen in pregnancy. In the previous studies with the same purpose, it was illustrated that periodontal pocket depth increases as pregnancy progresses, and decreases or the end of pregnancy and about three months after pregnan-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
cy, The periodontal pocket returns to its former position [27,28] In the other studies, it was indicated that the increase of pocket depth is due to growth of gingiva rather than periodontal breakdown [31,32] Our study demonstrated that the increase of periodontal pockets had at least one sextant displaying CPI 4, corresponding to severe periodontal disease. However, Miyazaki et al., [32] reported that 31 % of the pregnant women in a Japanese population had periodontal pockets of 4 or 5 mm, result similar to the data in the present work. But, we do not say these increases due to periodontal breakdown. According to the CPI findings obtained, oral hygiene instruction need in TN2 , was found in significant levels in pregnant women. As a matter of fact, Miyazaki et al. [32] found that only 1-2 % of the women in his study needed periodontal surgery. Also our data supported these findings. Another finding determined that the need for complex treatment increased with age. There is a positive correlation between brushing habits and periodontal problems. In our study, we found that 68.8% of pregnant women did not brush her teeth. This finding suggests that good oral hygiene habits are not practiced frequently among pregnant women. The best way to prevent of periodontal breakdown in pregnant women is through education and professional dental care. Pregnant women should be informed about the importance of oral health, and should be taught that the main symptom of periodontal disease is gingival bleeding. Pregnant woman should learn how to brush their teeth correctly. Ideally, it should be carried out at least twice a day, and how to use dental floss and sometimes chlorhexidine digluconate 0.2 %. It is best to visit the dentist at least four times a year. But in the absence of effective oral hygiene, non-surgical periodontal therapy only retards the progression of destructive periodontitis [33]. Also, Lie et al. [34] reported that the oral hygiene of the patient influences the tissue and may partly mask the response caused by scaling. 4.2 Conclusion The data confirmed that there was a possible relation between periodontal disease severity and terms of pregnancy. Periodontal disease severity in
the 3rd trimester was higher than those of both 1st trimester and 2nd trimester. The findings of CPITN index illustrated the importance of a simple preventive oral hygiene programs. The task both for nurses or dentists during pregnancy is to give good oral hygiene instruction to the expectant mother, and to direct her to advanced therapy in complex situations. It will be useful to inform the pregnant women about their periodontal status before the hormonal changes begin at the beginning of their pregnancies, because pregnancy causes to increase the present periodontal diseases. Finally, whole women have to check up her mouth before to become pregnant for periodontal health and their fetus. 4.3 Practice Implications The findings of CPITN index illustrated the importance of a simple preventive oral hygiene programs. Hospitals and medical groups will need to develop training programs for pregnant women. The duty both for nurses or dentists during pregnancy is to give good oral hygiene instruction to the candidate mother, and to direct her to advanced therapy in complex situations. 5. References
1. Carranza FA. Clickman’s clinical periodontology. (8 th ed.). Philadelphia: W.B. Saunders Company 1996. 2. Saydam GO. Periodontal health status and treatment needs for index age groups in Turkey based on CPITN values. J Nihon Univ Sch Dent.1991;33:147-151. 3. Lindhe J. Textbook of clinical periodontology. (2nd ed.). Copenhagen: Munksgaard 1992. 4. Löe H, Silness J. Periodontal disease in pregnancy I. Prevalence and severity. Acta Odontologica Scandinavica, 1963;21 :533-551. 5. Silness J, Löe H. Periodontal disease in pregnancy II. Correlation between oral hygiene and periodontal condition. Acta Odontologica Scandinavica, 1964; 24: 121-135. 6. Cohen D, Shapiro J, Friedman L, Kyle G, Franklin S. A longitudinal investigation of periodontal changes during pregnancy and fifteen months postpartum: part II. J Periodontol 1971; 42: 653-657. 7. Machuca G, Khoshfeiz O, Lacalle J, Machuca C, Bullon P. The influence of general health and socio-
Journal of Society for development in new net environment in B&H
1957
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
cultural variables on the periodontal condition of pregnant women. J Periodontol 1999;70:779-785. 8. Laine MA. Effect of pregnancy on periodontal and dental health. Acta Odontologica Scandanavica 2002;60: 257-264. 9. Taani DQ, Habashneh R, Hammad MM, Batieha A. The periodontal status of pregnant women and its relationship with socio-demographic and clinical variables. J Oral Rehabil. 2003;30: 440-445. 10. Jeffcoat MK, Hauth JC, Geurs NC, Reddy MS, Cliver SP, Hodgkins PM,Goldenberg R L. Periodontal disease and preterm birth: results of a pilot intervention study. J Periodontol 2003;74:1214-1218. 11. Champagne CME, Madianos PN, LieffS, Murtha AP, Beck JD, Offenbacher S. Periodontal medicine emerging concepts in pregnant outcomes. J Int. Acad. Periodontol. 2000;2:9-13. 12. Offenbacher S, Katz, V, Fertik G, Collins J, Boyd D, Maynor G, McKaig R, Beck J. Periodontal infection as a possible risk factor for preterm low birth weight. J Periodontol. 1996; 67: 1103-1113. 13. Offenbacher S, Lieff S, Beck, J D. Periodontitisassociated pregnancy complications. Prenatal and Neonatal Medicine 1998;3: 82-85. 14. Offenbacher S, Lieff S, Boggess KA, Murtha AP, Madianos PN, Champagne C M, McKaig R G, Jared HL, Mauriello SM, Auten RLJ, Herbert WN, Beck JD. Maternal periodontitis and prematurity. Part I: obstetric outcome of prematurity and growth restriction. Annals of Periodontology 2001; 6:164-174. 15. Jeffcoat MK, Geurs NC, Reddy MS, Cliver SP, Goldberg SL, Hauth JC. Periodontal infection and preterm birth: results of a prospective study. J Am. Dent. Assoc. 2001;132:875-880. 16. Davenport E S, Williams C E, Sterne JA, Murad S, Sivapathasundram V, Curtis MA. Maternal periodontal disease and preterm low birthweight: case-control study. J Dent Res. 2002;81:313-318. 17. Lopez NJ, Smith PC, Gutierrez J. Periodontal therapy may reduce the risk of preterm low birth weight in women with periodontal disease: a randomized controlled trial. J Periodontol 2002;73: 911-924. 18. Boggess KA, Lieff S, Murtha AP, Moss K, Beck J, Offenbacher S. Maternal periodontal disease is associated with an increased risk for preeclampsia. Obsteric and Gynecology 2003;101:227-231. 19. Dasanayake A P, Russell S, Boyd D, Madianos P N, Forster T, Hill E. Preterm low birth weight and periodontal disease among African Americans. Dent Clin of North America 2003;47:115-125. 20. Taylor C, Lillis C, LeMone P. Fundamentals Nursing (4 th ed.) Lippincott Williams/ Wilkins, Philadelphia 2001.
21. Chitty KK. Professional Nursing: Concepts and Challenges. (2nded.).W.B. Saunders Company, Philadelphia 1997. 22. Timby B. Fundamentals Skills and Concept in Patient Care. (7th ed.). Lippincott Williams/ Wilkins, Philadelphia 2001. 23. Emslie RD. The 621 periodontal probe, Int Dent J, 1980;30:287-288. 24. Ainamo J, Barmes D, Beagric G, Cutress T, Martin J, Sardo I. Development of the World Heart Organization Community Index of Treatment Needs (CPITN), Int Dent J, 1982;32:281-291. 25. Orbak R, Tezel A, Çanakçı V, Erciyas K, Sağsöz N. CPITN assessment of periodontal conditions of pregnant, T Clin J Dental Sci, 1998;4: 174-179. 26. Ainamo J. Assessment of periodontal treatment needs adaptation of the WHO community periodontal index of treatment needs(CPITN) to European countries. Public health aspects of periodontal disease. Quint Publish Co Inc 1984;33-45. 27. Hugosan A. Gingival inflammation and female sex hormones. A clinical investigation of pregnant women and experimental studies in dogs, J Periodontol Res, 1970;5: 1-5. 28. Löe H. . Periodontal changes in pregnancy, J Periodontol, 1965;36:37-42. 29. Löe H. Endocrinologic influences on periodontal disease in pregnancy and diabetes mellitus, Ala J Med Sci, 1965;5: 336-340. 30. Stamm JM. Epidemiology of gingivitis, J Clin Periodontol, 1986;13: 360-365. 31. Cohen DW, Friedman L, Shapiro J, Kyle C.. A longitudinal investigation of the periodontal changes during pregnancy, J Periodontol, 1969; 40:563-570. 32. Miyazaki H, Yamashita Y, Shirahama R, Goto-Kimura K, Shimada N, Sogame A, Takehare T. Periodontal conditions of pregnant women assessed by CPITN, J Clin Periodontol, 1991;18: 751-756. 33. Helden LB, Lisgarten MA, Lindhe,J.. The effect of tetracycline and/or Scaling on human periodontal disease, J Clin Periodontol, 1979;6: 222-230. 34. Lie T, Hoof I, Gjerdet NR. Computerized evaluation of the effectiveness of subgingival scaling in jaw models, J Clin Periodontol, 1987;14:149-155. Corresponding autor Ayfer Tezel, Ankara University, Faculty of Health Sciences, Department of Nursing, Ankara, Turkey, E-mail: tezel@health.ankara.edu.tr
1958
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Vascular access for hemodialysis: an experience report
Guilherme Centofanti1, Eliane Y. Fujii1, Rafael N. Cavalcante1, Edgar Bortolini1, Luiz Carlos de Abreu2, Vitor E. Valenti2, 3, Adilson C. Pires1, Hugo Macedo Junior2, Yumiko R. Yamazaki1, Soraya G. Audi2, Jose R. Cisternas2, Joao R. Breda1, Valdelias X. Pereira2, Edson N. Fujiki2, João A. Correa1
1 2
3
Departamento de Cirurgia, Faculdade de Medicina do ABC, Santo André, SP, Brasil, Laboratório de Escrita Científica, Departamento de Morfologia e Fisiologia, Faculdade de Medicina do ABC, Santo André, SP, Brasil, Departamento de Patologia, Faculdade de Medicina, Universidade de São Paulo, São Paulo, SP, Brasil.
Abstract Background: The evaluation of dialysis services is important for its adequacy and improvement in patient’s quality of life. We evaluated the profile of vascular access used for hemodialysis patients in our Unit. Methods: We evaluated 164 patients of both genders aged over 18 years old who have undergone implant or manufacture of vascular hemodialysis access. We excluded patients on renal replacement therapy by peritoneal dialysis. Results: 155 patients had arteriovenous fistula, 149 were performed by the same dialysis and six were still maturing. 15 patients were using central venous catheter. Among the patients under hemodialysis for arteriovenous fistula, 143 were native and six were prepared using polytetrafluoroethylene prosthesis. Among the 15 patients with central venous catheters, ten used short-term catheter and five used long-term catheter. The average time of using was seven days. Patients on dialysis for long-term catheter and without maturing fistula had a mean time of 4.4 months of use and had exhausted their chances of making fistulas. The most frequent type of fistula was the distal radio cephalic in 82 patients, followed by proximal radio cephalic in 24 patients. Among the fistula for dialysis patients, the highest prevalence was radio cephalic fistula in 106 patients. Among the most frequent complications observed in fistulas, the pseudoaneurysm after puncture and venous hypertension were the most common. Conclusion: Our Unit of hemodialysis is above the limits established by international norms.
Key words: Renal Dialysis; General Surgery; Ambulatory Care; Ambulatory Care Facilities. Introduction The kidney is an essential organ to keep the body alive [1-5]. The need for a vascular access is as old as hemodialysis and its adequate functioning is essential for effective maintenance dialysis [6-12]. The ideal access allows a safe approach, provides sufficient flow to perform hemodialysis and has a low complication rate [6, 12, 13]. Among the main access, through native fistula, fistula with prosthesis and central venous catheters, a native fistula comes closest to these premises [6, 11-13]. Guidelines from different countries recommend its use [6, 11-14] and studies showed that the native access presents the best patency (4 to 5 years) and lower rate of reoperation when compared with other accesses [12, 13]. Catheters are associated with high rates of infection and may compromise the subsequent manufacture of fistulas [13, 14]. Complications of vascular access are the main causes of morbidity in chronic renal dialysis patients and contribute to a high percentage of hospitalizations, resulting in high treatment costs [6, 12, 13, 15]. As a result, in recent years it has been emerging worldwide consensuses that aim to standardize the use of access in order to reduce complications and to promote greater longevity of the fistula and improve the patient’s quality of life [8]. The NKF-DOQI (National Kidney Foundation - Dialysis Outcomes Quality Initiative) - Clinical Practice Guidelines for Vascular Access, published 1959
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
in 1997 and its updates, is an American consensus that establishes guidelines and strategies for their implementation in order to increase the rate of preparation of native fistulas, aiming patient identification which is evolving with kidney failure and protection of local fistulas production. After its achievement, the dialysis units must implement a program to detect accesses at risk, complication rates and implement procedures to maximize accesses longevity [6, 12, 13]. Thus, the analysis of frequent dialysis services is essential for its adequacy in relation to recommended guidelines and also to improvements of vascular access with reduced morbidity and improved quality of life of dialysis patients [6, 8]. This context prompted us to conduct this research, aiming to monitor the quality of service and maintain control over the goals advocated by these institutions. Therefore, we aimed to evaluate the profile of vascular access used for hemodialysis in patients from our Unit. Methods Population This is a descriptive transversal observational study conducted on April to May 2008. We performed the study on the dialysis unit in the Department of Nephrology of the Faculdade de Medicina do ABC, in the Padre Anchieta Teaching Hospital and in the Mario Covas Hospital. The sample consisted of 164 patients (98 males). The study was approved by the Ethics Committee of the Faculty of Medicine of ABC, with questionnaires and physical examination in all patients on dialysis. All patients gave informed consent. All procedures were in compliance with the Helsinki Declaration. Inclusion and exclusion criteria We included patients of both genders aged over 18 years old, which were in agreement with the consent term, who have undergone implant or manufacture of vascular hemodialysis access. We excluded patients on renal replacement therapy by peritoneal dialysis. Variables We evaluated the following variables: gender, age, time which the subject was using hemodya1960
lisis, comorbidity, actual and previous access and access complication. Statistical Analysis For the descriptive statistics we used the Microsoft Excel® program. Results We examined a total of 164 patients, 90 (55%) from Padre Anchieta Teaching Hospital and 74 (45%) from the Mário Covas Hospital. Regarding gender, 98 patients were men and 66 women. The mean age was 53.62 years old, ranging from 23 to 80 years old. The most common etiology was found for renal hypertension in 56.7% of patients. Associated diseases observed were hypertension and diabetes mellitus (Table 1). Among the patients, 155 had arteriovenous fistula, 149 were performed by the same dialysis and six of them were still maturing. The other 15 patients under dialysis were using central venous catheter (Table 2). Among the 149 patients who underwent hemodialysis for arteriovenous fistula, 143 were native and six were prepared using polytetrafluoroethylene (PTFE) prosthesis (Table 2). Among the 15 patients with central venous catheters, ten used short-term catheter and five used long-term catheter (Table 2). Table 1. Distribution of patients according to associated diseases
Associated diseases Hypertension Diabetes mellitus Neoplasia Coronary failure Systemic Lupus Erythematosus Others Number of patients 136 53 3 2 2 3 % 83 32.3 18.3 1.2 1.2 18.3
Considering the patients with short-term catheter and without maturing fistula (five patients), the average time of using was seven days (minimum of two days and a maximum of 30 days). Patients on dialysis for long-term catheter and without maturing fistula (four subjects) had a mean time of 4.4 months of use and had exhausted their chances of making fistulas.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Tabela 2. Distribution of vascular accesses in use
Type of vascular access Arteriovenous fistula Catheter
%: percentage. * Five patients with maturing fistula. ** One patient with maturing fistula. PTFE: polytetrafluoroethylene.
Total
Native PTFE Short-term* Long-term**
Number 143 06 10 05 164
% 87.2 3.6 6.1 3 100
The most frequent type of fistula on use was the distal radio cephalic in 82 patients (55%), followed by proximal radio cephalic in 24 patients (16.10%) (Table 3). The number of fistulas in dialysis patients conducted by this kind of therapy ranged from one to eight. In 86 patients (57.72%) the fistula in use was the first and only to be made. Tabela 3. Distribution of fistulas according to location
Type of fistula Distal radio cephalic Proximal radio cephalic Brachial cephalic Brachial basilic PTFE upper limb Sapheno-femoral Total
PTFE: polytetrafluoroethylene.
Number 82 24 23 11 06 03 149
% 55 16.1 15.5 7.4 4 2 100
Among the fistula for dialysis patients, the highest prevalence was radio cephalic fistula in 106 patients (71.1%) and the mean duration of use was 42.5 months, ranging from one month to 16 years. These patients had an average of 0.4 previous fistulas, and in 73 patients (68.9%) it was the only fistula. Among the most frequent complications observed in fistulas, the pseudo-aneurysm after puncture and venous hypertension were the only observed. Discussion Due to the high number of use and complications of vascular access for hemodialysis due to catheter use and fistula with prosthesis, mainly in the U.S. statistics, it was created in 1997, the NKF-DOQI, establishing guidelines for standar-
dization of care for chronic kidney disease to dialysis in relation to vascular access in order to improve the quality of dialysis, reduce the cost and complications, therefore, improving the quality of life of patients. The periodic review of access for hemodialysis should be performed on all services so monitoring their adequacy in relation to international guidelines. Based on these premises, it was performed at the Division of Nephrology of our University a study to verify the adequacy and monitor the vascular access, within the standards established by these guidelines. In our study the percentage of dialysis patients with arteriovenous fistulas was higher than the recommended by the NKF-DOQI 2006, which is 70%. The location of fistulas is in accordance with the guidelines. We observed the predominance of distal radio-cephalic, which has a high rate in the primary fistulas, which is the ideal combination for the patient because it is related to a lower complication rate and, hence, improved quality of life [16, 17]. The number of catheters found in our research also meets the recommended by the NKF-DOQI and a large proportion of patients with short-term catheters had fistulas in maturation. Making fistulas in patients before dialysis is a target on our service and it is difficult because our patients are often referred with end-stage renal disease. Patients with long-term catheters are at the stage of exhaustion of vascular accesses and some of them had fistulas at maturity which is also in accordance with the guidelines. Our findings are of great importance because the complications with vascular access, especially catheters, are major causes of morbidity and mortality in dialysis patients [6, 12, 13, 16]. Thus, our results fit with the guidelines recommendation 1961
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
[18, 19], which is relevant for improving quality of life of renal dialysis patient. In summary, the Unit of hemodialysis of our University is above the limits established by international norms, as evidenced by the analysis phase of the study. Acknowledgements This study received financial support from Núcleo de Estudos, Pesquisas e Assessoria à Saúde da Faculdade de Medicina do ABC (NEPAS-FMABC). References
1. Yang L, Li X, Wang KJ. Perirenal hematoma became bilateral ureteropelvic junction obstruction after one month later: a case report. HealthMED 2011;5: 596-98. 2. Abdulla MH, Sattar MA, Abdullah NA, Khan MAH, Allah HH, Johns EJ. The interaction between reninangiotensin system and sympathetic nervous system in the systemic circulation of conscious SpragueDawley rats. HealthMED 2010;4: 328-34. 3. Resic H, Mataradzija A, Kukavica N, Beciragic A, Sahovic V, Avdagic M, Masnic F. Cardiovascular complications in patients with diabetic nephropathy in pre-dialysis period and on hemodialysis. HealthMED 2010;4: 475-8. 4. Salih MRM, Hassan Y. Therapeutic drug monitoring of vancomycin in chronic kidney disease patients. HealthMED 2010;4: 379-85. 5. Cavaljuga S, Ibrahimovic L. Epidemiology of endemic nephropaty in Bosnia and Herzegovina until 1990 – A tribute to the late Professor Jacob A. Gaon. HealthMED 2010;4: 200-9. 6. Romeu M, Nogues R, Marcas L, Sánchez-Martos V, Mulero M, Martinez-Vea A, Mallol J, Giralt M: Evaluation of oxidative stress biomarkers in patients with chronic renal failure: a case control study. BMC Res Notes 2010, 3:20. 7. Ostrvica E, Ostrvica D, Katica V, Katica A. Impact of hemodialysis quality on Hemoglobin levels in patients on Epoietin beta therapy. HealthMED 2010;4: 885-89. 8. Hamissi J, Mosalaei S, Yousef J, Ghoudosi A, Hamissi H. Occurrence of hepatitis B and C infection among hemodialyzed patients with chronic renal failure in Qazvin, Iran: a preliminary study. HealthMED 2011;4: 301-6.
9. Centofanti G, Fujii EY, Cavalcante RN, Bortolini E, de Abreu LC, Valenti VE, Pires AC, Macedo Junior H, Yamazaki YR, Audi SG, Cisternas JR, Breda JR, Pereira VX, Fujiki EN, Correa JA. An experience of vascular access for hemodialysis in Brazil. Int Arch Med. 2011;4:16. 10. Correa JA, de Abreu LC, Pires AC, Breda JR, Yamazaki YR, Fioretti AC, Valenti VE, Vanderlei LC, Macedo H Jr, Colombari E, Miranda F Jr: Saphenofemoral arteriovenous fistula as hemodialysis access. BMC Surg 2010, 10:28. 11. Navaneethan SD, Aloudat S, Singh S: A systematic review of patient and health system characteristics associated with late referral in chronic kidney disease. BMC Nephrol 2008, 9: 3. 12. Karamanidou C, Clatworthy J, Weinman J, Horne R: A systematic review of the prevalence and determinants of nonadherence to phosphate binding medication in patients with end-stage renal disease. BMC Nephrol 2008, 9: 2. 13. NKF-KDOQI: Clinical Practice Guidelines For Vascular Acess: update 2000. Am J Kidney Dis 2001, 37: 137-181. 14. NKF-KDOQI: Clinical Practice Guidelines For Vascular Acess: update 2006. Am J Kidney Dis 2006, 48: 248-272. 15. Either JE, Lindsay RM, Barre PE: Clinical Practice Guidelines for Vascular Acess. Canadian Society of Nephrology. J Am Soc Nephrol 1999, 10: 297-305. 16. Tordoir J, Canaud B, Haage P: European Best Practice Guidelines on Vascular Acess. Nephrol Dial Transplant 2007, 22: 1188-1227. 17. Hoen B, Kessler M, Hestin D: Risk Factors for Bacterial Infections in Chronic Haemodialysis Adult Patients: a Multicentre Prospective Survey. Nefrol Dial Transplant 1995, 10: 377-381. 18. Combe C, Pisoni RL, Port FK: Dialysis Outcomes and Practice Patterns Study: Data on the Use of Central Venous Catheters in Chronic Hemodialysis. Nephrologie 2001, 22: 379-384. 19. Rayner H, Pisono RL, Gillespie B, Goodkin D, Akiba T, Akisawa T, Saito A, Young E, Port F. Creation: Cannulation and Survival of Arteriovenous Fistulae: Data from the Dialisis Outcomes and Practice Patterns Study. Kidney Int 2003, 63: 323-333. Corresponding autor João Antônio Corrêa, Departamento de Cirurgia, Faculdade de Medicina do ABC, Santo André, SP, Brasil, E-mail: cdh.fsp@gmail.com
1962
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Comparative Polymerase Chain Reaction Use for Tuberculosis in Taipei, Taiwan: 2003–2008
Yung-Fong Yen1, Pesus Chou2, Chung-Yeh Deng3
1 2 3
Section of Infectious Diseases, Taipei Municipal Yang-Ming Hospital, Taipei, Taiwan, Community Medicine Research Center and Institute of Public Health, National Yang-Ming University, Taipei, Taiwan, Institute of Hospital and Health Care Administration, National Yang-Ming University, Taipei, Taiwan.
Abstract Objective: To compare the utilization rates of polymerase chain reaction (PCR) test between physicians and other healthcare workers (HCWs) with tuberculosis (TB) in Taipei, Taiwan. Material and methods: A city-wide, population-based, cross-sectional study for HCWs with TB in Taipei, Taiwan, between 2003 and 2008 was conducted. The outcome variable in this study was whether HCWs with TB took or did not take a PCR test for TB diagnosis. Subjects were categorized as physicians (Western medical doctors or dentists) and other HCWs (nurses, technicians, or pharmacists). Odds ratios and 95% confidence interval (CI) were estimated by multiple logistic regression. Results: A total of 145 HCWs with TB were identified in Taipei between 2003 and 2008. PCR utilization was 17.4 times higher (95% CI: 1.5206.1) among physicians with TB than among other HCWs with TB in multiple logistic regression analysis, after controlling for patient characteristics, clinical manifestations, and the accreditation levels of hospitals or clinics. Also, the presence of a cough of more than one week duration significantly increased PCR utilization. Conclusions: PCR utilization for TB diagnosis was significantly higher among physicians than among other HCWs with TB in Taipei, Taiwan, between 2003 and 2008. This may be attributed to physicians’ better medical knowledge, greater ability to pay for expensive medical services, and/ or expertise in accessing the medical system.
Key words: polymerase chain reaction (PCR), tuberculosis, healthcare workers, advanced medical technology Introduction Modern health care has been characterized by the rapid development and widespread use of advanced medical technologies for decades. Physicians, having a high degree of medical knowledge and a ready access to the medical system, may use various medical services expertly when ill. Studying physicians as patients, especially by comparing physician-patients and other comparable patients, provides an opportunity to understand the care-seeking behavior of highly medically informed patients (1,2). The findings in previous related studies are, however, not consistent. It has been reported that surgery utilization rates are as high as or higher among physicians than among lawyers, ministers, or business executives (2), and that medical doctors (MDs) are equally or more likely than non-MDs to obtain generally indicated health maintenance procedures (3). Also, physicians are high users of preventive care (4), and women physicians can exceed all examined national goals for personal screening practices when compared with other socio-economically advantaged women (5). But, conversely, physicians may under-utilize medical services including surgery as compared with the general population (6), and physicians and their relatives have a decreased rate of caesarean section as compared with other high socioeconomic status women (7). 1963
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
In trying to resolve this dichotomy, it is noteworthy that none of the aforementioned studies adequately investigated the utilization of advanced medical diagnostic technologies. Tuberculosis (TB) has been the leader in incidence of all infectious diseases in Taiwan for more than two decades. Healthcare workers (HCWs) are among those most at risk of acquiring TB (8). The control of TB depends on early and accurate diagnosis, and also the provision of effective anti-tuberculous treatment (9,10). The polymerase chain reaction (PCR) test for TB diagnosis, detects the DNA sequence of Mycobacterium tuberculosis (MTB) rapidly with excellent sensitivity (75–95%) and specificity (95–98%) (11-13), and so represents a stellar example of an advanced medical diagnostic technology. Moreover, PCR tests can shorten the time needed to diagnose TB from 1–2 weeks to 1–2 days (14) and contribute to earlier treatment initiation and better patient outcomes (14,15). In Taiwan, hospitals charge a patient approximately US$ 30 dollars for a PCR test. Additionally, the PCR test is available mainly at medical centers for the reasons of cost-efficiency and proficiency. Little is known about the factors that are associated with the use of PCR for TB diagnosis. This prompted the present study, which sought to determine the PCR utilization rate for TB diagnosis among HCWs with TB, whether the utilization of PCR differed between physicians and other HCWs with TB, and whether the PCR utilization rate differed between medical centers and other hospitals or clinics. Material and methods Study population and data source This was a city-wide, population-based, cross-sectional study that consisted of all HCWs with TB in Taipei, Taiwan, between 2003 and 2008. Taipei, a metropolitan city, has the most HCWs among all cities in Taiwan. Research data was collected from the TB registry of the Taipei City Government. This project was approved by the Institutional Review Board of Taipei City Hospitals. All cases were anonymous. In Taiwan, all cases suspected of TB are required to report 1964
to local TB control departments through an Internet-based notifying platform. After receiving the notification of new cases, case managers interviewed the subjects about their demographic characteristics and clinical manifestations using a questionnaire. The questionnaire collected subjects’ information including their age, sex, occupation, the hospitals or clinics in which they worked, clinical symptoms, contact history, site of infection, date of diagnosis, examinations taken (i.e., acid fast bacillus (AFB) smear, TB culture, PCR test, and chest radiography), and drugs for treatment. Each subject was followed up until treatment was completed or the subject died. Cases that were reported to the Taipei TB control department during the study period were all included in the study, except for those that were finally proved as not having TB. All case managers were required to attend TB control training programs before interviewing the subjects. Results of TB culture were provided by infection control nurses at hospitals in Taipei. Outcome variables The outcome variable in this study was whether HCWs with TB took or did not take a PCR test for TB diagnosis. Main explanatory variables There were two main explanatory variables in this study: HCWs’ occupations and medical institutions in which they worked. HCWs’ occupations were classified as physicians (i.e., Western medical doctors or dentists) or other HCWs (e.g., nurses, technicians, or pharmacists). Medical institutions were categorized into four groups according to accreditation level: academic medical centers, regional hospitals, district hospitals, or clinics. Academic medical centers had more beds, specialties, and subspecialties, and were more often with research-oriented missions than regional hospitals, and much more so than district hospitals.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Control variables Control variables comprised patient-level characteristics (age, sex, education, and marital status) and clinical manifestations (presence or absence of cough, findings of chest X-ray (CXR), AFB smear status, site of infection). Age groups were <60 and ≥60-years-of-age and education levels were classified into <Master’s degree and ≥Master’s degree. Marital status categories were married, divorced, widowed, or unmarried (single). AFB smear status was classified as positive or negative. Findings of CXR were categorized as normal, aberrant without cavitation (defined as the appearance of a hollow space on CXR), or aberrant with cavitation. Sites of infection were classified as active pulmonary TB, non-active pulmonary TB, or extra-pulmonary TB. Statistical analyses Chi-Square analysis was used for the univariate analysis. Multiple logistic regression analysis was conducted to estimate odds ratios and their 95 percent confidence intervals (CI) after controlling for covariates. All analyses were conducted using SPSS version 15.0 statistical software packages (SPSS, Chicago, IL, USA). Results A total of 145 HCWs with TB were identified in Taipei between 2003 and 2008. Table 1 shows characteristics of cases and results of univariate analysis among them. Eight (5.5%) had a PCR test; six had the test at medical centers and two at regional hospitals. Crude PCR utilization rates were higher among physicians (20.0%) than among other HCWs (1.7%). Increased PCR utilization rates were also found among men and those with cough that had persisted more than one week. Table 2 shows characteristics of the eight HCWs that had a PCR test. Of them, six were physicians and two were nurses, and each was diagnosed by different doctors.
Table 1. Characteristics of HCWs with TB in Taipei, Taiwan, 2003–2008
PCR test P done value Total Rate for χ2 n (%) test No. of patients Sex Male Female Age (years) ≥60 <60 Education* ≥Master level <Master level Marital status Married Unmarried Divorce Widowed Occupation Physicians Other HCWs Accreditation level of medical institutions Medical centers Regional hospitals District hospitals Clinics Cough more than one week Yes No Finding of chest radiography Normal Aberrant without cavitation Aberrant with cavitation Sputum smear status Positive Negative Category of infection Active pulmonary TB Non-active pulmonary TB Extra-pulmonary TB * Two cases were missing 145 33 112 9 136 6 137 73 68 3 1 30 115 8 5.5 0.02
5 15.2 3 2.7 1 11.1 7 5.1 1 16.7 7 5.1 6 2 0 0 6 2 8.2 2.9 0 0 20 1.7
0.41
0.3
0.16
0.001
0.11 71 52 12 10 32 113 6 2 0 0 8.5 3.8 0 0
6 18.8 2 1.8
0.002
0.09 15 110 20 29 116 30 100 15 2 13.3 6 5.5 0 0 2 6 2 5 1 6.9 5.2 6.9 5.1 5.9
0.66
0.91
As to the purposes of the PCR test, two physicians had the test because they were highly suspect 1965
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
for pulmonary TB, another two physicians as a means of differentiating MTB from nontuberculous mycobacterium (NTM) after their AFB smear tests were found to be positive, and the remaining two physicians as a means of reconfirming TB after their TB cultures were found to be positive. Of the nurses who had a PCR test, one was highly suspected of having pulmonary TB, and the other nurse of having extra-pulmonary TB. Table 3 summarizes the results of the multiple logistic regression analysis. Because of the limited number of PCR users, some subgroups in several variables were merged. Accordingly, marital status was re-grouped into history of marriage (i.e., married, divorce and widowed) or not, medical institutions were re-classified into medical center or not, and findings of CXR were re-grouped into normal or aberrant (with or without cavitation). After controlling for patient characteristics (age, sex, education, and history of marriage), accreditation level of medical institutions, and clinical manifestations (presence of cough of more or less than one week, findings of CXR, AFB smear status, and site of infection), multiple logistic regression
analysis found that the odds of the use of PCR test was 17.4 times higher (95% CI: 1.5–206.1) among physicians with TB than among other HCWs with TB. PCR utilization was statistically significantly higher among physicians (P=0.02). Also, presence of cough persisting more than one week increased PCR utilization significantly (OR=19.5; 95% CI: 1.1–334.3). Cases working at medical centers seemed to have a PCR test more often than those working at other medical institutions, albeit not statistically significantly (P=0.21). Moreover, the above results were held when variables were categorized in different ways. For example, by categorizing education level into another two groups (≥university degree and <university degree), multiple logistic regression analysis found that factors that were significantly associated with PCR utilization included physicians (OR=13.7, 95% CI: 1.1–164.8), and presence of cough persisting more than one week (OR=20.3, 95% CI: 1.3–327.9) (data not shown).
Table 2. Characteristics of HCWs with TB receiving a PCR test in Taipei, Taiwan, 2003–2008
Age/Sex 66/M 45/M 34/M 45/F 30/M Occupation/Hospital served Physician/Medical center Physician/Medical center Physician/Medical center Physician/Medical center Physician/Medical center Physician/Regional hospital Nurse/Regional hospital Nurse/Medical center Smear (date of Culture (date of PCR (date of test; result) test; result) test; result) 2006/4/18; – 2006/5/29; – 2003/3/24; + 2004/1/29; + 2004/12/23; – 2006/4/18; + 2006/5/29; + 2003/3/24; – 2004/1/29; + 2004/12/23; + 2006/4/19; + 2006/5/30; + 2003/3/25; + 2004/1/30; + 2005/1/27; + Purpose of PCR test Highly suspected of pulmonary TB Highly suspected of pulmonary TB Differentiating MTB from NTM Differentiating MTB from NTM Re-confirming TB diagnosis after positive TB culture was found Re-confirming TB diagnosis after positive TB culture was found Highly suspected of pulmonary TB Suspected of extrapulmonary TB
27/M 40/F 40/F
2008/8/21; – 2003/1016; – 2005/12/9; –
2008/8/21; + 2003/10/16; – 2005/12/9; –
2008/10/7; + 2003/10/17; – 2005/12/8; +
PCR, polymerase chain reaction; HCWs, healthcare workers; PTB, pulmonary tuberculosis; MTB, Mycobacterium tuberculosis; NTM, nontuberculous mycobacterium
1966
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 3. Multiple logistic regression analysis of factors influencing PCR utilization among HCWs with TB in Taipei, Taiwan, 2003–2008
Factor category Sex Female Male Age (years) < 60 ≥ 60 Education < Master level ≥ Master level History of marriage No Yes Physicians No Yes Medical centers No Yes Cough more than one week No Yes Findings of chest radiography Normal Aberrant Sputum smear status Negative Positive Site of infection Extra-pulmonary TB Pulmonary TB Odds 95% CI P value ratio 1 0.7 1 0.5 1 1.3 1 0.4
0.1-9.9
0.81
0.01-31.5
0.74
0.02-89.3
0.91
0.03-5.0
0.45
1 17.4 1.5-206.1 1 4.8
0.02
0.4-54.9
0.21
1 19.5 1.1-334.3
0.04
1 0.04 0.001-1.5 1 0.9 1 2.7
0.08
0.1-12.3
0.98
0.1-146.0
0.63
PCR, polymerase chain reaction; HCWs, healthcare workers; CI, confidence interval Discussion This study found that the PCR utilization for TB diagnosis was significantly higher among
physicians than among other HCWs with TB in Taipei, Taiwan, between 2003 and 2008. While a relatively high utilization rate of medical services among physicians has also been found in other studies (1-5), our study was different by conducting multiple logistic regression analysis to control for possible confounders. There are several possible explanations for the comparably high PCR utilization among physicians in this study. Firstly, compared with other HCWs, physicians have greater medical knowledge and this may help them seek medical treatment more readily. Consistent with this view, surgery utilization rates in one study were as high as or higher among physicians than among ministers, lawyers, or business executives (2). Another study also found that physicians are high users of preventive care because of their greater knowledge about preventive health practices (4). Medical knowledge may encourage physicians to be highly sensitive to their own bodily states and, hence, to use the medical services that could benefit them. Secondly, physicians can afford expensive medical services. Consistent with this view, medical utilization tends to be higher among individuals with higher income (16), with high income households tending to expect high-quality treatment and extra diagnosis procedures (17,18). This might suggest that because of their greater ability to pay, physicians may make greater use of advanced medical technologies regardless of high cost. Thirdly, physicians doctoring physicians is a special type of doctor-patient relationship (19). When caring for patients who are also physicians, treating physicians may provide extraordinarily careful services because of collegial sentiment. Also, such a patient may have better knowledge about which physicians can satisfy their needs for care. This study also found that the PCR utilization for TB diagnosis was significantly higher among HCWs with a cough persisting more than one week than among those without. In 2005, the United States Centers for Disease Control and Prevention (CDC) indicated that individuals with prolonged cough, fever, and weight loss should be highly suspected of having TB (9). In Kenya, the presence of cough of more than two weeks duration has been used as a screening tool for TB in an outpatient setting since 1979 (20). 1967
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Because PCR test is more widely and more inexpensively available at high-volume laboratories (11), the test might be more likely to be provided at large hospitals than at small ones. This study found that HCWs working at medical centers appeared to be more likely to have a PCR test for TB diagnosis than those at smaller medical institutions; this result, however, was not statistically significant. This might be because of limited observations in this study. Further research with larger numbers of subjects is needed. This study assessed whether or not the purposes of PCR test for TB diagnosis, as shown in Table 2, were compatible with updated guidelines. According to a 2009 CDC recommendation, TB culture remains the gold standard for laboratory confirmation of TB and PCR tests should be performed for all patients with a high clinical suspicion of TB infection, particularly in patients with a positive AFB smear (11). Also PCR tests could differentiate MTB from NTM, avoiding unnecessary treatment, isolation, and contact investigations for persons who are suspected of, but in fact do not have, TB (21). Moreover, PCR tests should be considered for diagnosing extrapulmonary TB because it has higher sensitivity than TB culture (22). Accordingly, except for the two physicians who used the PCR test after having tested positive in TB culture, the other six HCWs all had the test for TB diagnosis compatible with updated guidelines. The PCR test was clinically unnecessary in the two physicians. The population-based nature of the data in the present study is good for sample representation. More importantly, the tight regulation of TB notifying system in Taiwan—active pulmonary TB cases are required to report to local TB control departments within 24 h and other TB cases no later than 7 days—could help decrease interviewees’ recall bias greatly. Also, infection control nurses are required to review the charts of each case and trained case managers are required to re-check the information. Their collaborations result in the TB registry of Taipei City Government. This study had quite wide estimates of 95% CI in many variables, which might be because of the limited number of PCR users. However, physicians were significantly associated with the use of PCR test in this circumstance. Moreover, given 1968
that physicians are superior to adults in the general population in terms of their medical knowledge, understanding of the medical system and, often, their ability to pay for medical services, physicians may also have higher PCR utilization rates than general adults. However, further research is needed to empirically test this hypothesis. Further research is also needed to examine the utilization of other advanced medical technologies among physicians, other HCWs, and adults in the general population to better understand the behavior of highly medically informed patients. Evaluating the adequacy of utilizations is equally important. This study, together with others (23,24), raises important issues about the disparity in medical utilization, especially for out-of-pocket, advanced medical diagnostic technologies. Our study found that highly medically informed consumers such as physicians are more likely than less informed consumers such as other HCWs to use a PCR test for TB diagnosis paid for by patients themselves. This suggests the importance of promoting public awareness of advanced medical technology, especially those proven helpful for diagnosing highly infectious and costly diseases early. Moreover, financial barriers to this sort of services should be overcome to prevent economic disparities in their use. Conclusion PCR utilization for TB diagnosis was significantly higher among physicians than among other HCWs with TB in Taipei between 2003 and 2008. Physicians’ medical knowledge, greater ability to pay, or expertise in access to the medical system may account for this result. Acknowledgement The authors wish to thank Head Nurse YingHuei Shie for interviewing the subjects and reviewing their medical records. The authors are also grateful to Registered Nurse Cuei-Cyong Pan for assisting with data collection.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
References
1. Cockerham WC, Creditor MC, Creditor UK, Imrey PB. Minor ailments and illness behavior among physicians. Med Care. 1980; 18: 164-73. 2. Bunker JP, Brown BW, Jr. The physician-patient as an informed consumer of surgical services. N Engl J Med. 1974; 290: 1051-5. 3. Kahn KL, Goldberg RJ, DeCosimo D, Dalen JE. Health maintenance activities of physicians and nonphysicians. Arch Intern Med. 1988; 148: 2433-6. 4. Wachtel TJ, Wilcox VL, Moulton AW, Tammaro D, Stein MD. Physicians' utilization of health care. J Gen Intern Med. 1995; 10: 261-5. 5. Frank E, Brogan DJ, Mokdad AH, et al. Health-related behaviors of women physicians vs other women in the United States. Arch Intern Med. 1998; 158: 342-8. 6. Domenighetti G, Casabianca A, Gutzwiller F, Martinoli S. Revisiting the most informed consumer of surgical services. The physician-patient. Int J Technol Assess Health Care. 1993; 9: 505-13. 7. Chou YJ, Huang N, Lin IF, et al. Do physicians and their relatives have a decreased rate of cesarean section? A 4-year population-based study in Taiwan. Birth. 2006; 33: 195-202. 8. Hosoglu S, Tanrikulu AC, Dagli C, Akalin S. Tuberculosis among health care workers in a short working period. Am J Infect Control. 2005; 33: 23-6. 9. Jensen PA, Lambert LA, Iademarco MF, Ridzon R. Guidelines for preventing the transmission of Mycobacterium tuberculosis in health-care settings, 2005. MMWR Recomm Rep. 2005; 54: 1-141. 10. Guidelines for preventing the transmission of Mycobacterium tuberculosis in health-care facilities, 1994. Centers for Disease Control and Prevention. MMWR Recomm Rep. 1994; 43: 1-132. 11. Updated guidelines for the use of nucleic acid amplification tests in the diagnosis of tuberculosis. MMWR Morb Mortal Wkly Rep. 2009; 58: 7-10. 12. Rapid diagnostic tests for tuberculosis: what is the appropriate use? American Thoracic Society Workshop. Am J Respir Crit Care Med. 1997; 155: 1804-14. 13. Perry S, Catanzaro A. Use of clinical risk assessments in evaluation of nucleic acid amplification tests for HIV/tuberculosis. Int J Tuberc Lung Dis. 2000; 4(2 Suppl 1): S34-40. 14. Moore DF, Guzman JA, Mikhail LT. Reduction in turnaround time for laboratory diagnosis of pulmonary tuberculosis by routine use of a nucleic acid amplification test. Diagn Microbiol Infect Dis. 2005; 52: 247-54.
15. Taegtmeyer M, Beeching NJ, Scott J, et al. The clinical impact of nucleic acid amplification tests on the diagnosis and management of tuberculosis in a British hospital. Thorax. 2008; 63: 317-21. 16. Weinick RM, Byron SC, Bierman AS. Who can't pay for health care? J Gen Intern Med. 2005; 20: 504-9. 17. Younis MZ, Rivers PA, Fottler MD. The impact of HMO and hospital competition on hospital costs. J Health Care Finance. 2005; 31: 60-74. 18. Shen YC, Melnick G. The effects of HMO ownership on hospital costs and revenues: is there a difference between for-profit and nonprofit plans? Inquiry. 2004; 41: 255-67. 19. Schneck SA. "Doctoring" doctors and their families. JAMA. 1998; 280: 2039-42. 20. Aluoch JA, Swai OB, Edwards EA, et al. Study of case-finding for pulmonary tuberculosis in outpatients complaining of a chronic cough at a district hospital in Kenya. Am Rev Respir Dis. 1984; 129: 915-20. 21. Dinnes J, Deeks J, Kunst H, et al. A systematic review of rapid diagnostic tests for the detection of tuberculosis infection. Health Technol Assess. 2007; 11: 1-196. 22. Cheng VC, Yam WC, Hung IF, et al. Clinical evaluation of the polymerase chain reaction for the rapid diagnosis of tuberculosis. J Clin Pathol. 2004; 57: 281-5. 23. Brown CP, Ross L, Lopez I, Thornton A, Kiros GE. Disparities in the receipt of cardiac revascularization procedures between blacks and whites: an analysis of secular trends. Ethn Dis. 2008; 18(2 Suppl 2): S2-112-7. 24. Harris B, Hwang U, Lee WS, Richardson LD. Disparities in use of computed tomography for patients presenting with headache. Am J Emerg Med. 2009;27:333-6. Corresponding author Chung-Yeh Deng, Institute of Hospital and Health Care Administration, National Yang-Ming University, Taipei, Taiwan, E-mail: cydeng@ym.edu.tw
Journal of Society for development in new net environment in B&H
1969
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Study of antibiotic resistant H. pylori isolated from Iranian patients during 2009-2010
Sara Sayadi1, Mojtaba Darboue1, Hosein Dabiri2, Leila Shokrzadeh2, Tabasom Mirzaee2, Masoud Alebouyeh2, Dariush Mirsatari2, Homayoun Zojaji2, Ehsan Nazemalhoseini2, Mohammad Reza Zali2
1 2
Islamic Azad university, Science and research branch, Department of microbiology, Fars, Iran, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of medical science, Tehran, Iran.
Abstract Helicobacter pylori is considered as an important cause of human gastric and extra-gastric diseases especially in developing countries. Triple therapy; a proton pump inhibitor, metronidazole and amoxicillin, or clarithromycin are used worldwide for infection treatment. By adventing antibiotic resistant strains, the treatment has become complicated. The aim of current study is to fallow Helicobacter pylori antibiotic susceptibility trend to major antiobiotics during 2009-2010. Gastric biopsies from patients with dyspepsia were cultured on H. pylori specific media with microareophilic condition. All recovered strains were confirmed as H. pylori by catalase, urease and oxidase tests, PCR for glmM gene was used for molecular confirmation. Antibiotic susceptibility testing for clarithromycin, tetracycline, amoxicillin, metronidazole and ciprofloxacin were performed according to CLSI guidelines for H. pylori by agar dilution method. Resistant to metronidazole, amoxicillin, ciprofloxacin, clarithromycin and tetracycline were 24(60%), 4(10%), 11(27%), 7(17%) and 2(5%) respectively. H. pylori resistance to nearly all of the studied antibiotics have been increased in compare to previous study. Significant increase in resistance to metronidazole was the highlighted and concerning phenomena in current study, but it is still lower than some Asian countries. Regard to increasing resistant trend in H. pylori as an Iranian main health problem, it is needed to find appropriate alternative of antibiotics agents and the way of antibiotics administration. 1970
Key words: Helicobacter pylori, Antibiotic resistance, treatment Introduction Helicobacter pylori (H. pylori) is a common human pathogen, which have been infected nearly half of the world’s population and 90% of Iranian peoples (1). H. pylori is considered as a major cause of peptic ulcer disease, chronic gastritis, gastric mucosa associated lymphoid tissue lymphoma , atrophic gastritis, gastric adenocarcinoma (2). Also, there is a relationship between H. pylori and several extra gastrointestinal diseases, such as intractable iron deficiency anemia and idiopathic thrombocytopenic purpura(2). Respect to serious disease which is caused by H. pylori, Antimicrobial treatment is too necessary for eradication of H. pylori and decreasing the patients' symptoms (3). Also antibiotic treatment is highly recommended to asymptomatic first-degree relatives of cancer patients (3). Triple therapy consisting of a proton pump inhibitor (PPI) and antibiotics; metronidazole with amoxicillin or clarithromycin is the most common eradication regimen for H. pylori (2), however there are some reports regarding usefulness of first line treatment in Iran. Some guidelines recommend that eradication rates of 59–95% can be obtained by using bismuthbased quadruple therapy for 7–10 days (4). However regimens should only be recommended when the local prevalence of resistant to interested antibiotics is lower than certain level (5). It seems that resistance of H. pylori to antibiotics
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
is the main reason for the treatment failure of H. pylori-associated diseases (6). Moreover due to the high prevalence of H. pylori infection in Iran (1) as a developing country and increased resistance to antibiotics, it seems necessary to determine the resistance pattern of H. pylori strains against different antibiotics. In current study we aimed to analyze antibiotic susceptibility pattern of H. pylori isolates taken from Iranian dyspepsia patients to very common antibiotics; amoxicillin, clarithromycin, metronidazole, ciprofloxacin, and tetracycline generally prescribed in our patients to follow ineffectiveness of these antibiotics among them. Materials and methods Population study The study group consisted of 40 isolates from patients with dyspepsia undergoing endoscopy in Taleghani Hospitalin Tehran, Iran during 20092010. None of the patients had received non-steroidal anti-inflammatory drugs or antibiotics within the previous three months. Biopsies from antral region were kept in transport medium consisting of thioglycolate with 1.3 g/l Agar (Merck Co, Homburg, Germany) with 3% yeast extract (Oxoid Ltd., Basingstoke, UK) and brought to the laboratory within three hours after endoscopy and then followed by culture and direct polymerase chain reaction (PCR) on tissue samples. Isolation and identification For each patient two specimens were taken from greater curve of antrum, one for culture and other for histological studies. Gastric biopsy were transported and cultured on Brucella agar (Merck, Homburg, Germany) supplemented with 10% (v/v) horse blood, 10% Fetal Calf Serum(FCS), Amphotricin B(5 μg/l) [Sigma-Aldrich,USA] and campylobacter selective supplement consisting of vancomycin 2.0 mg, polymyxin 0.05 mg, trimethoprim 1.0 mg (Merck, Homburg, Germany). The cultured plates were incubated at 37°C for at least three-five days in a microaerophiliic atmosphere (5% O2,
10% CO2, 85% N2) in a CO2 incubator (InnovaCo 170; USA). Negative cultures had been kept in incubator for 2 weeks. H. pylori strains were identified by Gram staining, colony morphology, and positive oxidase, catalase and urease reactions. DNA extraction and PCR amplification analysis The harvested bacteria were used for DNA extraction. Genomic DNA was extracted by QIAamp tissue DNA extraction kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. Further identification of H. pylori colonies, was done by PCR for glmM (ureC) gene using specific primer pairs; forward 5′ GGATAAGCTTTTAGGGGTGTTAGGGG3′and reverse 5′ GCTTACTTTCTAACACTAACGCGC-3′ which amplify 296-bp fragment (7). The PCR was performed in a final volume of 25 μl containing 10 X PCR buffer, 500 nM of each primer, 2 mM MgCl2; 200 μM each deoxyribonucleotide triphosphate (dNTP), 1.5 U Taq DNA polymerase, and 200 ng DNA sample. It was performed in a thermocycler (AG 22331; Eppendorf, Hamburg, Germany) under the following conditions: initial denaturation for 5 min at 94°C was followed by 30 cycles of 93°C for 1 min, 58°C for 30 s and 72°C for 1 min. After a final extension at 72°C for 10 min, electrophoresis on 1.2% agarose contained gels confirmed the 296 bp PCR product according to standard procedures. Individual cultures representing colonies from each patient was frozen at -70 ºC in Brain Heart Infusion Broth (Merck Co, Germany),15% Glycerol(Merck Co, Germany), 20% Fetal Calf Serum until the antibiotic susceptibility testing. Antibiotic susceptibility testing The minimum inhibitory concentration (MICs) was carried out by agar dilution method (7) according to CLSI protocols for the H. pylori isolates. Muller-Hinton Agar (Merck Co, Germany) containing 7% defibrinated sheep blood was used as media. The stock solutions of each drug including clarithromycin (Tehran Shimi, Iran), ciprofloxa1971
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
cin, amoxicillin, tetracycline and metronidazole (MAST, London, United Kingdom) were prepared in accordance with manufacturer’s instructions and kept in aliquots at –20°C. From these stock solutions, working solutions were made in distilled water to be incorporated into the Muller Hinton Agar(MHA) media. Media with different concentrations of each antibiotic were prepared by adding defined amount of each antibiotic to MHA media, when MHA temperature cooled to nearly 45°C after autoclave. The range of MIC was from 0.06 to 8 µg/ml for clarithromycin, from 0.06 to 2 µg/ml for tetracycline, amoxicillin and ciprofloxacin and from 0.06 to 64 µg/ml for metronidazole (7). The bacterial suspension which were equivalent to a no. 3 McFarland standard prepared and 5 µl of them were inoculated on Muller-Hinton Agar plates containing different concentrations of each antibiotic together with control plate without antibiotics. The MIC of each antibiotic was determined after 72 h of incubation (7). The resistance breakpoints for amoxicillin, metronidazole ciprofloxacin, tetracycline and clarithromycin, were defined as ≥ 0.5, ≥8, > 1, ≥ 4, and ≥.0.5 µg/ml, respectively ( 7). Data analysis Chi squared and Fisher’s exact tests were used for analysis of categorical data. Analyses were done using Sigma Stat for Windows V2.03 (SPSS, Chicago, IL, USA). A P value less than 0.05 was considered statically significant. Results Here we examined a population (n = 40) of Iranian H. pylori strains isolated from Taleghani hospital in Tehran (among 2009 – 2010).
According to CLSI guideline agar dilution method is the best choice for antimicrobial susceptibility testing of H. pylori (8,9). Resistance against Tetracycline, Amoxicillin, Ciprofloxacin, Metronidazole and Clarithromycin were assayed accordingly. All 40 H. pylori strains with criterion as Gram negative, helix-shaped, oxidase, catalase and urease positive phenotype and glmM positive reaction in PCR were selected for antibiotic susceptibility test. The isolates were from patients with clinical complications included 31(77%) patients with gastritis, 6(15%) with duodenal ulcer, one (2%) with gastric ulcer and 2(5%) with gastric cancer. The rate of antibiotic resistance in current study were as follows: metronidazole 24 (60%), ciprofloxacin 11(27%), clarithromycin 7 (17%) ,amoxicillin 4 (10%) and tetracyclinen2 (5%).14(35%) and 26(65%) of the isolates were recovered from male(mean age 56) and female(mean age 46) patients, respectively. Multi Drug Resistant (MDR) phenotype with combined resistance against four antibiotics was seen in two isolates. Among 24 metronidazole-resistant strains (60%), 13(32%) of the isolates were monodrug resistant and 12 strains (50%) were multi drug resistant, however mono drug resistance phenotype was not detected in other tested antibiotics. 4 (10%) of the isolates were double resistant for metronidazole and clarithromycin, and only one isolate (2%) was triple resistant for metronidazole, clarithromycin and amoxicillin. In our study there was not any significant relation between antibiotic resistance and sex, age and patients outcomes. Antibiotic resistance rates and MIC50 and MIC90 are shown in table1.
Table 1. H. pylori resistant rates to antibiotics in 2009-2010 and the MIC50 and MIC90
Antibiotic Amoxicillin Clarithromycin Metronidazole Tetracycline Ciprofloxacin Resistance (%)2009MIC 50 2010 (µg/ml)2009-2010 10 17 60 5 27 0.12 0.25 32 0.25 1 MIC 90 (µg /ml) 2009-2010 0.5 8 32 4 8 MIC range (µg /ml) 0.12 to 8 0.12 to 4 0.125 to > 32 0.12 to 8 0.12 to 8
1972
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Discussion H. pylori as a major human pathogen is considered worldwide, specially for its antibiotic resistance which is a serious problem in curing the infected patients (10). It has been reported that prevalence of H. pylori in developing countries such as Iran is higher than developed countries (10,11). Because of high frequency of treatment failure of H. pylori infection in Iranian dyspepsia patients (1), it is needed to determine the antibiotic resistance pattern and its trends, although there are some difficulties in growing the bacteria, due to the slow rate of growth in the culture medium (12). On the other hand the study of antibiotic susceptibility trend is necessary to an efficient resistance prevention policy. Our result showed that the resistance to metronidazole have been raised to 60%. The increasing trend of metronidazole- resistant H. pylori isolates has been reported from Europe; which varied in pediatric patients between 16% and 43% and in adult patients between 14.9% and 40.3% during the years 1989-2001 and 1990-2002, respectively(13). However there are numerous studies, which have been showed the steady pattern for metronidazole susceptibility during years; in Shanghai it has been showed the resistance rate of H. pylori to metronidazole remained in steady state (40%-50%) from 2000-2009(6). The possible reason could be different usage of metronidazole in various parts. Metro-
nidazole resistance in Iran is still lower than India (90%), Saudi Arabia (78.5%), Australia (59.1%), united Arab Emirates (62.5%) and Bahrain (57%) and also is lower than reported previous in Iran, but higher than another study in Iran(14). H. pylori antibiotic resistance rates in different countries during different periods of time are shown in table2. On the other hand metronidazole resistance rates might not be equal in different parts of a country. In India the resistance rate in Lucknow, Chennai and Hyderabad, for example was 68%, 88.2% and 100%, respectively, whereas in Delhi (37.5%) and Chandigarh it was 38.2% (15). Similarly, the resistance rate was high (44%) in south of Iran, while it was illustrated 78% in Tehran(14,5). The major reason for this differences might varies from one region to other, but the principle reasons could be testing conditions; kind of medium, age of the bacterial colonies, incubation time and microaerophilic conditions and amount of inoculum (6). The increased resistance might be related to its frequency usage in protozoal, genital and dental infections (16) and also H pylori genetic drift and adaptation to different environment might be effective on metronidazole resistance (17). Considering above, antibiotic regimen which contains metronidazole can be more efficient if its dosage increased, time of consumption prolonged and bismuth salts added (6). Ciprofloxacin is an effective antibiotic against Gram negative organisms; Pseudomonas aeruginosa, Acinetobacter, Campylobacter, HaemophiPercentage of resistance to Metroni- Clarithro- Tetracyc- Amoxi- Ciprodazole mycin line cillin floxacin 55.6 7.3 38.1 7.3 40-50 8-20 1 0 41 20 0 0 27 20 30 16 0 1 4 16 18 2 0 6 29 4 4 0 37 2 0 0 1 73 30 9 6 44 5 20 3 80 4 1 3 40 14 4 2 2 41 41 3 3 45
Table 2. Resistance rates of antibiotics in different countries
Country/region Iran (27) Shanghai (34) China(14) Bulgaria (18) Taiwan, (3 ) Bulgaria (16) Lebanon (14) Malaysia (29) Iran/Mazandaran (30) Iran/Shiraz (5) Saudi (14) Iran (7) Turkey(11) year 2005-2008 2000-2009 2010 2007-2009 1998–2007 2005-2007 2001 2004-2007 2007-2010 2008-2009 2002 2007-2008 2009 Number of isolates 110 293 166 501 330 75 44 187 132 121 223 42 31
Journal of Society for development in new net environment in B&H
1973
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
lus, Salmonella, and Shigella species(18) It has been reported that it is used in treatment of the skin, lungs, airways, bones, and joints infections, also it is effective on urinary tract infections caused by E. coli and infectious diarrheas caused by E. coli, Campylobacter jejuni, and Shigella bacteria. Here we report second low effective antibiotic, ciprofloxacin, with resistance rate27%. It is higher than (2%) which has been reported in Iran previously (15), but Most studies reported low prevalence (1%) of ciprofloxacin resistance; Bulgaria and India with prevalence rates of 8.6% and 12%, respectively, but Ciprofloxacin resistance rate reported 11.2% in 2003, 16.6% in 2004, and finally increased to 22.1% in 2005 in Germany and a high rate (33.8%) has been reported for H. pylori infected adult patients in South Korea (16). The mechanism of ciprofloxacin action as a fluoroquinolone is inhibiting topoisomerase and DNA gyrase, and interfering with replication of bacterial DNA (18). Topoisomerase gene is not detected in H. pylori genome (18) therefore the main cause of ciprofloxacin resistance is DNA gyrase A gene mutation. For this reason increasing in resistant strains in this study may caused by increasing in mutant strains which can be determined. Although clarithromycin resistance rate to H. pylori in developing countries (25% to 50%) is higher than developed countries (10%)(13,19), in our experience it was 17%. In previous studies from Iran (Tehran) a high rate of resistance to clarithromycin have been reported ranging from 16.7% to 21%(14,20), Similarly in Shanghai an increasing trend in resistant rates to clarithromycin (8.6%, 9.0% and 20.7%) from 2000 to 2009 has been reported(21). Also in Bulgaria from 1990 to 1995, clarithromycin resistance increased significantly, but it is less rapidly (3.1-fold) than in South Korea (4.9-fold over 10 years) and Japan (1.5-fold over 2 years), while it is stable in United Kingdom and Netherlands (22). H. pylori resistance to clarithromycin differs among countries, in Japan 12%, Europe, 1.7%23.4% and in North America it is reported between 10.6%-25%(23,24). Emerging clarithromycin resistance may due to its usage in respiratory infections in Iran same as other countries (21). As a mater of fact, there is cross-reaction between clarithromycin and other macrolides ; erythromycin. So, resistance to one of them may result in another resistance (25). 1974
According to this study betalactam resistance was 10%. Although this result is different with previous study in Iran which was 26%(14). In most studies it has shown that H. pylori resistance to amoxicillin is either very rare or non-existent (5). In the United States, Canada, and Italy amoxicillin resistance was not important until recent years (26) also in Europe rare resistance to amoxicillin was detected (7). Additionally it reported 18.5% in South Korea, 19.4% in Indonesia, 32.8% in India, and 38% in Brasilia (5). In Ile-Ife, southwest of Nigeria, 100% of the 32 isolates were resistant (5). This high resistance to amoxicillin may be related to unreasonable use of this antibiotic in Iran. Besides this results it was observed the increased resistance for amoxicillin in Shigella spp., Salmonella spp., and Campylobacter spp. Isolates in Iran (27). In a previous study in south of Iran amoxicillin resistance reported 20% (5). It should be considered that differences in rates (for amoxicillin from 1.6% to 27% in Iran (14,20)may due to inter laboratory qualifications because of different testing protocols or regional prescribing pattern. This phenomenon might exist for other antibiotics, too (5). Additionally colonization of other bacteria which are β-lactam-resistant in the stomach might be result in amoxicillin resistant H. pylori strains by transformation or a conjugation-like mechanism (7). About tetracycline susceptibility, the resistance rate was 5% during 2009-10. Our result (5%) was similar to Shiraz where 3% were reported (5). The resistance rates to tetracycline has been reported variously from 14% in Italy and 11% in Nigeria(7,28). Considering low resistant rates; Tetracycline which is more cost effective has been used for H. pylori eradication when failure treatment with first line antibiotics (amoxicillin + clarithromycin/amoxicillin + metronidazole) is observed (3). In conclusion determination of antibiotic resistance by antimicrobial susceptibility testing before prescribing the antibiotics has some advantages; increase treatment of patients, decrease of antibiotic resistance and cost effectiveness, but it has its own limitations; for large scale it is time consuming and culture of H. pylori is hard and expensive. Considering the dramatic increase in some antibiotic resistance rates, sequential therapy is a new way which can be replaced with traditional ones for treatment of H pylori infection.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Moreover, Garenoxacin reported as an antibiotic choice for primary ciprofloxacin- or levofloxacin resistant H. pylori strains which can be tested in future studies. Also it is suggested that antibiotic prescription and it’s offer in drug stores in Iran should be revised. Acknowledgment This study was supported by a grant from Research Institute for Gastroenterology and Liver Diseases (RIGLD), Shahid Beheshti University of medical science, Taleghani Hospital, Tehran, Iran. References
1. Mohammad Minakari, Amir Hosein Davarpanah Jazi, Ahmad Shavakhi(2010) A Randomized Controlled Trial: Efficacy and Safety of Azithromycin, Ofloxacin, Bismuth, and Omeprazole Compared With Amoxicillin, Clarithromycin, Bismuth, and Omeprazole as Second-Line Therapy in Patients With Helicobacter pylori Infection. Helicobacter 15: 154–159. 2. Qing ZHENG, Wan Jun CHEN, Hong LU(2010) Comparison of the efficacy of triple versus quadruple therapy on the eradication of Helicobacter pylori and antibiotic resistance. Journal of Digestive Diseases 11; 313–318. 3. Farideh Siavoshi, Parastoo Saniee, Saeid Lati_Navid (2010) Increase in Resistance Rates of H. pylori Isolates to Metronidazole and TetracyclineComparison of Three 3-Year Studies Archives of Iranian Medicine13 (177-187). 4. Chan FK, Sung JJ, Suen R(2000) Salvage therapies after failure of Helicobacter pylori eradication with ranitidine bismuth citrate-based therapies. Aliment Pharmacol Ther;14(1):91–5. 5. Shohreh Farshad, Abdolvahab Alborzi, Aziz Japoni,(2010). Antimicrobial usceptibility of Helicobacter pylori strains isolated from patients in Shiraz, Southern Iran World J Gastroenterol. 2010 December 7; 16(45): 5746–5751. 6. Qin-Juan Sun, Xiao Liang, Qing Zheng, (2010) Resistance of Helicobacter pylori to antibiotics from 2000 to 2009 in Shanghai. World J Gastroenterol 16(40): 5118-5121
7. Leila Shokrzadeh1, Fereshteh Jafari1, Hossein Dabiri1(2010) Antibiotic Susceptibility Profile of Helicobacter pylori isolated from the Dyspepsia Patients in Tehran, Iran. Saudian journal of gasteroenterology 8. Osato MS, Reddy R, Reddy SG, (2001) Comparison of the E test and the NCCLS approved agar dilution method to detect metronidazole and clarithromycin resistant Helicobacter pylori. Int J Antimicrob Agents 17:39-44. 9. Sherif M, Mohran Z, Fathy H, (2004) Universal high-level primary metronidazole resistance in Helicobacter pylori isolated from children in Egypt. J Clin Microbiol 42 Suppl 10:4832-34. 10. Alarcon T, Domingo D, Lopez-Brea M.(1999) Antibiotic resistance problems with Helicobacter pylori. Int JAntimicrob Agents; 12:19-26. 11. Bakir Ozbey S, Ozakin C, Keskin M.(2009) Antibiotic resistance rates of Helicobacter pylori isolates and the comparison of E-test and fluorescent in situ hybridization methods for the detection of clarithromycin resistant strains.Mikrobiyol Bul. Apr;43(2):227-34. 12. Maryam Razaghi, Seyyed Mehdi Boutorabi, Ali Mirjalili, Shirin Norolahi, Masoumeh Hashemi, Mehrdad Jalalian,(2010)diagnosis of helicobacter pylori infection by ELIsA stool antigen 13. and comparison with the other diagnostic methods. HealthMED - Volume 4 /Number 3. 14. Mégraud F. (2004) H pylori antibiotic resistance: prevalence, importance, and advances in testing. Gut.;53:1374–1384. 15. Ala I. Sharara a, Marwan Chedid a, George F. (2002) Prevalence of Helicobacter pylori resistance to metronidazole, clarithromycin, amoxycillin and tetracycline in Lebanon. International Journal of Antimicrobial Agents 19 : 155–158 16. Thyagarajan SP, Ray P, Das BK, (2003) Geographical difference in antimicrobial resistance pattern of Helicobacter pylori clinical isolates from Indian patients: Multicentric study. J Gastroenterol Hepatol 18:1373-8. 17. Reza Khashei, Hasan Shojaei, Peyman Adibi, (2008) Genetic Diversity and Drug Resistance of Helicobacter pylori Strains in Isfahan, Iran. Iranian journal of basic medical sciences.vol.11, no.3
Journal of Society for development in new net environment in B&H
1975
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
18. Sisson G, Jeong JY, Goodwin A, (2000) Metronidazole activation is mutagenic and causes DNA fragmentation in Helicobacter pylori and in Escherichia coli containing a cloned H. pylori RdxA(+) (Nitroreductase) gene. J Bacteriol 182:5091-6. 19. J.-C. Yang , P.-I. Lee, P.-R. Hsueh(2010) In vitro activity of nemonoxacin, tigecycline,and other antimicrobial agents against Helicobacter pylori isolates in Taiwan, 1998–2007 Eur J Clin Microbiol Infect Dis 29:1369–1375 20. Yilmaz O, Demiray E.(2007) Clinical role and importance of fluorescence in situ hybridization method in diagnosis ofHelicobacter pylori infection and determination of clarithromycin resistance in H. pylori eradication therapy. World J Gastroenterol 13:671-675. 21. Mohammadi M, Doroud D, Mohajerani N,(2005) Helicobacter pylori antibiotic resistance in Iran. World J Gastroenterol. 11:6009–6013. 22. Lyudmila Boyanovaa, Rossen Nikolovb, Galina Gergovaa, (2010) Two- decade trends in primary Helicobacter pylori resistance to antibiotics in Bulgaria Diagnostic Microbiology and Infectious Disease 67 319–326 23. De Francesco V, Margiotta M, Zullo A (2007) Prevalence of primary clarithromycin resistance in Helicobacterpylori strains over a 15 year period in Italy. J Antimicrob Chemother 59:783–785. 24. Teare L, Peters T, Saverymuttu S,(1999) Antibiotic resistance in Helicobacter pylori.Lancet. 353:242. 25. Farideh Siavoshi, Parastoo Saniee, Saeid Lati_Navid (2010) Increase in Resistance Rates of H. pylori Isolates to Metronidazole and TetracyclineComparison of Three 3-Year Studies Archives of Iranian Medicine13 (177-187). 26. Versalovic J, Shortridge D, Kibler K, (1996) Mutations in 23S rRNA are associated with clarithromycin resistance in Helicobacter pylori.Antimicrob Agents Chemother. 40:477–480. 27. Nahar S, Mukhopadhyay AK, Khan R,(2004)Antimicrobial susceptibility of Helicobacter pylori strains isolated in Bangladesh. J Clin Microbiol 42:4856–8. 28. Falsafi T, Abdi-Ali E, Mobasheri F(2001) Drug resistance to Shigella spp., Salmonella spp., and Campylobacter spp., in pediatric infections. Iranian J Pediatr;11:20–8.
29. Realdi G, Dore MP, Piana A, et al(1999) Pretreatment antibioticresistance in Helicobacter pylori infection: results of three randomized controlled studies. Helicobacter 4(2):106–12. 30. Ahmad N, Zakaria WR, Mohamed R(2011) Analysis of antibiotic susceptibility patterns of Helicobacter pylori isolates from Malaysia. Helicobacter 11(1)47-56. 31. Talebi Bezmin, Abadi A, Mobarez AM, (2010) Antibiotic resistance of Helicobacter pylori in Mazandaran, North of Iran. Helicobacter15:505-509. Corresponding author Sara Sayadi, Department of microbiology, Islamic Azad university, Science and research branch, Fars, Iran, E-mail: sara_sayyady@yahoo.com
1976
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Clinical prediction of pediatric dengue virus infection in Taiwan-a Rasch scaling approach
Wen-Pin Lai1, Tsair-Wei Chien2,3, Hung-Jung Lin1,4, Wei-Chih Kan5,6, Shih-Bin Su7,8
1 2 3 4 5 6
7 8
Department of Emergency Medicine, Chi-Mei Medical Center, Taiwan Department of Hospital and Health Care Administration, Chia-Nan University of Pharmacy and Science, Tainan, Taiwan Department of Administration, Chi-Mei Medical Center, Taiwan Department of Biotechnology, Southern Taiwan University, Taiwan Division of Nephrology, Department of Medicine; Chi-Mei Medical Center, Tainan, Taiwan Department of Medical Laboratory Science and Biotechnology, Chung Hwa University of Medical Technology, Tainan, Taiwan Department of Biotechnology, Southern Taiwan University, Tainan, Taiwan Department of Family Medicine, Chi-Mei Medical Center, Tainan, Taiwan
Abstract Dengue fever (DF) often presents as an acute febrile illness of unclear origin. We developed a simple method that uses existing patient data to identify DF. We used Rasch analysis to evaluate 21 features (7 laboratory and 14 clinical features) to predict DF. Features inconsistent with the Rasch model were removed. Parallel analysis (PA) was used to determine the number of factors. We found seven items that allow early detection of pediatric DF (PA 95% CI = 1.49, 2nd Eigenvalue = 1.2; 1st and 2nd Eigenvalues of standardized residual = 1.6; AUC = 0.917; sensitivity = 95.65). The DF cut-off point for those seven items was set at ³ 3.0. Simple laboratory data—biphasic fever, skin rash, WBC counts, platelet counts, AST, ALT, and CRP— help with early detection of pediatric DF. Data derived from measuring these features may optimize clinical decision making when discriminating DF from other febrile illnesses. Key words: Dengue fever; Parallel analysis; Rasch analysis; Receiver operating characteristic (ROC) curve; White blood cells; Platelets
1. Introduction Dengue virus (DV) infection is one of the most common mosquito borne viral diseases of humans worldwide1. It causes a spectrum of illness from mild dengue fever (DF) to both severe dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS) 2,3. The global prevalence of DF has increased in Southeast Asia, Africa, the Western Pacific region, and the Americas 4,5 in the past thirty years. An estimated 2.5 billion people in more than 100 countries are at risk of being infected with DV; more than 50 million new infections are reported annually, and 250,000-500,000 cases of DHF cause over 20,000 deaths, mainly children, every year5,6. The challenge faced by primary care physicians, especially those who work in hospital emergency departments, is to achieve a rapid, effective, and accurate diagnostic screening for DF. However, the initial symptoms of DF such as fever, headache, and myalgia are nonspecific and similar to those of other viral illnesses7-10. Some studies 7,8 using the univariate approach (e.g., t-tests and analysis of variance (ANOVA)) report that the presumptive diagnosis of DF is so imprecise because the signs and symptoms are not useful for detecting DF. Another study using multivariable regression analysis attempted to distinguish pa1977
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
tients with dengue from those with other febrile illnesses, but neither had high statistical validity nor had any change in clinical features over the course of illness10. We thus were interested in using the well-developed measurement method of Rasch analysis 11 combined with parallel analysis (PA) 12 to construct a valid and reliable scale using existing data for early detection of DF in children. Because PA is one of the methods most recommended to deal with the number-of-factors-to-retain problem13-15, others support the notion that using the Rasch model may yield misleading results if there are two dimensions in which the items are interlaced in difficulty and that, therefore, it is better to use factor analysis combined with parallel analysis (or exploratory factor analysis) to determine the number of factors (i.e., latent trains) 16,17. 2. Methods 2.1 Population The retrospective study data used in this study were from the medical records of pediatric (£ 16 years old) patients with febrile illnesses clinically suspected to be DF who visited the emergency department of a medical center for treatment in southern Taiwan between January and December 2007. A total of 177 pediatric patients were identified. Blood was collected and routine tests for levels of white blood cells (WBC), platelets, aspartate aminotransferase (AST), alanine aminotransferase (ALT), and C-reactive protein (CRP) were done for all patients. Serological confirmation of DF was then obtained using a commercial
Personal Gender Age group (years) Data Female Male 0-4 5-9 9-16 n 47 61 48 24 36 DF-
test (Dengue Duo IgM Rapid Strips; Pan Bio, Australia) 18,19, which are effective for detecting dengue-specific antibodies. Patients with a positive strip test were categorized as DF+ with a negative strip test as DF- (Table 1). 2.2 Data collection for input into the development of a scale To construct a scale to screen for DV infection, we selected 21 items capturing clinical, historical, and laboratory features from our study population. These data were obtained from the patients’ medical records, and included a history of clinical infection consistent with DF; a family history of recent dengue infection; a history of mosquito bites during the 2 weeks before visiting the emergency department; a high fever (≥ 39°C), a biphasic fever; a rash, petechiae; retro-orbital pain, joint pain (arthralgia), headache, myalgia, and abdominal pain; anorexia; WBC and platelet counts; AST, ALT, and CRP levels; occult hematuria, stool occult blood; a cough, sore throat, and soft (watery) stool; and flushed skin. The thresholds of these items (Tables 2 and 3) were based on the patient’s responses for symptom features and on clinical guidelines for laboratory features. 2.3 Developing a single construct to measure DF tendency WBC and platelet counts were scored using a 0-2 polytomous scale, on which a higher number indicated that DF was potentially present, and the counts were combined with other dichotomoDF+ Total % 42 58 16.2 29.4 54.4 n 76 101 59 44 73 % 42.9 57.1 33.5 25 41.5
Table 1. Demographic characteristics of the patients suspected with dengue virus infection
% 43.5 56.5 44.4 22.2 33.3 n 29 40 11 20 37 P 0.845 0.005
DF+: patients with a positive dengue fever strip test DF-: patients with a negative dengue fever strip test P-values were determined using the χ2 test
1978
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 2. Clinical and historical characteristics for patients studied
Score Family history High fever of 39°C Biphasic fever Skin rash Petechiae Retrobublar pain Bone pain Abdominal pain Anorexia Soft (watery) stool Headache Myalgia Cough Sore throat 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 Description Absent Present Absent Present Absent Present Absent Present Absent Present Absent Present Absent Present Absent Present Absent Present Absent Present Absent Present Absent Present Absent Present Absent Present n 81 27 87 21 108 0 82 26 106 2 104 4 106 2 104 4 92 16 97 11 92 16 89 19 64 44 97 11 DF% 75 25 80.6 19.0 100 0 75.9 24.1 98.1 1.9 96.3 3.7 98.1 1.9 96.3 3.7 85.2 14.8 89.8 10.2 85.2 14.8 82.4 17.6 59.3 40.7 89.8 10.2 n 40 29 37 32 58 11 20 49 60 9 61 8 63 6 53 16 46 23 56 13 59 10 57 12 45 23 63 6 DF+ % 58 42 53.6 46.4 84.1 15.9 29 71 87 13 88.4 11.6 91.3 8.7 76.8 23.2 66.7 33.3 81.2 18.8 85.5 14.5 82.6 17.4 66.2 33.8 91.3 8.7 Total n % 121 68.4 56 31.6 124 70.1 52 29.9 166 93.8 11 6.2 102 57.6 75 42.4 166 93.8 11 6.2 165 93.2 12 6.8 169 95.5 8 4.5 157 88.7 20 11.3 138 78 39 22 153 86.4 24 13.6 151 85.3 26 14.7 146 82.5 31 17.5 109 61.9 67 38.1 160 90.4 17 9.6 P 0.858 < 0.001 < 0.001 < 0.001 0.004 0.063 0.057 < 0.001 0.004 0.101 0.953 0.973 0.357 0.743
P-values were determined using the χ2 test
Table 3. Laboratory findings at hospital visit for the patients studied
Score Hematuria (%) Stool occult blood WBC count (ml) Platelet count (ml) AST (IU/L) ALT (IU/L) CRP (mg/L) 0 1 0 1 0 1 2 0 1 2 0 1 0 1 0 1 Description Absent Present Absent Present > 5000 3000-5000 ≤ 3000 > 1.50 ´ 105 1.0-1.0 ´ 105 ≤ 1.0 ´ 105 AST ≤ 40 AST > 40 ALT ≤ 40 ALT > 40 CRP ≤ 25 CRP < 25 n 32 3 3 6 74 17 13 82 18 4 32 7 37 2 19 67 DF% 91.4 8.6 33.3 66.7 71.2 16.3 12.5 78.8 17.3 3.8 82.1 17.9 94.9 5.1 22.1 77.9 n 21 3 5 3 10 17 39 15 27 24 8 39 24 23 1 49 DF+ % 87.5 12.5 62.5 37.5 15.2 25.8 59.1 22.7 40.9 36.4 17 83 51.1 48.9 2 98 Total n % 53 89.8 6 10.2 8 47.1 9 52.9 84 49.4 34 20 52 30.6 97 57.1 45 26.5 28 16.5 40 46.5 46 53.5 61 70.9 25 29.1 20 14.7 116 85.3 P 0.679 0.347 < 0.001 < 0.001 < 0.001 < 0.001 0.001
AST: aspartate aminotransferase; ALT: alanine aminotransferase; CRP: C-reactive protein; WBC: white blood cell; P-values were determined using the χ2 test
Journal of Society for development in new net environment in B&H
1979
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
us scales (0 for “absent” and 1 for “present”) to constitute a dengue detection scale (Tables 2 and 3). The Rasch partial credit model 11,20 was used to examine whether these items (1) measure the same underlying construct and (2) assess the tendency toward DF. 2.4 Analysis and statistical tools The analysis plan consisted of three steps. First, the dichotomous and polytomous item data together were analyzed using the Rasch partial credit model with various category numbers for dichotomy and polytomy combined in the scale 21 . Winsteps software (http://www.winsteps.com/ winsteps.htm) was used to examine item properties21. Second, parallel analysis, a method based on the generation of random variables to determine the number of factors, was used to compare the observed eigenvalues extracted from the correlation matrix to be analyzed with those obtained from uncorrelated normal variables. Third, the accuracy of the prediction of DF was examined using the receiver operating characteristic (ROC) 22, with which the area under the curve (AUC) and the sensitivity vs. (1 - specificity) for a binary classifier system as its discrimination threshold varied were obtained. 2.4.1 Rasch analysis Rasch models are latent trait models estimating person ability (or person measure), and item difficulty (i.e., frequency of presentation for each item) along a single continuum11. Rasch models describe a probabilistic relationship between item difficulty and person ability, both of which are reported in "logits" or log-odds 23. The Rasch partial credit model is suitable for both polytomous and dichotomous items with varying categories, such as WBCs, platelets, AST, ALT, and CRP, in a scale. There are two important criteria for Rasch Models, namely item fit and dimensionality. Item fit to the Rasch model is commonly measured using the mean-square residual fit statistic24. Two commonly employed fit statistics to assess item fit are the infit weighted 1980
mean square statistic, and the outfit unweighted mean square statistic. Fit statistics for items have an expected value of 1.0, and can range from 0 to infinity. Deviations in excess of the expected value (e.g., > 2.0 25) can be interpreted as under-fit (or noise) between the items and the model, whereas values significantly lower than the expected value can be interpreted as item redundancy over-fit (or mute) to the model’s requirement. Dimensionality concerns whether the data form a single factor and can be used to assess whether the single latent trait (e.g., tendency toward DF in this study) explains all the variance in the data26. Dimensionality may be evaluated using principal components analyses (PCA) of the residuals that have been extracted 27. Several studies used both the outfit statistic and PCA of the standardized residuals to verify items fitting unidimensionality23,27-30. Criteria are suggested to determine whether unidimensionality is held in the standardized residuals: 1) > 60% of the variance explained by the Rasch factor31; and 2) 2nd eigenvalues (EV) of Rasch residual < 232. 2.4.2 Parallel analysis (PA) Because the PA approach is too time consuming for simulation to get the 2nd eigenvalue of the 95% confidence interval (CI), we used a PA engine on a website (http://ires.ku.edu/~smishra/ parallelengine.htm) and extracted the simulated PA 95% value from the website to determine the unidimensionality of the DF scale when the PA 95% value was greater than the 2nd Eigenvalue on observed scores33. 2.4.3 AUC and sensitivity sequentially compared using 5 nested models Based on the results of PCA on standardized residuals, we sequentially separated items with residual loadings by two parts to compare several indices, such as AUC and the sensitivity, in order to select the optimal item combination to detect the tendency toward DF. Five nested models— model_1, model_21, model_22, model_31, and model_32—were compared using indices.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
3. Results 3.1 Clinical symptoms and laboratory characteristics Of the 177 pediatric patients reviewed, 69 had been diagnosed as DF+ and were admitted to the hospital at a mean of 4.53 days (range: 1-10 days) after the onset of fever. Their median age was 10 years (range: 0-16 years); 40 (58.0%) of these patients were male. The 108 DF- patients were the control group; they were admitted at a mean of 2.97 days (range: 1-9 days) after the onset of fever. Their median age was 5 years (range: 0-16 years); 61 (56.5%) of these patients were male (Table 1). DF- patients were followed by hospital records and no evidence of DV infection was found in this study. Characteristics of the two groups of DF and DF- patients are compared and shown in Table 1. Most patients in both the DF+ DF- groups had slightly elevated CRP levels (< 25 mg/L) (Table
3). A significantly higher proportion of DF patients than DF- patients had elevated AST and ALT levels and reduced platelet and WBC counts. In contrast, a significantly higher proportion of DF- patients had relatively normal WBC and platelet counts. 3.2 Unidimensional characteristics for DF The item (“history of dengue”) was excluded from further analysis because all patients had responded “none”. Model_1 was multidimensional due to two parts of residual loading apparently apart from (Table 4) and the PA 95% EV (1.66) less than the value of 2nd EV on observed scores (2.20), extracting two factors from the data (Table 5). Thirteen non-DF-specific items were removed from model_1 (Table 4: Contrast 1-1) because the indices of model_21 had a lower AUC and sensitivity than did model_22: model_21 accounted for only 17.7% of the explained variance (2nd EV on observed scores
Table 4. Two parts of factor loading on 1st Rasch Residuals for 20 items excluding family history
Item Feature Contrast 1-1 Retrobublar pain Anorexia Stool occult blood Bone pain Soft (watery) stool Cough Myalgia High fever 39°C Sore throat Headache Abdominal pain Petechiae Hematuria (%) Contrast 1-2 Platelet count (ml) AST (IU/L) WBC count (ml) CRP (mg/L) Biphasic fever Skin rash ALT (IU/L) loading -0.44 -0.40 -0.38 -0.35 -0.31 -0.29 -0.29 -0.19 -0.19 -0.18 -0.17 -0.14 -0.05 0.62 0.49 0.48 0.48 0.39 0.37 0.15 Difficulty* 0.33 0.09 -0.59 0.41 1.02 -0.52 0.69 -0.05 1.43 0.97 1.18 2.00 1.60 -2.95 -0.89 -3.49 -2.86 2.00 -0.72 0.35 infit 0.97 1.06 1.31 0.98 1.04 1.30 1.20 0.93 1.31 1.15 1.08 0.91 1.11 0.83 0.71 0.79 0.59 1.00 1.04 0.78 MNSQ outfit 0.87 1.20 1.38 0.86 0.96 1.37 1.41 0.87 2.68 1.33 0.81 0.6 2.03 0.7 0.67 0.71 0.52 0.81 1.08 0.65
*Denoted in logits or log-odds AST: aspartate aminotransferase; ALT: alanine aminotransferase; CRP: C-reactive protein; WBC: white blood cell
Journal of Society for development in new net environment in B&H
1981
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
= 1.8), which suggested that model_21 cannot be unidimensional due to the PA 95% EV (1.46) was less than the value of the 2nd EV on observed scores (1.80) (Table 5). In contrast, model_22 (Table 4: Contrast 1-2) was unidimensional: 1) fit statistics of infit and outfit between 0.5 and 1.5 according to the Winstep user guide31; 2) the variance explained by the Rasch factor was greater than 60%, 3) the 1st EV on Rasch residuals was smaller than 2; and 4) the PA 95% EV (1.49) was greater than the 2nd EV for the observed scores (1.2) (see Table 5, model_22).
3.3 AUC and sensitivity compared with other models Model_22 had the highest values of AUC, sensitivity, and Cronbach’s a of the five models tested (Table 5). The cut-off point for model_22 on summation scores, determined using ROC analysis, was set at 3.
Table 5. Unidimensionality examination for dengue fever variables
Variable High fever 39°C Biphasic fever Skin rash Petechiae Retrobublar pain Bone pain Abdominal pain Anorexia Soft (watery) stool Headache Myalgia Cough Sore throat Hematuria (%) Stool occult blood WBC count (ml) Platelet count (ml) AST (IU/L) ALT (IU/L) CRP (mg/L) PA 95% EV§ 1st EV on observed scores 2nd EV on observed scores Unidimensionality Variance explained by measures 1st EV on Rasch residuals 2nd EV on Rasch residuals Sensitivity Specificity Cut-off point on observed scores AUC Standard Error Cronbach's alpha Items selected Model_1 √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ 1.66 3.80 2.20 No 38.10% 2.40 1.70 79.71 89.81 0.89 0.02 0.63 Model_21 √ √ √ √ √ √ √ √ √ √ √ √ √ Model_22 √ √ Model_31 Model_32 √ √
1.46 2.00 1.80 No 17.70% 1.80 1.60 55.07 74.07 0.65 0.04 0.38
AST: aspartate aminotransferase; ALT: alanine aminotransferase; AUC: area under the receiver operating characteristic (ROC) curve; CRP: C-reactive protein; PA: parallel analysis; WBC: white blood cell; §EV: eigenvalue
√ √ √ √ √ 1.49 2.30 1.20 Yes 60.30% 1.60 1.60 95.65 74.07 3.0 0.91 0.02 0.69
√ √ √ 1.06 1.30 1.00 Yes 75.00% 2.00 1.00 81.16 79.63 0.86 0.02 0.63
√ √ 1.10 1.60 1.00 Yes 61.10% 1.90 1.10 89.86 73.15 0.83 0.03 0.44
1982
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
4. Discussion 4.1 Main findings The traditional univariate approach attributed no sign or symptom to the assessment of DF. However, the Rasch analysis detected characteristics of a tendency toward DF rather well. For example, patients with anorexia, or abdominal discomfort or diarrhea and signs of pharyngitis in patients with DF were deemed to have gastrointestinal problems and respiratory tract infections by using the traditional approach (model_21), as reported in other studies7-9,33-35. In contrast, model_22 contained seven items with the greatest predictive power (sensitivity (95.65) and AUC (0.91))for assessing DF biphasic fever, skin rash, WBC count, platelet count, and AST, ALT, and CRP levels. We found that scales with appropriate items measured the latent trait indicating a tendency toward DF. Physicians can sum these category scores during their initial examination to detect a tendency toward pediatric DF. We also found that some important data were missed because of laboratory and clinical features and, therefore, are not clearly revealed in patients’ medical records. Rasch analysis can overcome this drawback and disclose valuable information that is difficult to deal with in a traditional diagnostic examination. 4.2 Detecting DF at an early stage Biphasic fever and petechiae with 2.0 logits were the rarest symptoms presented (difficulty) in the 21 items. A WBC count (ml) with -3.49 logits was the easiest to code, which indicated that the WBC count (ml) was the commonest characteristic among all the patients. The difficulties of the symptom characteristics ranged from -0.72 to +2.00 logits, compared with that for the laboratory characteristics, which ranged from -3.49 to +0.35 logits. These data showed that the symptom characteristics for DF detection are less common than changes in laboratory characteristics. This means that distinguishing DF+ from DF- patients using signs or symptoms is inefficient because anything distinguishing rarely presents before initial thera-
py is given7,8. However, combining the symptom characteristics with the laboratory characteristics, early detection of DF is more efficient and sensitive (96.65%). This is consistent with other studies reporting that the early stage of severe acute respiratory syndrome from dengue fever can be distinguished using simple laboratory features33,36. Like other studies, we found that thrombocytopenia and leukopenia were highly associated with DF5,33,35,36. WBC and platelet counts are easily obtainable in primary care settings; thus, a combination of laboratory variables (low platelet or WBC counts) for early prediction of dengue infection is feasible. We suggest that the scores of the seven items in model_22 be added to see whether the total is > 3.0. If it is, a DF confirmation test (e.g., Dengue Duo IgM Rapid Strips) can be used to confirm a DF infection. 4.3 Limitations This study has several limitations. First, the study lacks the serotype identification and hospital-based design. Physical signs and symptoms and laboratory investigations of the patients were observed and recorded only during their first hospital visit before therapy was begun. Additional studies on the natural history of dengue and nondengue disease need to be conducted. Second, the sample size was relatively small, even though we were able to construct for diagnosing physicians a highly accurate discriminatory screening feature with an adequately powered accuracy with more than 0.90 AUC for the seven combined variables. However, our findings need to be confirmed by prospective studies in other areas affected by DF. The results in our study indicate potentially useful distinguishing features in DF infected patients. This is important for physicians in remote local clinics where early diagnostic tests for dengue, such as dengue IgM/IgG antibody, PCR, or virus isolation, are not available. 4.4 Further research and prospects Future research should focus on the effects of categorizing the scaling appropriateness for WBC and platelet counts because it would be interesting 1983
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
for physicians to know whether fewer or more categories (e.g., 0-1, 0-2, 0-3, or even 0-5 points of a Likert-type scale) will make the scale more accurate. The decision-support rule for adult DF detection similar to that for children in this study would also be interesting to probe and develop. 5. Conclusion The simple laboratory data in model_22—biphasic fever, skin rash, WBC count, platelet count, and AST, ALT, and CRP levels—can help in the early identification of DF in children, particularly when the summed scores are > 3. The measurement information derived from these features can help optimize clinical decision making in discriminating DF from other febrile illnesses, before using a costly and time-consuming dengue confirmation test. We recommend future studies using a decision-support rule for adult DF detection similar to that for children in this study. Author contributions Dr. Wen-Pin Lai and Mr. Tsair-Wei Chien conceived and designed the study, performed the statistical analyses, and were responsible for recruiting study participants. Dr. Wei-Chih Kan helped designed the study, collected information, and interpreted data. Dr. Hung-Jung Lin and Dr. Shih-Bin Su participated in the study design, supervised the study, and helped draft the manuscript. All authors read and approved the final manuscript. Acknowledgments This research was supported by grant CMFHR 9779 from the Chi-Mei Medical Center. Ethical approval The protocol of this study was approved by the Research and Ethics Review Board of Chi-Mei Medical Center. 1984
References
1. World Health Organization, 2002. Fact sheet No 117. Geneva: World Health Organization. 2. Henchal EA, Putnak JB: The dengue viruses. Clin Microbiol Rev 1990;3:376-396. 3. Gubler DJ: Dengue and dengue hemorrhagic fever. Clin Microbiol Rev 1998;11:480-496. 4. Calisher CH: Persistent emergence of dengue. Emerg Infect Dis 2005;11:738-739. 5. Guzman MG, Kouri G: Dengue: an update. Lancet Infect Dis 2002;2:33–42. 6. Annelies W-S, Eli Schwartz: Dengue in Travelers. N Engl J Med 2005;353:924-32. 7. Hoang Lan Phuong, Peter J de Vries, Tran TT Nga, et al.: Dengue as a cause of acute undifferentiated fever in Vietnam. BMC Infect Dis 2006; 6:123 8. Nunes-Araújo FR, Ferreira MS, Nishioka SD: Dengue fever in Brazilian adults and children: assessment of clinical findings and their validity for diagnosis. Ann Trop Med Parasitol 2003;97:415-419. 9. Hammond SN, Balmaseda A, Pérez L, et al.: Differences in dengue severity in infants, children, and adults in a 3-year hospital-based study in Nicaragua. Am J Trop Med Hyg 2005;73:1063-1070. 10. James A. Potts and Alan L. Rothman: Clinical and laboratory features that distinguish dengue from other febrile illnesses in endemic populations. Trop Med Int Health. 2008;13: 1328-1340. 11. Rasch G.: Probabilistic Models for Some Intelligent and Attainment Tests. Copenhagen, Denmark: Institute of Educational Research 1960. 12. Horn JL: A rationale and test for the number of factors in factor analysis. Psychometrika 1965, 30: 179-185. 13. Humphreys LG, Montanelli RG: An examination of the parallel analysis criterion for determining the number of common factors. Multivariate Behav Res 1975,10,193-206. 14. Silverstein AB: Note on the parallel analysis criterion for determining the number of common factors or principal components. Psychological Reports 1987,61:351-354. 15. Stout WF: A new item response theory modeling approach with applications to unidimensionality assessment and ability estimation. Psychometrika 1990; 55:293-325.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
16. Tennant A, Pallant J: Unidimensionality matters. Rasch Measurement Transactions 2006,20:10481051. 17. Smith RM: A comparison of methods for determining dimensionality in Rasch measurement. Structural Equation Modeling 1996,3:25-40. 18. Kittigul L, Suankeow K: Use of a rapid immunochromatographic test for early diagnosis of dengue virus infection. Eur J Clin Microbiol Infect Dis 2002; 21:224-226. 19. Vaughn DW, Nisalak A, Kalayanarooj S, Solomon T, Dung NM, Cuzzubbo A, et al.: Evaluation of a rapid immunochromatographic test for diagnosis of dengue virus infection. J Clin Microbiol 1998; 36:234-238. 20. Masters GN: A Rasch model for partial credit scoring. Psychometrika 1982;47,149-174. 21. Linacre JM: Winsteps [computer program]. Available at http://www.winsteps.com/winsteps.htm [accessed 07 October 2010]. 22. Fawcett T: An introduction to ROC analysis. Pattern Recognition Letters 2006;27,861-874. 23. Smith AB, Fallowfield LJ, Stark DP, Velikova G, Jenkins VA: Rasch and confirmatory factor analysis of the general health questionnaire (GHQ)— 12. Health Qual Life Outcomes. 2010;30:8:45. 24. Wright BD, Linacre JM: Reasonable mean-square fit values. Rasch Measurement Transactions 1994; 8:370. 25. Smith EV: Detecting and evaluating the impact of multidimensionality using item fit statistics and principal component analysis of residuals. J Appl Meas 2002, 3: 205-231. 26. Bond TG, Fox CM: Applying the Rasch model: Fundamental Measurement in the Human Sciences. London. Lawrence Erlbaum Associates; 2001. 27. Chien TW, Lin SJ, Wang WC, Leung HW, Lai WP, Chan AL: Reliability of 95% confidence interval revealed by expected quality-of-life scores: an example of nasopharyngeal carcinoma patients after radiotherapy using EORTC QLQ-C 30. Health Qual Life Outcomes 2010,13;8:68. 28. Smith AB, Wright P, Selby PJ, Velikova G.A: Rasch and factor analysis of the Functional Assessment of Cancer Therapy-General (FACT-G). Health Qual Life Outcomes 2007, 20;5:19.
29. Smith AB, Fallowfield LJ, Stark DP, Velikova G, Jenkins V: A Rasch and confirmatory factor analysis of the General Health Questionnaire (GHQ)12. Health Qual Life Outcomes 2010, 8:45. 30. McAlinden C, Pesudovs K, Moore JE: The development of an instrument to measure quality of vision; the Quality of Vision (QoV) questionnaire. Invest Ophthalmol Vis Sci. 2010 (in press). 31. Linacre JM, 2008. A User’s Guide to WINSTEPS. Available at http://www.winsteps.com/a/winsteps. pdf [accessed 07 October 2010]. 32. Chou YT, Wang WC: Checking Dimensionality in Item Response Models with Principal Component Analysis on Standardized Residuals. Educational and Psychological Measurement 2010;70:717731. 33. Wilder-Smith A, Earnest A, Paton NI: Use of simple laboratory features to distinguish the early stage of severe acute respiratory syndrome from dengue fever. Clin Infect Dis 2004; 39:1818-1823 34. Lee MS, Hwang KP, Chen TC, Lu PL, Chen TP: Clinical characteristics of dengue and dengue hemorrhagic fever in a medical center of southern Taiwan during the 2002 epidemic. J Microbiol Immunol Infect 2006; 121-129 35. Liu HW, Ho TL, Hwang CS, Liao YH: Clinical observations of virologically confirmed dengue fever in the 1987 outbreak in southern Taiwan. Kaohsiung J Med Sci 1989;5:42-49. 36. Watt G, Jongsakul K, Chouriyagune C, Paris R: Differentiating dengue virus infection from Scrub Typhus in Thai adults with fever. Am J Trop Med Hyg 2003; 536-538. Corresponding author Shih-Bin Su, Department of Family Medicine, Chi-Mei Medical Center, Tainan City 710, Taiwan, E-mail: shihbin.su@msa.hinet.net.
Journal of Society for development in new net environment in B&H
1985
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The effects of highly concentrated oxygen flow rate changes on the blood oxygen saturation and heart rate of young and elderly subjects
Jae-Hoon Jun, Mi-Hyun Choi, Jeong-Han Yi, Soon-Cheol Chung Department of Biomedical Engineering, Research Institute of Biomedical Engineering, College of Biomedical & Health Science, Konkuk University, Chungju, South Korea
Abstract This study investigated the differences in blood oxygen saturation (SpO2) and heart rate (HR) related to flow rate, age, and phase in subjects in their 20s and 60s when the supply of highly concentrated (93%) oxygen was varied (1 L/min, 3 L/min, and 5 L/min). Ten males (25.0±1.8 years) and ten females (23.7±1.9 years) in their 20s and ten males (68.0±2.6 years) and ten females (65.5±3.1 years) in their 60s participated in the study. The experiment consisted of three phases: Pre-Hyperoxia (5 min), Hyperoxia (10 min), and Post-Hyperoxia (10 min). SpO2 [%] and HR [bpm] were measured during each phase. SpO2 was higher in the Hyperoxia phase than in the Pre- and Post-Hyperoxia phases. A higher flow rate was associated with a more pronounced increase in SpO2. The SpO2 of subjects in their 20s was higher than that of subjects in their 60s, regardless of flow rate or phase; however, the rate of SpO2 increase when transitioning from the Pre-Hyperoxia phase to the Hyperoxia phase was higher for that of subjects in their 60s than those in their 20s. HR was lower in the Hyperoxia phase than in the Pre- and Post-Hyperoxia phases. The HR of subjects in their 20s was higher than that of subjects in their 60s, regardless of flow rate or phase, and the rate of HR decrease from the Pre-Hyperoxia phase to the Hyperoxia phase was higher for subjects in their 20s than those in their 60s. However, flow rate did not cause a difference in HR. Key words: Blood oxygen saturation, Heart rate, Highly concentrated oxygen, Flow rate change, Age 1986
Introduction External oxygen administration has been shown to enhance cognitive performance, including memory, visuospatial, verbal, addition, and n-back tasks (1, 2, 3, 4, 5, 6, 7, 8, 9, 10). Highly concentrated oxygen administration induces improvement of cognitive abilities, as demonstrated by an increase in the percentage of correct answers (1, 2, 3, 4, 5, 6, 7, 8, 9) and a reduction in response time (1, 2, 3, 4, 6, 10). The more a difficult task, the larger the effect of highly concentrated oxygen administration (6, 7). When humans perform cognitive tasks, various physiological changes occur that increase the supply of glucose and oxygen to nervous tissues (11). Both heart rate and oxygen consumption increased in subjects who played a video game or performed complex mental arithmetic (12). Wientjes (13) reported that difficulty with information processing was associated with increasingly rapid and shallow respiration. Increased memory load was accompanied by accelerated heart rate, increased respiration rate, and a larger volume of exhaled carbon dioxide, which is a direct indicator of oxygen uptake (14). This implies that as the cognitive load increases (i.e., the cognitive processing demand grows), the physiological changes increase. However, highly concentrated oxygen administration during cognitive processing affected physiological signals as well as cognitive performance (5, 6, 7, 8, 9). The supplementation of highly concentrated oxygen during cognitive processing increased blood oxygen saturation (SpO2) (2, 3, 4, 5,
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
6, 7, 8, 9) and reduced the increase in HR caused by cognitive load (6, 7, 8, 9). This indicates that a sufficient supply of oxygen needed for cognitive processing led to an increase in SpO2 and a blunted HR response (6, 7, 8, 9). It has been reported that cognitive performance correlates with SpO2 (1, 4, 5, 7, 9). Individuals with higher SpO2 showed better cognitive ability. Therefore, SpO2 and HR have the potential to serve as important physiological indices to determine the influence of highly concentrated oxygen on cognitive performance. To more accurately determine the effect of highly concentrated oxygen on cognitive processing via physiological signals such as SpO2 and HR, it is necessary to investigate changes in cognitive ability and physiological signals due to oxygen flow rate, supply time, and concentration. In addition, more studies are needed to investigate the differences in effects related to age and gender (15). This study used oxygen flow rate and age as important variables among various experimental parameters. To determine changes in cognitive ability related to the flow rate of highly concentrated oxygen, this preliminary study investigated changes in SpO2 and HR of subjects in their 20s and 60s when highly concentrated oxygen was supplied at different rates. Methods Participants and oxygen administration This study enrolled a total of 40 participants, including ten males (25.0±1.8 years) and ten females (23.7±1.9 years) in their 20s and ten males (68.0±2.6 years) and ten females (65.5±3.1 years) in their 60s. None of the participants reported having a history of cardiovascular, respiratory, or blood disorders. The experimental design controlled for external factors that could influence physiological signals (e.g., smoking, alcohol, coffee). The overall procedure was explained to all subjects, who subsequently gave their consent for the procedure. All experimental procedures were performed according to the regulations of our Institutional Review Committee. Oxygen supply equipment (OXUS Co.) was developed for this study that provided 93% oxygen
in air at three flow rates (1, 3, and 5 L/min). To maintain steady flow and constant concentration, oxygen was administered to the subject through a mask. Physiological measures and experimental procedure Blood oxygen saturation (SPO2 [%]) and heart rate (HR [bpm]) were measured via a pulse oximeter (8600 Series, NONIN Medical, Inc.) on the left index finger of the subject. The experiment consisted of three phases: PreHyperoxia (Pre-H), Hyperoxia, and Post-Hyperoxia (Post-H), as shown in Figure 1. Pre-H was a rest phase prior to the supply of highly concentrated oxygen (5 min.); during the Hyperoxia stage subjects received 93% oxygen through masks (10 min.); and Post-H was a rest phase after the supply of oxygen (10 min.). During Pre- and Post-H phases the subjects breathed air (21% oxygen) naturally. While the subjects sat comfortably on chairs, their SpO2 and HR were measured for a total of 25 minutes. The experiment was repeated at flow rates of 1, 3, and 5 L/min, and the subjects rested for 30 minutes between each experiment at different flow rates. All subjects participated in each of the experiments (all three flow rates), and the order of flow rate was randomly determined.
Figure 1. Experimental design. Data analysis Means of SpO2 and HR for each subject were calculated for each phase. Two-way analysis of variance (ANOVA) with repeated measures was used with flow rate (1, 3, and 5 L/min), age (20s and 60s), and phase (Pre-H, Hyperoxia, and PostH) as independent variables to verify a significant difference in SpO2 and HR according to flow rate, age, and phase. When an interactive effect among variables was observed, major variables influen1987
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
cing physiological signals were determined with simple main effect analysis. Results Blood oxygen saturation As shown in Figure 2, means of SpO2 were calculated according to flow rate and age in each phase. The SpO2 during the Hyperoxia phase was higher than that measured during the Pre- or Post-H phases. Increased supply of highly concentrated oxygen was associated with greater increases of SpO2. The SpO2 was higher for subjects in their 20s than those in their 60s, regardless of flow rate or phase. Changes in SpO2 were analyzed with flow rate, age, and phase as independent variables, as shown in Table 1. A significant difference was found for flow rate (p=.008), age (p<.001), and phase (p<.001). Since an interactive effect between phase and age was shown (p<.001), the simple main effect analysis was performed. One-way ANOVA on the difference due to age in each phase revealed that SpO2 was significantly different due to age in all phases (Pre-H: p<.001; Hyperoxia: p=.001; Post-H: p<.001) (Figure. 3). According to results of one-way ANOVA on the difference due to phase in each age group, both groups showed a significant difference in SpO2 due to phase (20s: p<.001;
60s: p<.001) (Figure 3). Since an interactive effect between phase and flow rate was shown (p<.001), the simple main effect analysis was performed. One-way ANOVA on the difference due to flow rate in each phase revealed that SpO2 was significantly different due to flow rate only in the Hyperoxia phase (p=.001) (Figure. 3). According to results of one-way ANOVA on the difference due to phase at each flow rate, all three flow rates showed a significant difference in SpO2 due to phase (1 L/ min: p<.001; 3 L/min: p<.001; 5 L/min: p=.001) (Figure 3). In conclusion, SpO2 was significantly different due to flow rate, age, and phase.
Figure 3. SpO2 in each phase according to age and flow rate As shown in Figure 2, although the SpO2 of subjects in their 20s was higher than that of subjects in their 60s, regardless of flow rate or phase, the rate of SpO2 increase from the Pre-H phase to the Hyperoxia
Figure 2. Differences in SpO2 between subjects in their 20s and 60s due to highly concentrated oxygen flow rate 1988
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 1. Results of ANOVA with repeated measures on SpO2 using flow rate, age, and phase as independent variables
Source Within – subject Effect Phase Phase × Age Phase × Flow rate Phase × Age × Flow rate Between – subject Effect Age Flow rate Age × Flow rate Type III Sum of Squares 178.102 10.353 5.283 1.222 102.507 28.340 .361 df 2 2 4 4 1 2 2 Mean Square 89.051 5.177 1.321 .306 102.507 14.170 .180 F 484.890 28.188 7.191 1.664 36.384 5.030 .064 Sig. .000 .000 .000 .159 .000 .008 .938
phase of subjects in their 60s tended to be higher than that of those in their 20s. To analyze this trend, rates of SpO2 increase from the Pre-H to Hyperoxia phase (i.e., Hyperoxia - Pre-H) of subjects in their 20s or 60s were calculated at three flow rates. The independent t-test showed significant differences in the rates of SpO2 increase between subjects in their 20s or 60s, as shown in Figure 4 (1 L/min: p<.01; 3 L/min: p<.001; 5 L/min: p<.01).
Figure 4. Rates of SpO2 increase from the Pre-H phase to the Hyperoxia phase (Hyperoxia - Pre-H) of subjects in their 20s and 60s for three flow rates
**p<.01 ***p<.001
Heart rate As shown in Figure 5, means of HR were calculated according to flow rate and age in each phase, and the variations in HR were analyzed with flow rate, age, and phase as independent variables (Table 2). There was a significant difference due to phase (p<.001) and age (p<.001). Since there were interactive effects between phase and age
(p<.001), between phase and flow rate (p=.048), and among phase, age, and flow rate (p=.028), the simple main effect analysis was performed. When two-way ANOVA on flow rate and phase in each age group was performed, both groups showed a significant difference in HR due to phase (20s: p<.001, 60s: p<.001) (Figure 6). However, there was no difference due to flow rate in either group (p>.05) (Figure 6). For subjects in their 60s, an interactive effect between phase and flow rate was observed (p=.002); therefore, the simple main effect analysis was conducted. According to results of one-way ANOVA on differences due to flow rate in each phase, no difference in HR due to flow rate was observed in any of the phases (p>.05). One-way ANOVA examining the difference due to phase at each flow rate revealed that the difference in HR due to phase was significant at each of the three flow rates (1 L/min: p<.001; 3 L/min: p<.001; 5 L/min: p<.001). In conclusion, HR was significantly different due to phase and age. As shown in Figure 5, the HR of subjects in their 20s was higher than those in their 60s, regardless of flow rate or phase, and the rate of HR decrease when transitioning from the Pre-H phase to the Hyperoxia phase of subjects in their 20s tended to be higher than that of subjects in their 60s. To analyze this trend, the rate of HR decrease from the Pre-H phase to the Hyperoxia phase (PreH - Hyperoxia) of each age group was calculated at three flow rates. The independent t-test showed that significant differences between the age groups in the rate of HR decrease were observed at two flow rates, as shown in Figure 7 (1 L/min: p>.05; 3 L/min: p<.01; 5 L/min: p<.05). 1989
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 2. Results of ANOVA with repeated measures on HR using flow rate, age, and phase as independent variables
Source Within – subject Effect Phase Phase × Age Phase × Flow rate Phase × Age × Flow rate Between – subject Effect Age Flow rate Age × Flow rate Type III Sum of Squares 411.320 51.679 27.122 30.958 4144.617 224.727 3.829 df 2 2 4 4 1 2 2 Mean Square 205.660 25.839 6.781 7.740 4144.617 112.364 1.915 F 73.895 9.284 2.436 2.781 18.271 .495 .008 Sig. .000 .000 .048 .028 .000 .611 .992
Figure 5. Differences in HR between subjects in their 20s and 60s due to highly concentrated oxygen flow rate
Figure 6. HR in each phase according to age and flow rate
Figure 7. Rates of HR decrease from the Pre-H phase to the Hyperoxia phase (Pre-H - Hyperoxia) of subjects in their 20s and 60s for three flow rates
*p<.05 **p<.01
1990
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Discussion This study investigated differences in SpO2 and HR due to flow rate, age, and phase when the supply of highly concentrated oxygen (93%) was varied (1, 3, and 5 L/min) using subjects in their 20s or 60s. The supply of 30% and 40% concentrated oxygen compared to the supply of oxygen via air (21%) was shown to increase SpO2 (5, 6, 7, 8, 9). Also, Moss et al. (2), found that the supply of 100% oxygen increased SpO2. Similar to these previous studies, this study also demonstrated that SpO2 was greater in the Hyperoxia phase than in the Pre- or Post-H phases. As we expected, this study found that a greater supply of highly concentrated oxygen increased SpO2. Previous studies reported that SpO2 and cognitive ability correlated positively during the supply of highly concentrated oxygen (1, 2, 5, 7, 9). Therefore, it is expected that increasing the supply of highly concentrated oxygen would produce higher SpO2, and increased SpO2 would improve cognitive performance more substantially. Colodny (16) reported that SpO2 was higher in young people than in elderly people because numerous physical functions (e.g., heart, respiration, blood function) become impaired due to the aging process. The current study also demonstrated that subjects in their 20s exhibited higher SpO2 than those in their 60s during all phases. However, the rate of SpO2 increase when transitioning from the Pre-H phase to the Hyperoxia phase of subjects in their 60s was higher than that of subjects in their 20s. It was believed that highly concentrated oxygen was effectively and easily absorbed in the body of older subjects because the absolute value of SpO2 in these subjects was low. It was reported, as mentioned above, that SpO2 and cognitive ability positively correlated (1, 4, 5, 7, 9). Although absolute cognitive performance of subjects in their 20s would be expected to be higher than that of subjects in their 60s, it is anticipated that improvement of cognitive performance due to highly concentrated oxygen administration would be higher in those in their 60s than in those in their 20s. This connection needs to be elucidated through additional future studies. It has been reported that hyperoxia can reduce HR (15, 17). Similarly, this study showed that HR decreased in the Hyperoxia phase compared
to that in the Pre- and Post-H phases. Therefore, the supply of highly concentrated oxygen during cognitive processing could reduce the increase of HR following a cognitive load (6, 7, 8, 9). Since physical function (e.g., cardiovascular, respiratory, and blood function) decrease with aging as mentioned above, the absolute value of HR for subjects in their 20s was higher than that of subjects in their 60s. The rate of HR decrease from the Pre-Hyperoxia phase to the Hyperoxia phase, or the adaptability of HR from Pre-Hyperoxia to Hyperoxia, was higher for subjects in their 20s than those in their 60s because of the same reason. Although highly concentrated oxygen flow rate increases tended to be associated with a greater decrease in HR, there was no significant difference. The variation of HR signal was generally larger than that of SpO2, which might account for the absence of a statistically significant difference. The variation in physiological function in systems (e.g., heart, respiration, and blood) might also be related to the absence of statistical differences. Therefore, further investigation of this topic is necessary. The results of this study can be used as basic data to determine the mechanism of changes in cognitive performance related to the flow rate of highly concentrated oxygen and to age. Acknowledgements This work was supported by Konkuk University in 2011. Reference
1. Moss, M.C., Scholey, A.B. Oxygen administration enhances memory formation in healthy young adults. Psychopharmacology. 1996; 124: 255-260. 2. Moss, M.C., Scholey, A.B., Wesnes, K. Oxygen administration selectively enhances cognitive performance in healthy young adults: a placebo-controlled double blind crossover study. Psychopharmacology. 1998; 138: 27-33. 3. Winder, R., Borrill, J. Fuels for memory: the role of oxygen and glucose in memory enhancement. Psychopharmacology. 1998; 136: 349-356.
Journal of Society for development in new net environment in B&H
1991
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
4. Scholey, A.B., Moss, M.C., Neave, N., Wesnes, K. Cognitive performance, hyperoxia,and heart rate following oxygen administration in healthy young adults. Physiol Behav. 1999; 67: 783-789. 5. Chung, S.C., Iwaki, S., Tack, G.R., Yi, J.H., You, J.H., Kwon, J.H. Effect of 30% oxygen administration on verbal cognitive performance, blood oxygen saturation and heart rate. Appl Psychophysiol Biofeedback. 2006; 31: 281-293. 6. Chung, S.C., Kwon, J.H., Lee, H.W., Tack, G.R., Lee, B., Yi, J.H., Lee, S.Y. Effects of high concentration oxygen administration on n-back task performance and physiological signals. Physiol Meas. 2007; 28: 389-396. 7. Chung, S.C., Lee, H.W., Choi, M.H., Tack, G.R., Lee, B., Yi, J.H., Kim, H.J., Lee, B.Y. A study on the effects of 40% oxygen on addition task performance in three levels of difficulty and physiological signals. Int J Neurosci. 2008a; 118: 905-916. 8. Chung, S.C., Lee, B., Tack, G.R., Yi, J.H., Lee, H.W., Kwon, J.H., Choi, M.H., Eom, J.S., Sohn, J.H. Physiological mechanism underlying the improvement in visuospatial performance due to 30% oxygen inhalation. Appl Ergon. 2008b; 39: 166-170. 9. Chung, S.C., Lim, D.W. Changes in memory performance, heart rate, and blood oxygen saturation due to 30% oxygen administration. Int J Neurosci. 2008c; 118: 593-606. 10. Chung, S.C., Tack, G.R., Choi, M.H., Lee, S.J., Choi, J.S., Yi, J.H., Lee, B., Jun, J.H., Kim, H.J., Park, S.J. Changes in reaction time when using oxygen inhalation during simple visual matching tasks. Neurosci Lett. 2009; 453: 175-177. 11. John, J., Eric, H.S., Edward, E.S., Erick, J.L., Edward, A., Satoshi, M., Robert, A.K. Verbal working memory load affects regional brain activation as measured by PET. J Cogn Neurosci.1997; 9: 462-475. 12. Turner, L.A., Carroll, D. Heart rate and oxygen consumption during mental arithmetic, a video game, and graded exercise: further evidence of metabolically-exaggerated cardiac adjustments. Psychophysiology. 1985; 22: 261-267. 13. Wientjes, C.J.E. Respiration in psychophysiology: methods and applications. Biological Psychology. 1992; 34: 179-204.
14. Backs, R.W., Selihos, K. A. Metabolic and cardiorespiratory measures of mental effort: the effects of level of difficulty in a working memory tasks. Int J Psychophysiol. 1994; 16: 57-68. 15. Jun, J.H., Choi, M.H., Lee, S.J., Yang, J.W., Kim, J.H., Choi, J.S., Park, J.Y., Tack, G.R., Lee, B.Y., Kim, H.J., Chung, S.C. Changes in blood oxygen saturation and heart rate of young male and female subjects due to flow rate of highly concentrated oxygen. HealthMED. 2010; 4(4): 1062-1067. 16. Colodny, N. Effects of age, gender, disease, and multisystem involvement on oxygen saturation levels in dysphagic persons. Dysphagia. 2001; 16:48-57. 17. Lodato, R.F., Jubran, A. Response time, automatic mediation and reversibility of hyperoxiabradycardia in conscious dogs. J Appl Physiol. 1993; 74: 634-642. Corresponding author Soon-Cheol Chung, Department of Biomedical Engineering, Research Institute of Biomedical Engineering, College of Biomedical & Health Science, Konkuk University, South Korea , E-mail: scchung@kku.ac.kr
1992
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Effects of magnetic stimulation of cervical spinal cord on main cerebral arterial blood flow
Ünal Özüm1, Hatice Balaban2, Hande Yapışlar3, Suat Topaktaş2
1
Cumhuriyet University Faculty of Medicine, Department of Neurosurgery. Sivas, Turkey. Cumhuriyet University Faculty of Medicine, Department of Neurology. Sivas, Turkey. 3 İstanbul Bilim University, Faculty of Medicine, Department of Physiology. İstanbul, Turkey.
2
Abstract Magnetic stimulation is a non-invasive method for stimulation of nervous tissue, including cerebral cortex, spinal roots, and peripheral nerves. Neural tissue can easily be stimulated through skin by a stimulator coil. To find a new, noninvasive method alternative to the epidural electrical stimulation, the effect of magnetic stimulation of cervical spinal cord on blood flow in main cerebral artery is investigated. Cervical spinal cord at C2 and C7 levels were stimulated magnetically in healthy male volunteers, age between 17-40, for once, consecutively twice, and consecutively thrice, and blood flow in right middle cerebral artery was measured by transcranial Doppler ultrasonography during and after magnetic stimulation. Mean flow velocity in right middle cerebral artery decreased after magnetic stimulation of high cervical spinal cord, and this change appeared early and was prolonged as number of magnetic stimulation increased. Our results show that magnetic stimulation of high cervical spinal cord increases cerebral blood flow. Key words: Transcranial Doppler ultrasound; Magnetic stimulation; Spinal cord stimulation; Cerebral blood flow. Introduction Electrical spinal cord stimulation (ESCS) has been used for treatment of patients with chronic pain since 1967 [1, 2]. Since peripheral vasodilation is shown to occur with ESCS, it is natural to
inquire whether the same effect occurs centrally [3]. ESCS via electrodes placed on dorsal spinal surface increases cerebral blood flow significantly [4-7]. This beneficial effect of ESCS has been used in the management of intracranial ischemic conditions [812]. As placement of electrodes over dorsal surface area is an invasive procedure and may cause ethical problems in clinical studies, this procedure is not be used widely in clinical practice. Neuron and its axon can be stimulated magnetically through the skin by a stimulator coil. Magnetic stimulation is applied to the cervical spine in order to investigate central motor conduction time, spinal motor pathway, cervical spinal root, and brachial plexus pathology [13-17]. As electrical stimulation of upper cervical spinal cord may increase cerebral blood flow (CBF), magnetic stimulation of cervical spinal cord may also have the same effect in intracranial area. We aimed to test if magnetic stimulation of upper cervical spinal cord increases blood flow in main cerebral arteries of adult healthy males. Methods Study was approved by Local Ethics Committee and all subjects gave written informed consent. A total of 100 healthy male volunteers consented to participate in this study. Any subjects with disease in personal medical history and physical examination were excluded. Subjects of age <17 were not included in the study due to possibility of cooperation failure to the transcranial Doppler ultrasound study. Subjects age >45 were also excluded since 1993
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
high prevalence of vascular diseases like atherosclerosis may alter cerebrovascular reactivity, which may not detected in routine physical examination. Maximum physical and emotional stability of subjects were considered in order to gain CBF stability. Study was performed at the same time of every day (8-10 PM) in order to standardize circadian rhythm of subjects. After procedure was explained to volunteers, subjects were seated in comfortable chair in dim study room. Researcher asked subjects to stay motionless, quite, alert, and calm during the study. Blood flow in right middle cerebral artery (MCA) was evaluated by transcranial Doppler (TCD) ultrasonography via right temporal window. Once the flow signals from the right MCA were detected, the probe was fixed to the head via probe holder, in order to record clearest and artifact free signals. Measurement of mean flow velocity (MFV; cm/sec) in the right MCA was used, and all TCD studies were performed in a blinded fashion. A transcranial Doppler (TCD) ultrasonography device with 8 MHz frequency probe (Smart-Lite TCD System, RIMED, Israel) was used. Decreased MFV was interpreted as a vasodilation in MCA which reflected increase in CBF. A single-pulse device with a maximum output of 2.0 Tesla (Magstim, Long Island City, NY, USA) was used in this study. The stimulation coil diameter was 90 mm. The anatomical reference for the high cervical spinal cord was accepted as a point on the spinous process of C2 and C7 vertebra. The coil was set in a horizontal position to achieve maximum magnetic field over the cervical spinal cord. Stimulation intensity was adjusted to 60 % of maximum output (1.2 Tesla). The time interval between two or three consecutive stimulation was 3 second. Subjects were randomly assigned to ten groups: C2 control group (C2-control, n=10), C7 control group (C7-control, n=10), C2 false stimulation group (C2-F-st, n=10), C7 false stimulation group (C7-F-st, n=10), C2 once stimulation group (C21-st, n=10), C7 once stimulation group (C7-1-st, n=10), C2 twice consecutive stimulation group (C2-2-st, n=10), C7 twice consecutive stimulation group (C7-2-st, n=10), C2 thrice consecutive stimulation group (C2-3-st, n=10), and C7 thrice consecutive stimulation group (C7-3-st, n=10). 1994
In control groups, TCD measurement was performed without performing any stimulation for 30 minutes. In F-st groups, in order to exclude possible CBF changes due to click sound of magnetic pulse or the sense of touch of coil to the neck, single magnetic pulse was applied after stable MFV of right MCA of subjects was achieved, while coil vertically touched the neck of subjects in which the position could not stimulate cervical spinal cord at C2 or C7 level. Cervical spinal cord at C2 or C7 level was stimulated magnetically once in 1-st groups, consecutively twice in 2-st groups, and consecutively thrice in 3-st groups. The time of magnetic pulse application in F-st and 1-st groups and the time of last magnetic pulse application in 2-st and 3-st groups was accepted as the zero time of TCD measurement and MFV of right MCA was measured continuously for 30 minutes after application of magnetic pulse or pulses. MFV values of right MCA received from four groups at 0., 10., 20., 30., 40., 50., 60., 120., 300., 600., 900., and 1200. seconds of measurement were evaluated. Heart rate and capillary blood oxygenation were monitorized and noninvasive arterial blood pressure was received before stimulation and monitorized every one minutes during the study. C2-control, C7-control, C2-F-st, C7-F-st, C21-st, C7-1-st, C2-2-st, C7-2-st, C2-3-st, and C73-st groups were analyzed with repeated measurements ANOVA plus a post-hoc Bonferroni's test. Significance was accepted at p<0.05. SPSS for Windows (Version 12.0) is used. Results No significant difference was found between the groups as to age distribution (p>0.05). Heart rate, saturation of arterial oxygen (SO2), and noninvasive arterial blood pressure remained within normal ranges in all subjects throughout the study, tachycardia in first 30 second after stimulation was not significant in C2-F-st, C7-F-st, C2-1-st, C7-1-st, C2-2-st, C7-2-st, C2-3-st, and C7-3-st groups (p>0.05). No significant change in MFV value was observed during TCD study in C2-control group (p>0.05). False magnetic stimulation caused no significant MFV change in any time points evaluated (p>0.05). There was no significant difference
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
in mean MFV value measured at all time points between C2-control and C2-F-st groups (p>0.05). No significant difference was found in mean MFV value at the beginning of TCD measurement between and C2-control, C2-F-st, C2-1-st, C2-2st, and C2-3-st groups respectively (p>0.05). As soon as once and twice magnetic pulse were applied, mean MFV values increased for 10 seconds and then began to decrease, but the difference between the 10th and 0 second in term of mean MFV values were not significant (p>0.05). The decreasing trend continued until the 50th second in C2-1-st group and the 60th second in C2-2-st group. Thereafter, mean MFV values showed an increasing trend until the end of TCD measurements (Figure 1 and 2). Mean MFV values at 50th second in C2-1-st group and at 60th second in C2-2-st group were significantly different from mean MFV values at 0 and10th seconds in both groups (p<0.05). No significant difference was found in mean MFV values measured at all time points between C2-1-st, C2-2-st, C2-F-st, and C2-control groups (p>0.05).
As soon as thrice consecutive magnetic pulses was applied, mean MFV value increased for 10 second again and then began to decrease, but mean MFV value at 10th second was not significantly different from mean MFV value at the beginning of TCD measurement. The decreasing trend continued until the 40th second. Thereafter, mean MFV value showed a stable trend between 40th and 120th seconds. Thereafter, mean MFV value showed an increasing trend until the end of TCD measurement (Figure 3). Mean MFV values at the 40th 50th, 60th and, 120th seconds were significantly different from mean MFV values at 0, 10th, 20th 900th and 1200th seconds (p<0.05). There was significant difference in mean MFV values measured at 40th, 50th, 60th, and 120th second between C2-3-st and C2-control and C2-F-st group (p<0.05). No significant difference was found in mean MFV values measured at all time points between C2-3-st and C2-1-st and C2-2-st group respectively (p>0.05).
Figure 1. Mean flow velocity (MFV) curves were obtained after magnetic stimulation of cervical spinal cord at C2 level in C2-F-st and C2-1-st groups. Interrupted line shows MFV in C2-control group
Figure 3. Mean flow velocity (MFV) curves were obtained after magnetic stimulation of cervical spinal cord at C2 level in C2-F-st and C2-3-st groups. Interrupted line shows MFV in C2-control group Once, twice, and thrice magnetic stimulation of cervical spinal cord at C7 level created no significant MFV change in any time points evaluated (p>0.05), (Figure 4). Mean MFV values at the 40, 50, 60, and, 120 seconds in C7-3-st group were significantly different from mean MFV values at the same time points in C2-3-st group (p<0.05), (Figure 5).
Figure 2. Mean flow velocity (MFV) curves were obtained after magnetic stimulation of cervical spinal cord at C2 level in C2-F-st and C2-2-st groups. Interrupted line shows MFV in C2-control group
Journal of Society for development in new net environment in B&H
1995
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Figure 4. Mean flow velocity (MFV) curves were obtained after magnetic stimulation of cervical spinal cord at C7 level in C7-F-st, C7-1-st, C72-st, and C7-3-st groups. Interrupted line shows MFV in C7-control group
Figure 5. Mean flow velocity (MFV) curves were obtained after thrice magnetic stimulation of cervical spinal cord at C2 and C7 level Discussion As magnetic stimulation of cervicomedullary junction and cervical spine is used widely in clinical practice for both diagnostic and therapeutic purposes with little discomfort, human experiment was preferred in this study. Repetitive lowintensity magnetic stimulation of cervicomedullary junction intended to stimulate the cerebellum is reported to cause nausea in some subjects [18]. Coil was positioned over the spinous process of second cervical vertebra and no subject has complained of nausea in this study. Major difficulty is unintended stimulation of axons in the roots and brachial plexus and activation of head and neck muscle during magnetic stimulation of high cervical area depending on coil position [17] A painless involuntary movement in neck, shoulders, and arms were observed in 1-st, 2-st, and 3-st groups as soon as magnetic pulse was applied at C2 and C7 levels. Since sex hormones, especially estro1996
gens, have well-known vasoactive properties and estrogen level is different depending on time point in menstrual cycle of female, standardization of blood flow in female may be impossible [1921]. For this reason, females were not consented to participate in this study. This is a preliminary study and an expanded, well planned study including both sexes should be performed. Transcranial Doppler ultrasonography is a safe, noninvasive and painless tool to analyze CBF. No special precautions are necessary [13, 22, 23]. There are experimental and clinical data about the effect of ESCS on CBF in literature since 1985 [4]. Although the underlying mechanism of this effect is still unclear, some possible explanations have been raised throughout data obtained from detailed studies: - Functional reversible symphatectomy. ESCS may stimulate superior cervical ganglion, which cause inhibition of preganlionic adrenergic neurons [24-26]. - Vasomotor centers. ESCS may alter CBF by influencing activity of rostroventrolateral nucleus of medulla together with fastigial nucleus of cerebellum which is known to influence central hemodynamic when stimulated [27, 28]. - Nitric oxide (NO). Nicotinic acetyl choline receptors located at the terminals of postganglionic sympathetic neurons would be responsible for norepinephrine release. Thereafter norepinephrine may activate closely located NO ergic neurons to release transmitter NO. Other possible mechanism for NO release is direct release from antidromically activated afferent trigeminal nerve fiber terminals [29, 30]. - Calcitonin gene related peptide (CGRP). ESCS antidromically activates afferent trigeminal nerve fibers, causing release of CGRP which is a potent vasodilator agent [31, 32]. Some or all mechanisms above may be responsible for the relationship between ESCS and CBF alteration. Electrical stimulation of neurons and/ or axons is the first event in this relationship. In ESCS practice, rectangular pulses of 50100 Hz passing through an electrode placed over
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
epidural surface of spinal cord at special levels of spine according to the special purpose are used. Intensity of electrical stimulation is adjusted close to threshold for producing motor effect (approximately ½ – 1/3 of motor threshold). ESCS lasts for 1-8 hours. Although, this intensity is selected in order to stimulate fast-conducting (>75 m/s), large diameter fiber with lower threshold, without activating slow-conducting (<55 m/s), thin fiber with higher threshold, most fibers have lower threshold for electrical stimulation [33, 34]. Single electrical stimulus creates single action potential. When multiple electrical stimuli influence a neuron or axon, the sum of their effects is called a summation [35]. In ESCS practice, repetitive electrical pulse in special frequency and intensity is applied in order to achieve diagnostic and/or therapeutic purposes. It has been reported that no alteration in extracranial autonomic parameters (arterial blood pressure, heart rate, etc.) was observed throughout the ESCS [8, 9, 26, 32]. Non-invasive stimulation of neurons and axons by magnetic stimulator is feasible. Single magnetic stimulation of cerebral cortex, spinal roots, cranial and peripheral nerves has been used in clinical and experimental practice and serves diagnostic purposes. Repetitive magnetic stimulation of neural network has been used as a new therapeutic tool for different neurological and psychiatric disorders. Magnetic stimulation of neural network occurs according to the principle of electromagnetic induction, as discovered by Michael Faraday in 1838. A pulse passing through a coil placed over the person's skin that has sufficient strength and duration short enough, penetrates skin and bone, and induces a secondary ionic current in neural tissue. The site of stimulation of nerve body or fibers is the point along its length at which sufficient current to cause depolarization passes through its membrane [34]. For magnetic stimulation fast-conducting (>75 m/s) fibers have a lower threshold, slow-conducting (<55 m/s) fibers have a higher threshold [33]. Two types of coil, circular coil of 8-10 cm diameter and double cone coil are used in clinical practice each with their advantage and disadvantage. A circular coil of 9 cm diameter was used in this study.
Single action potential in neuro-axonal network which is created with single magnetic pulse at C2 level did not change blood flow in right MCA significantly. Second action potential which is superimposed to first one revealed further insignificant increase in blood flow in right MCA. However, summation of three action potentials which is created by three consecutive magnetic pulse revealed earlier, more prolonged, and significantly increase in blood flow in right MCA. One or more magnetic pulses may cause blood flow increasing in right MCA throughout the same mechanisms, explaining the relationship between ESCS and CBF changes, mentioned above. Interval between two or three consecutive magnetic pulse was approximately 3 seconds according to our stimulator's capability, and magnetic pulse intensity was adjusted to 60 % of maximum output (1.2 Tesla) in this study. Application of repetitive magnetic stimulation in different frequencies (one pulse per second or more) and in different intensities (less or more than 1.2 Tesla) may achieve different responses. A train of repetitive stimulation may modulate cortical neuronal excitability. This modulator effect may range from inhibition to facilitation depending on the stimulation variables (specifically frequency of stimulation). Lower frequency of repetitive magnetic stimulation (approximately 1 Hz) can suppress excitability of neuron groups, while approximately 20 Hz stimulation trains lead to temporary increase in neuronal excitability [36, 37]. Frequency of magnetic stimulation was approximately 0.3 Hz with instable time interval in this study. Increase in blood flow in right MCA with very low frequency magnetic stimulation may be explained with multiple mechanisms of underlying relationship between cervical spinal cord stimulation and CBF changes. Magnetic pulses may have stimulated neurons and/or axons in upper cervical spinal cord and/or superior cervical ganglion, which may be responsible for CBF increasing with cervical cord stimulation. Magnetic pulses are used for the first time to stimulate upper cervical spine in order to influence intracranial blood flow. It seems necessary to perform a study of prolonged repetitive magnetic stimulation in different frequency and intensity of cervical spine as a next step. Therapeutic effect of prolonged repetitive magnetic stimulation in diffe1997
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
rent frequency and intensity of upper cervical spine in order to improve CBF in pathological conditions such as post subarachnoid hemorrhage vasospasm should be also examined. Evaluation of the effects of magnetic stimulation of upper cervical spine on intracranial main arteries and cerebral cortical blood flow by cerebral angiography or laser Doppler flow-meter may provide useful data. We have obtained evidence that magnetic stimulation of cervical spinal cord at upper levels looks more appropriate to achieve CBF improvement. Because of the invasiveness and ethical issue of the placement of electrodes over the dorsal epidural surface in conventional electrical stimulation studies, noninvasive and easy stimulation of upper cervical spinal cord by magnetic stimulator may be a new alternative to improve CBF. References
1. Meglio M, Cioni B, Visocchi M, Nobuli F, Rodriguez G, Rosadini G. Spinal cord stimulation and cerebral hemodynamics. Acta Neurochir (Wien) 1991;1:43-8. 2. Shealy CN, Mortimer JT, Reswick JB. Electrical inhibition of pain by stimulation of the dorsal columns: preliminary clinical report. Anesth Analg 1967;46:489-91. 3. Broseta J, Barbera JA, De Vera JA. Spinal cord stimulation in peripheral arterial disease. A cooperative study. J Neurosurg 1986;64:71-80. 4. Hosobuchi Y. Electrical stimulation of cervical spinal cord increases cerebral blood flow in humans. App Neurophysiol 1985;48:372-6. 5. Isono M, Kaga A, Fujiki, M, Mori T. Effect of spinal cord stimulation on cerebral blood flow in cats. Stereotact Funct Neurosurg 1995;64:40-6. 6. Meglio M, Cioni B, Visocchi M, Nobuli F, Rodriguez G, Rosadini G. Spinal cord stimulation and cerebral hemodynamics. Acta Neurochir (Wien) 1991;1:43-8. 7. Sagher O, Huang DL. Effect of cervical spinal cord stimulation on cerebral blood flow in the rat. J Neurosurg 2000;93:71-6.
8. Ebel H, Schomacker K, Balong A, et al. High cervical spinal cord stimulation (CSCS) increase regional cerebral blood flow after induced subarachnoid hemorrhage in rats. Minim Invas Neurosurg 2001;44:167-71. 9. Gürelik M, Kayabaş M, Karadağ Ö, Göksel HM, Akyüz A, Topaktaş S. Cervical spinal cord stimulation improves neurological dysfunction induced by cerebral vasospasm. Neuroscience 2005;134:827-32. 10. Linderoth B, Ghererdani G, Ren B, Lunderberg T. Preemptive spinal cord stimulation reduces ischemia n an animal model of vasospasm. Neurosurgery 1995;37:266-71. 11. Matsui T, Asano T, Takakura K, Yamada R, Hosobuchi Y. Beneficial Effects of Cervical Spinal Cord Stimulation on Patients with Impaired Consciousness: a preliminary report. PACE 1989;12:718-25. 12. Visocchi M, Cioni B, Pentimalli L, Meglio M. Increase of cerebral blood flow and improvement of brain motor control following spinal cord stimulation in ischemic spastic hemiparesis. Stereotact Funct Neurosurg 1994;62:103-7. 13. Aaslid R, Huber P, Nornes H. Evaluation of Cerebrovascular Spasm with Transcranial Doppler Ultrasound. J Neurosurg 1984;60:37-41. 14. Hess CW, Mills KR, Muray NMF, Schriefer TN. Magnetic brain stimulation: central motor conduction studies in multiple scleorisis. Ann Neurol 1987;22:744-53. 15. Maccabee PJ, Amassian VE, Eberle LP, Cracco RQ. Magnetic coil stimulation of straight and bent amphibian and mammalian peripheral nerve in vitro: locus of excitation. J Physiol 1993;460:201-9. 16. Pascal-Leone A, Valls-Sole VJ, Wasserman EM, Hallet M. Response to rapid-rate transcranial magnetic stimulation of the human motor cortex. Brain 1994; 117:847-58. 17. Taylor JL, Gandeiva SC. Noninvasive stimulation of the human corticospinal tract. J App Physiol 2004;96:1496-503. 18. Satow T, Mima T, Hara H, et al. Nausea as a complication of low-frequency repetitive transcranial magnetic stimulation of the posterior fossa. Clin Neurophysiol 2002;113:1441-3.
1998
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
19. Geary GG, Krause DN, Duckles SP. Gonadal hormones affect diameter of male rat cerebral arteries through endothelium-dependent mechanisms. Am J Physiol Heart Circ Physiol 2000;279:511-9. 20. Hurn PD, Littleton-Kearney MT, Kirsch JR, Dharnarajan AM, Traystman RJ. Postischemic cerebral blood flow recovery in the female: effect of 17B-estradiol. J Cereb Blood Flow Metab 1995;15:666-72. 21. Matteis M, Troisi E, Monaldo BC, Caltagirone C, Silvestrini M. Age and Sex Differences in Cerebral Hemodynamics. A Transcranial Doppler Study. Stroke 1998;29:963-7. 22. Segura T, Serena J, Plaza I, Monforte C, Figuerola A, Davalos A. Normal values for transcranial doppler studies in our medium. Neurologia 1999;14:437-44. 23. Shafe M, Blaivas M, Hooker E, Straus I. Noninvasive intracranial cerebral flow velocity evaluation in the emergency department by emergency physicians. Acad Emerg Med 2004;11:774-7. 24. Linderoth B, Herregodts P, Meyerson BA. Sympathetic mediation of peripheral vasodilation induced by spinal cord stimulation: Animal studies of the role of cholinergic and adrenergic receptor subtypes. Neurosurgery 1994;35:711-9. 25. Patel S, Huang DL, Sagher O. Sympathetic mechanisms in cerebral blood flow alterations induced by spinal cord stimulation. J Neurosurg 2003;99:754-61. 26. Visocchi M, Argiolas L, Meglio M, et al. Spinal cord stimulation and early experimental cerebral spasm: The “functional monitoring” and the “preventing effect”. Acta Neurochir (Wien) 2001;143:177-85. 27. Doba N, Reis DJ. Changes in regional blood flow and cardiodynamics evoked by electrical stimulation of the fastigial nucleus in the cat and their similarity to orthostatic reflexes. J Physiol 1972;227:729-47. 28. Iadecola C, Nakai M, Mraovitch S, Ruggiero DA, Tucker LW, Reis DC. Global increase in cerebral metabolism and blood flow produced by focal electrical stimulation of dorsal medullary reticular formation in rat. Brain Res 1983;272:101-14.
29. Croom JE, Foreman RD, Chandler MJ, Barron KW. Cutaneous vasodilation during dorsal column stimulation is mediated by dorsal roots and calcitonin gene related peptide. Am J Physiol 1997;272:950-7. 30. Göksel HM, Karadağ Ö, Turaçlar U, Taş F, Öztoprak İ. Nitric oxide synthase inhibition attenuates vasoactive response to spinal cord stimulation in an experimental cerebral vasospasm model. Acta Neurochir (Wien) 2001;143:383-91. 31. Croom JE, Foreman RD, Chandler MJ, Koss MC, Barron KW. Role of nitric oxide in cutaneous blood flow increases in the rat hind paw during dorsal column stimulation. Neurosurgery. 1997;40:565-71. 32. Tanaka S, Komori N, Barron KW, Chandler MJ, Linderoth B, Foreman D. Mechanisms of sustained cutaneous vasodilatation induced by spinal cord stimulation, Auton Neurosci 2004;114:55-60. 33. Edgley SA, Eyre JA, Lemon RN, Miller S. Comparison of activation of corticospinal neurons and spinal motor neurons by magnetic and electrical transcranial stimulation in the lumbosacral cord of anesthetized monkey. Brain 1997;120:839-53. 34. Kobayashi M, Pascual-Leone A. Transcranial magnetic stimulation in neurology. The Lancet 2003;2:145-56. 35. Wilson DM. Relative refractoriness and patterned scharge of locus flight motor neurons. J Exp Biol 1964;4:191-205. 36. Chen R, Classen J, Gerloff C. Depression of motor cortex excitability by low-frequency transcranial magnetic stimulation. Neurology 1997;48:1398-403. 37. Pascal-Leone A, Tormos JM, Keenan J, Tarazona F, Canete C, Calata MD. Study and modulation of human cortical excitability with transcranial magnetic stimulation. J Clin Neurophysiol 1998;15:333-43. Corresponding author Ünal Özüm MD, Cumhuriyet University Faculty of Medicine, Department of Neurosurgery, Sivas, Turkey, E-mail: ozum@cumhuriyet.edu.tr
Journal of Society for development in new net environment in B&H
1999
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Activities to prevent common types of maltreatment of Slovenian nursing home residents: the nursing staff viewpoint
Ana Habjanic1, Satu Elo2, Arja Isola2, Dusanka Micetic-Turk3
1 2 3
Faculty of Health Sciences, University of Maribor, Slovenia, Faculty of Medicine, Institute of Health Sciences, Faculty of Oulu, Finland, University Clinical Center Maribor, Slovenia.
Abstract Research into the maltreatment of residents in nursing homes has been neglected because of the risk of personal exposure and negative stereotypes. In modern society it is important to try to improve the established routines and habits that make maltreatment possible. The aim of this study was to examine the maltreatment of nursing home residents and find solutions for its prevention, from the nursing staff viewpoint. A cross-sectional study design was used, with structured questionnaires and unstructured interviews. The sample consisted of nursing staff members from fourteen nursing homes in Slovenia (survey: n=148; interview: n=20). The resulting data was processed by means of statistical analysis and conventional content analysis. The nursing staff made suggestions on how to improve food intake, protection of intimacy and daily walks but could not offer solutions for better privacy or improved cleaning. In the long term, elder care needs to suppress existing “practicality” issues in the activities of daily care and reconsider nursing ethics in a plea for more attention and respect for older people. Key words: elder care, maltreatment, nursing home, nursing staff, residents Introduction Maltreatment in general and especially in nursing homes was difficult to recognise and to study in the past (1-3). Only vague statistical data exi2000
sts about victims, ranging from 4-9% among the entire older population (65 years and over), with no systematic study of nursing homes (4, 5). Elder maltreatment/mistreatment may primarily originate from outsight, for example by family members, and may therefore be generally linked to financial exploitation (6-8). The nursing staff plays an important role in preventing elder maltreatment because its members are often the first and only health care providers who have direct access to residents that are being maltreated. The trust in and respect that residents have for nurses gives them the opportunity to identify residents who are being maltreated, since residents often disclose their domestic abusive situations to nurses. However, nurses are often afraid to get involved, owing to lack of adequate training or inexperience with intervention in cases of maltreatment and abuse (9). A literature search about elder maltreatment in nursing homes conducted via the electronic databases of CINAHL, Medline and Science direct resulted in 213 non-overlapping hits. The search terms “nursing home” and “maltreatment” were used in selecting the period of the last 20 years, from 1990 to 2010. The term “maltreatment” was replaced by the term “abuse” and the term “nursing home” by the term “long-term care”. The inclusion criteria for the literature search required the terms to be found in titles or abstracts or as keywords. The literature search was performed as suggested by Whittemore and Knafl (10). After the review of abstracts, 56 papers were found to be related to maltreatment in nursing homes. An ad-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
ditional 23 papers were hand picked by reviewing papers that were extracted by electronic search. The literature revealed no comprehensive definition for maltreatment of the elderly. Generally speaking, maltreatment refers to any intentional behaviour involving either physical or mental force that causes an insult to an elder’s person or property and causes him/her to suffer (11). According to Pillemer and Moore (12), maltreatment in institutional custody consists of negligence in care, psychic or physical maltreatment. This definition was later adopted and confirmed by several researchers (13-16). Research in resent years has been oriented towards recognition of various types of maltreatment, with the goal of identifying the most urgent incidents. In a study conducted by Isola et al. (17), staff members estimated negligence to be the most common type of maltreatment; leaving residents unnecessarily alone was the most commonly reported incident. Malmedal et al. (16) reported that entering a resident’s room without knocking was frequently observed by staff members. Of the types of physical maltreatment, unnecessary physical restraint was documented as the most common (16, 17). Saarnio et al. (18) and Jakobsen and Sørlie (19) reported that on various occasions restraints were used too often where they could have been avoided. Most of the preventive strategies against maltreatment found in the literature were oriented towards inadequate food intake by residents, since this represents a major health risk for dehydration and malnutrition (20-22). In the USA, for example, “feeding assistants” were qualified to help regular nursing home staff during mealtimes (23). Instances of abuse were brought into consideration owing to lack of personnel, physical strain, low job satisfaction, burnout and high turnover rates (24-27). Where there is no improvement, such conditions may finally lead to the inability to provide sufficient competent nursing staff for institutional elder care provision (28). Better education and staff training were also addressed as possible prevention measures against abuse; so, for example, unskilled communication may increase tensions between residents and staff (29, 30). The literature did not provide comprehensive solutions for elder abuse prevention, yet indicated that step by step solutions may improve overall conditions.
Aim The aim of this study was to identify the most common types of elder maltreatment in nursing homes from the point of view of the nursing staff and to provide suggestions for reducing these incidents. Methods Quantitative study (1st phase) Instrument of the study The structured questionnaire for identifying maltreatment among residents was formulated by Isola and her colleagues (13). The questionnaire included 23 items. Translation into Slovene was done according to the guidelines by Harkness (31). The original questionnaire items offered no inconvenience or offence for study participants with regard to cultural sensitivity. Therefore, all items were translated into Slovene without changes. The nursing staff were asked to indicate whether they had witnessed instances of maltreatment of the elderly in their wards. Those who had witnessed such instances were asked to estimate the frequency of maltreatment. The response alternatives were as follows: daily, once a week, at least once a month, seldom, never and cannot say. Survey sample The data were collected in Slovenian nursing homes from two major cities, Ljubljana and Maribor, and their surrounding areas. The study sample consisted of 148 staff members employed at three public and one private nursing home. According to the Slovenian Society of Social Institutions records, 86% of staff members employed in public nursing homes and 14% in private nursing homes with concession, were surveyed (32). It was also considered that in 2006, the personnel in Slovenian nursing homes comprised 90% female and 10% male workers. About 50% of these worked in nursing wards and around 25% in residence wards and dementia wards. It was difficult to select an appropriate educational scheme for the respondents, since the level of higher education among nursing staff increases yearly. The complete background data is presented in Table 1. According 2001
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
to the educational level in Slovenia, registered nurses had to finish nursing college, nursing assistants’ needed secondary school and caregivers’ needed vocational school (33). This sample of 148 members of the nursing staff represents about 5% of the Slovenian workforce in nursing homes. Table 1. Background information about participants
Background information Female Male Education Caregiver Nursing assistant Registered nurse Institution status Public nursing home Private nursing home with concession Ward Residence ward Nursing ward Dementia ward Age (years) Nursing experience (years) Experience in present job (years) Gender Total n=148 n 134 14 62 72 14 127 21 % 91 9 42 49 9 86 14
of resident maltreatment. The statistical analysis was done with SPSS software, ver. 15.0.1. (SPSS Inc., Chicago, Il). Reliability of the quantitative study The reliability of the instruments in this study was tested by Cronbach’s alpha coefficient. Based on an alpha coefficient of 0.89, above the recommended threshold of 0.7, the instrument showed good internal consistency (34). Qualitative study (2nd phase) Interview sample The interview sample included nursing staff (n=20) from ten nursing homes that were not involved in the quantitative part of the research. The idea behind this research design was to discover whether the identified types of maltreatment were also evident in other Slovenian nursing homes. The distribution of the interview sample was similar to that for the quantitative part. Gender distribution included 18 females and 2 males; the mean age was 37.3±8.2 years and the mean amount of experience in a current job was 10.4±4.9 years. Purposive sampling (35) was used in consideration of nursing home experience of at least five years. Research question The research question was developed after the survey analysis. The participants were asked how they coped with the most often identified maltreatment types and what solutions they suggested for prevention. Conventional content analysis The interviews were analysed by means of conventional content analysis (36). The transcribed interviews were read several times to obtain an overall sense of the context, as one would read a novel. The initial coding started by extracting labels or expressions from the transcribed content. As this process continued, similar labels or expressions were coded to the final coding scheme. These codes were sorted to level two categories.
31 21 83 56 34 23 mean ± SD 37.3 ± 8.6 13.3 ± 9.0 11.0 ± 8.5
The data were collected in the period from the middle of December 2006 till March 2007 by the use of structured questionnaires. The agreed number of questionnaires was sent by regular post to the head nurse of each nursing home (150 questionnaires altogether). These head nurses distributed the questionnaires among the nursing staff. In case of inquiry about questions in the questionnaire, help was provided by the head nurse of the ward. Completed questionnaires were collected and examined for missing data, and 148 questionnaires were determined to be relevant to the analysis; the response rate was 98.2%. Convenience sampling was used, stratified by gender and by nursing home wards. Statistical analysis Frequencies and percentage distributions were used to show the most commonly identified types 2002
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Level one categories (main themes) were identified from the results of the quantitative part of the study. The categories were used to organize and group codes into meaningful clusters (37, 38). For ease of understanding, codes and categories were formed through logical induction by seeking general terms that might be familiar to the broader public, and by using the terms connected to longterm care found by a literature review. To prepare for reporting the findings, exemplars for each code and category were identified from the data. Figure 1 shows the brief research design. Trustworthiness of the qualitative study The researchers personally conducted all interviews and the analysis. The next step, assuring credibility, meant the involvement of an external researcher from the field of gerontology and institutional elder care. Level II categories formed by the researchers were confirmed by the external researcher, who also analysed all the interviews at full length. Both the researchers and the external researcher were unanimous about the formation and content of the categories as discussed by Padgett (39). The confirmability of the study was further enhanced by comparing the results obtained with earlier studies and knowledge. Transferability was sought by presenting the field of elder care provision in terms of general concepts, so that a sufficient level of abstraction for the institutional elder care phenomenon could be guaranteed.
Nursing home settings The present study was conducted in 14 nursing homes in Slovenia. At present, there are 112 nursing homes in Slovenia with approximately 19,000 beds (40). By dividing the last two numbers, we can establish that the average nursing home has around 170 beds. The largest single complex is located in the 2nd largest city of Maribor and has a capacity of more then 600 beds. Other sites are much smaller and have a capacity of between 100 and 200 beds. The main difference with other, better developed European countries is that Slovenia has no smaller nursing homes (< 50 residents) and practically no nursing homes in the countryside, where many of them tend to be more exclusive and expensive (16, 41). Ethical considerations Approval for the study was obtained locally from the ethics committee of each nursing home supporting the study. Nursing staff participation in the survey was voluntary and anonymous. The participants were informed about the nature of the study and given an information sheet about the research process. Interviews were audio recorded. Nursing staff who agreed to be interviewed provided oral informed consent. In order to ensure anonymity and privacy, names of the persons involved were never displayed, and private issues not considered in the research have been erased.
Figure 1. Research design
Journal of Society for development in new net environment in B&H
2003
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
At the start of the interview, the participants were asked once again for permission to make the recording, and they were also informed of their right to stop and erase the recorded data by withdrawing from the study at any time. Results Survey (1st phase) The nursing staff noticed inappropriate behaviour towards elderly residents on a daily basis, the response range being from 0.0% to 16.6%. Physical maltreatment (especially rough handling) was not seen on a daily basis. In general, the response “never” varied from 12.4% to 66.4%, on average 36.0%. A large percentage involved the response “I can’t say”, the average being 18.7%. According to the nursing staff reports, the most problematic type of maltreatment was the inability to accompany the residents outside (16.6% reported this on a daily basis). In second place was the problem of untidy apartments (12.5% on a daily basis). The next two cases of maltreatment represented violation of intimacy (10.3% on a daily basis) followed by violation of privacy (9.6% on a daily basis). The fifth problematic maltreatment type, with 8.8% identified on a daily basis was that the residents were not appropriately fed. A detailed assessment of the maltreatment types included in the survey is shown in Table 2. Interviews (2nd phase) After identifications of the five most often mentioned maltreatment types, staff from nursing homes that were not included in the survey were asked to describe how they and the nursing homes for which they work cope with the problems. They were asked to describe potential solutions for reducing or preventing maltreatment. The main themes of the interview were driven by the quantitative study, quoted as level I category in Table 3. Codes and level II categories were derived from the interviews. Staff members claimed that daily walks represented a time-consuming obligation, one which is not scheduled as part of their responsibilities; the2004
refore, it is only from goodwill that they take residents out for walks. A female staff member said, “Daily walks are not considered as a duty.” In this issue, staff members relied mostly on outside help, for example, from relatives, volunteers and students who are completing their clinical practice in the nursing home. Nevertheless, there was one male staff member who said the following: “In our nursing home, a so called ‘interest group’ of residents has been formed, and one of the staff is appointed to take this group outside and supervise leisure activities, for approximately two hours a day.” Another female staff member added, “We try very hard to encourage capable residents to help those who have limited mobility and are unable to go out on their own. We do everything to help: we set up the wheelchair, transfer the resident to the wheelchair; we only need someone to take the resident out and provide company.” Staff members could not suggest any solutions for untidy apartments. They described the problem as resembling their own working conditions, where they have to take care of up to ten residents at the same time on their own. A female staff member said, “Our nursing home has an area of 7000 square metres, and there are four cleaners under contract.” Another female staff member said, “We are more concerned about the general condition of the apartments, so each year we renovate some. In my opinion, cleaning is sufficient, also thanks to relatives who are occasionally willing to help.” To reduce and prevent violations of intimacy, staff members gave basic guidelines that should be respected by all employees in a nursing home. They said that the closing of doors and the use of doorknob hangers will protect residents sufficiently from visitors. A female staff member said, “We mutually remind ourselves not to forget, in our haste, to close doors and to display the doorknob signs.” A further problem in securing intimacy involves multi-bed apartments, where intimate care should be screened from roommates. This could easily be done if beds were equipped with privacy curtains; unfortunately, this is not always the case. A female staff member suggested, “We should only unclothe the relevant body parts, and we should use pyjamas instead of a hospital gown.” Another female staff member pointed out that nursing homes have poor external protection, sin-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 2. Nursing staff assessment of resident maltreatment
Maltreatment 1. Negligence in care The residents are left alone (without necessary control) The residents are not given the requested help Infrequent changes of incontinence pads Inappropriate hygiene Not enough to drink Inappropriate or deficient dressing Insufficient or surplus food Untidy apartments Inability to accompany the residents outside the room Unfulfilled wishes 2. Psychic maltreatment Inappropriate relationship Use of coarse or disparaging tone in addressing residents Use of a loud, angry voice Mockery of the residents Violation of intimacy Violation of privacy 3. Physical maltreatment Inappropriate food intake (too fast, food too cold or too hot) The residents do not get the necessary therapy Exposure to unnecessary pain Rough handling Inappropriate delivery of nursing care Unnecessary physical restraint Infrequent changes of body position Daily n % Once a At least once Seldom week a month n % n 0 2 1 0 0 3 1 15 9 9 6 4 12 4 5 6 1 1 9 1 7 3 3 % 0.0 1.4 0.7 0.0 0.0 2.0 n % Never n % I can't say n % n Total %
10 6.8 2 1.4
4 2.7 3 2.0 6 4.1 6 4.1 5 3.4 4 2.7
41 27.9 70 47.6 22 15.0 147 100.0 33 22.4 72 49.0 35 23.8 147 100.0 62 42.1 41 27.9 27 18.4 147 100.0 36 24.4 72 49.0 31 21.1 147 100.0 52 35.7 61 41.8 24 16.4 146 100.0 50 34.0 64 43.6 26 17.7 147 100.0
10 6.8 2 4 0 1.4 2.7 0.0
4 2.7 3 2.0 18 12.5 13 9.0 24 16.6 15 10.3 7 4.8 6 4.1 7 4.8 7 4.8 10 0 2 3 6.8 0.0 1.4 2.1
0.7 39 26.6 72 49.0 28 19.0 147 100.0 10.4 61 42.4 19 13.2 18 12.5 144 100.0 6.2 6.2 4.1 2.7 8.2 2.8 3.4 4.1 0.7 0.7 6.2 0.7 4.8 2.1 2.1 49 33.8 18 12.4 30 20.7 145 100.0 71 48.6 32 21.9 21 14.4 146 100.0 48 32.9 28 19.2 45 30.8 146 100.0 38 26.0 70 47.9 22 15.2 146 100.0 60 29 54 53 41.1 20.0 37.0 36.2 33 82 44 49 22.6 56.5 30.1 33.6 22 27 26 21 15.1 18.6 17.8 14.4 146 145 146 146 100.0 100.0 100.0 100.0
12 8.2 5 9 3 15 14 3.4 6.2 2.1 10.3 9.6
13 8.8 1 0 0 9 6 5 0.7 0.0 0.0 6.2 4.2
6 4.1 0 0.0 8 5.5 0 0.0 7 4.8 4 2.8
46 31.3 50 34.0 31 21.1 147 100.0 32 22.1 76 52.4 35 24.1 145 100.0 54 37.3 45 31.0 29 20.0 145 100.0 23 15.8 97 66.4 25 17.1 146 100.0 59 40.4 46 31.5 18 12.3 146 100.0 44 30.6 39 27.1 48 33.3 144 100.0 83 56.9 30 20.5 15 10.3 146 100.0
3.4 10 6.8
ce practically anyone has the opportunity to walk through the corridors and enter the apartments. When it comes to privacy protection, nursing staff stated that they do knock on doors or ring the bell before entering. One female staff member was very critical on the subject of privacy: “It is often very difficult to respect privacy, since residents are annoyed by the bell, or they do not hear gentle
knocking, and you can wait ages by the entrance. When I am to enter multi-bed apartments, I knock on the door, wait a few seconds and then enter the room.” Generally, nursing staff described a failure to acknowledge that these apartments serve as new homes for older people. A female staff member said, “I believe that for too many of us nursing home residents are considered as patients.” 2005
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 3. Codes extracted and categories formed (major themes)
Level I category Level II category outside help Daily walks staff duty inside help lack of staff outside help doorway protection indoor protection entrance protection good manners changing perceptions about nursing home mealtime strategies outside help Codes (words, expressions) cooperation between wards; pupils and students; external help; volunteers; young people without jobs schedule; lack of staff; working group for leisure activities; not considered as a duty cooperation between residents lack of cleaning staff family involvement closing doors; “care in progress” doorknob hangers privacy curtains; unclothing only the necessary body parts; using pyjamas instead of a hospital gown preventing access by strangers knocking on the door; ringing a bell poor consideration of nursing home as a home for residents priority; cooperation between wards; provision of meals in stages family involvement
Untidy apartments
Violation of intimacy
Violation of privacy
Inappropriate food intake
A majority of nursing staff described mealtimes as a priority task in their workplace. Thus, many different strategies were adopted to enable safe, timely and sufficient food intake during lunch and supper time. The highest level of satisfaction was reported for provision of meals in stages, so that lunch time was not limited to one hour only but was extended by the use of thermo-regulated food depositories. One female staff member said, “At our nursing home we keep food warm, and we serve meals in stages when we have enough time. Basically, overall we don’t save any time, but it is much easier to arrange things in case of unforeseen incidents, and I also find it very important not to show signs of nervousness in front of the frail residents.” Another female staff member added: “Even if we do get behind, we have more options to get help; sometimes we can count on staff from other wards, local physiotherapists or relatives.” During lunch or supper time, family involvement was described as most appreciated. A female staff member said, “We have some relatives who are amazing: they feed their own and even other residents. They are really a great support for us; unfortunately such behaviour is found only among the minority.”
Discussion The results obtained in our study of most common types of maltreatment from the point of view of the nursing staff were not surprising, these types have also been reported in other studies (16, 17, 42). In considering the results, we took our research a step further, towards nursing homes’ coping strategies for these persistent problems. The nursing staff were able to make suggestions about how to improve food intake, protection of intimacy and daily walks, but could not offer solutions for better privacy or improved cleaning. Malnutrition represents a huge problem in nursing homes, owing to lack of staff and the concomitant speed of food intake (20, 21). According to Simmons & Schnelle (23), the time required for mealtime assistance should be between 35 and 40 minutes per meal per resident, where residents who need only supervision and verbal cuing require just as much time as those who are physically dependent on staff for eating. Some nursing homes in Slovenia already follow these findings by extending lunch time from noon till 15:00 hours and supper time from 18:00 till 20:00 hours. With this strategy, residents can have the opportunity to eat their meals in the required time and also, in case of unforeseen incidents, to get help from so-
2006
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
urces outside the ward or institution, for example, from the family. Staff members reported the highest levels of satisfaction with such an approach. The policy in these nursing homes was to make mealtimes a priority and thus to postpone other activities during this time interval. Assuring privacy and intimacy is a continual problem in twin-bed or multi-bed nursing homes apartments (in Slovenia, this is the case in approximately 65% of all apartments). Typically, violation of privacy and intimacy results from the stressful working conditions in daily care routines (43), or from simple practical considerations (16). Practicality may be justified when it satisfies residents’ needs speedily, yet more research is needed to provide information on how to resolve ethical dilemmas in nursing practice (44). Despite this struggle, staff members described their efforts towards mutually reminding each other to close doors and to display the doorknob signs during care provision. By practicing attentive care and exposing only the relevant body parts, it is also possible to make improvements. The nursing staff were in favour of dressing residents in pyjamas instead of the popular hospital gowns. If it were possible to follow such attentive care practices on a long term basis, the overall time delay should be limited. To maintain a decent quality of life for nursing home residents, daily walks should be considered as a duty, since this is the best opportunity for residents to make conversation and express their feelings (45, 46). Unfortunately, this is seldom the case because of staff overburden; therefore, some nursing homes reported the scheduling of outside leisure activities for approximately two hours daily. One staff member is appointed to assemble the residents and organise activities with the help of students and other volunteers. Such gatherings may also serve as an opportunity to encourage capable residents to help those who have limited mobility and are unable to go out on their own. Basically, the solution is multifaceted, where by forming a group of people, it becomes easier to find ideas for various activities and also someone capable of overseeing individual activity. It is important to consider that some residents are more interested in reading newspapers, others in playing cards and others in enjoying the fresh air (47).
Conclusion Our research included fourteen nursing homes throughout Slovenia; after conducting interviews with their nursing staff, it became apparent that the problems were similar for each site. The response of the interviewees was never surprising over the survey results, which provides further proof that the whole research design was accurate and that the results generated may be generalised. The proposed strategies for reducing maltreatment and, most importantly, for improving the well-being of residents sound simple but will require considerable effort in overcoming the rigid structure of long-term care provision. Ambitious nursing homes start clever projects that attract the public, especially the younger population and volunteers, and in that manner acquire the necessary external help. By attracting external support, these institutions may better meet the physical and emotional needs of the older population. Findings about maltreatment in nursing homes in various countries show similar results regarding its most common types. In contrast, the scientific literature offers only a small number of measures to improve present conditions. More research is therefore needed, which should provide preventive measures, directions and guidelines on how to reduce maltreatment. Also, more nursing school education about maltreatment should be available and additional training provided on how to incorporate this knowledge in clinical practice. In the long term, elder care needs to suppress existing “practicality” issues in the activities of daily care and reconsider nursing ethics in a plea for more attention and respect for older people. Acknowledgement The authors would like to thank all members of the nursing staff who agreed to be interviewed and participated in the survey.
Journal of Society for development in new net environment in B&H
2007
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
References
1. Fulmer T. Elder mistreatment. Ann Rev Nurs Res 2002; 20(1): 369–95. 2. Meeks-Sjostrom D. A comparison of three measures of elder abuse. J Nurs Scholarsh 2004; 36(3): 247–50. 3. Griffith R. Abuse and the law: A breach of duty. Nurs Resident Care 2008; 10(7): 357–61. 4. World Health Organization. World report on violence and health: Summary. Geneva: WHO, 2002. 5. House of Commons Health Committee. Elder abuse: Report of session 2003-4 vol. 1. London: TSO, 2004. 6. Choi NG, Kulick DB, Mayer J. Financial Exploitation of Elders: Analysis of Risk Factors Based on County Adult Protective Services Data. J Elder Abuse Negl 1999; 10(3/4): 39–61. 7. Payne BK. An integrated understanding of elder abuse and neglect. J Crim Justice 2002; 30(6): 535–47. 8. Bužgová R, Ivanová K. Elder abuse and mistreatment in residential settings. Nurs Ethics 2009; 16(1): 110–26. 9. Thobaben M. Elder abuse prevention. Home Health Care Manag Pract 2008; 20(2): 194–6. 10. Whittemore R, Knafl K. The integrative review: updated methodology. J Adv Nurs 2005; 52(5): 546–53. 11. Fulmer T, Guadagno L, Dyer BC, Connolly MT. Progress in elder abuse screening and assessment instruments. J Am Geriatr Soc 2004; 52(2): 297– 304. 12. Pillemer K, Moore DW. Abuse of patients in nursing homes: findings from a survey of staff. Gerontologist 1989; 29(3): 314–9. 13. Isola A, Laitinen P, Rissanen, M, Vitikainen A. Vanhusten kaltoinkohtelu: Kirjallisuuskatsaus (The maltreatment of elderly: A literature review). Hoitotiede 1995; 7(5): 206–13 (in Finnish). 14. Brandl B, Horan DL. Domestic violence in later life: An overview for health care providers. Women Health 2002; 35(2/3): 41–54. 15. Lachs MS, Pillemer K. Elder abuse. Lancet 2004; 364(9441): 1263–72.
16. Malmedal W, Ingebrigtsen O, Saveman B-I. Inadequate care in Norwegian nursing homes – as reported by nursing staff. Scand J Caring Sci 2009; 23(2): 231–42. 17. Isola A, Backman K, Voutilainen P, Rautsiala T. Quality of institutional care of older people as evaluated by nursing staff. J Clin Nurs 2008; 17(18): 2480–9. 18. Saarnio R, Isola A, Laukkala H. The use of physical restraint in institutional care of older people in Finland: nurses’ individual, communal and alternative modes of action. J Clin Nurs 2009; 18(1): 132–40. 19. Jakobsen R, Sørlie V. Dignity of older people in a nursing home: Narratives of care providers. Nurs Ethics 2010; 17(3): 289–300. 20. Crogan NL, Corbett CF. Predicting malnutrition in nursing home residents using the minimum data set. Geriatr Nurs 2002; 23(4): 224–6. 21. Elia M, Zellipour L, Stratton RJ. To screen or not to screen for adult malnutrition? Clin Nutr 2005; 24(6): 867–84. 22. Nijs K, de Graaf C, van Staveren WA, de Groot LCPGM. Malnutrition and mealtime ambiance in nursing homes. J Am Med Dir Assoc 2009; 10(4): 226–9. 23. Simmons SF, Schnelle JF. Feeding assistance needs of long-stay nursing home residents and staff time to provide care. J Am Geriatr Soc 2006; 54(6): 919–24. 24. Castle NG, Engberg J. Staff turnover and quality of care in nursing homes. Med Care 2005; 43(6): 616–26. 25. Harris DK, Benson ML. Maltreatment of patients in nursing homes: There is no safe place. Binghamton, New York: The Haworth Press Inc, 2005. 26. Mueller C, Arling G, Kane R, Bershadsky J, Holland D, Joy A. Nursing home staffing standards: Their relationship to nurse staffing levels. Gerontologist 2006; 46(1): 74–80. 27. Stričević J, Balantič Z, Turk Z, Čelan D. Ergonomic analysis of workload diminution by the use of assistive technical equipment at nursing care. HealthMED 2009; 3(3): 212–8.
2008
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
28. Robinson A, Cubit K. Caring for older people with dementia in residential care: Nursing students’ experiences. J Adv Nurs 2007; 59(3): 255–63. 29. Payne BK, Fletcher LB (2005). Elder abuse in nursing homes: Prevention and resolution strategies and barriers. J Crim Justice 2005; 33(2), 119–25. 30. DeHart D, Webb J, Cornman C. Prevention of elder mistreatment in nursing homes: competencies for direct-care staff. J Elder Abuse Negl 2009, 21(4): 360–78. 31. Harkness JA. Instrument translation. In: Harkness JA, van der Vijver FJR, Mohler PP eds. Cross-cultural survey methods. New Jersey: John Wiley & Sons, 2003: 19–34. 32. Association of Social Institutions of Slovenia. 40 let skupnosti socialnih zavodov Slovenije. Ljubljana (The 40th anniversary), SSZS, 2006 (in Slovene). http://www.ssz-slo.si/apl/doc/7B8EE17E.pdf (20.8.2010). 33. The Chamber of Nursing and Midwifery Care of Slovenia. Poklicne aktivnosti in kompetence v zdravstveni in babiški negi (Nursing and midwifery activities and competencies). Ljubljana: ZZBNS, 2008 (in Slovene). 34. http://public.edition-on.net/links/660_zdravstvena_in_babiska_nega.asp?page=6 (20.08.2010). 35. Nunnally JC, Bernstein IH. Psychometric theory (3rd ed). New York: McGraw-Hill, 1994. 36. Polit DF, Beck CT. Nursing research: Principles and methods (7th ed.). Philadelphia: Lippincott Williams & Wilkins, 2004. 37. Hsieh HF, Shannon SE. Three approaches to qualitative content analysis. Qual Health Res 2005; 15(9): 1277–88. 38. Coffey A, Atkinson P. Making sense of qualitative data: complementary research strategies. Thousand Oaks: Sage Publications, 1996. 39. Patton MQ. Qualitative research and evaluation methods. Thousand Oaks: Sage Publications, 2002. 40. Padgett DK. Qualitative methods in social work research: challenges and rewards. Thousand Oaks: Sage Publications, 1998.
41. Association of Social Institutions of Slovenia. Splošno o domovih in posebnih zavodih (General information about nursing homes). Ljubljana: SSZS, 2010 (in Slovene). http:/www.ssz-slo.si/slo/ main.asp?id=2361E17F (5.9.2010). 42. Netten A, Bebbington A, Darton R & Forder J. Care homes for older people. Volume 1. Facilities, residents and costs. Canterbury: PSSRU, 2001. http://www.pssru.ac.uk/pdf/chop1.pdf (5.3.2011). 43. Baker MW, Heitkemper MM. The roles of nurses on interprofessional teams to combat elder mistreatment. Nurs Outlook 2005; 53(5): 253–9. 44. Ross C. Detecting and preventing elder abuse. Nurs Resident Care 2007; 9(11): 504, 506, 508. 45. Suhonen R, Stolt M, Launis V, Leino-Kilpi H. Research on ethics in nursing care for older people: A literature review. Nurs Ethics 2010; 17(3): 337– 52. 46. Bates-Jensen BM, Alessi CA, Cadogan M, LevyStorms L, Jorge J, Yoshii J, Al-Samarrai NR, Schnelle JF. The minimum data set bedfast quality indicator: Differences among nursing homes. Nurs Res 2004; 53(4): 260–72. 47. Schnelle JF, Simmons SF, Harrington C, Cadogan M, Garcia E, Bates-Jensen M. Relationship of nursing home staffing to quality of care. Health Serv Res 2004; 39(2): 225–50. 48. Harper Ice G. Daily life in a nursing home. Has it changed in 25 years? J Aging Stud 2002; 16(4): 345–59. Corresponding author Ana Habjanic, University of Maribor, Faculty of Health Sciences, Slovenia, E-mail: ana.habjanic@uni-mb.si
Journal of Society for development in new net environment in B&H
2009
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
V-Y fasciocutaneous sliding flap in the surgical treatment of invasive vulvar cancer
Srdjan Djurdjevic, Aleksandar Curcic, Mirjana Bogavac, Ljiljana Ivanovic Department of Obstetrics and Gynecology, Clinical Center of Vojvodina, Novi Sad, Serbia
Abstract Introduction: Vulvar cancer make approximately 3-5 % of all malignant female genital organs tumors. Different surgical procedures are available and the choice depends on 3 main factors : size of primary tumor, depth of penetration into stroma , and spread into regional lymph nodes. A special problem exists with treatment of tumor which covers large areas, urethra, bladder, perineum or anus. Objective: Demonstration of surgical technique in creation of V-Y sliding fasciocutaneous flap for covering the defect following the surgical excision of vulvar cancer and evaluation of obtained results. Method: Seven patients aged 59-75 years (x=65.5) were operated in the period from 2005 to 2008. After inguinal lymphadenectomy, wide local excision 4 (57.1%) and radical vulvectomy 3 (42.9%) were performed, followed by covering of the defect by V-Y fasciocutaneous flaps. Histopathological examination confirmed squamocellular type of carcinoma in all cases. Staging of the disease was determined postoperatively according to current FIGO classification. The period of monitoring and follow up was 29 months on average (24-36). Results: We applied 11 V-Y fasciocutaneous flaps (3 unilateral and 4 billateral). The average duration of operation was 155 minutes, and average blood loss was 250 ml. Regarding postoperative complications, we had 2 cases (18.2%) of partial superficial dehiscence at the junction of bilaterally created flaps. Local recurrence was recorded at one patient in the area of perianal region 36 months after the operation. Conclusion: Based on the donor-site scar, thickness and degree of flap advancement, the fasciocutaneous V-Y flap is a good method for re2010
construction of vulvoperineal defect after radical tumor excision. Key words: V-Y fasciocutaneous flap, vulvar cancer Introduction Vulvar cancer make approximately 3 - 5 % of all malignant female genital organs tumors. The rate of incidence in the countries of Western Europe and North America is 1.5 in 100,000 [1,2]. The most important or independent prognosis factor is presence of metastasis in lymph nodes [3,4]. Surgical treatment requires individual approach. Different surgical procedures are available and the choice depends on 3 main factors : size of primary tumor, depth of penetration into stroma, and spread into regional lymph nodes [5,6]. A special problem exists with treatment of tumor which covers large areas, urethra, bladder, perineum or anus. In such cases, it is possible to consider different skin-muscle flaps for covering defects caused by surgical excision [7,8]. Application of flaps requires knowledge of basic principles of plastic and reconstruction surgery. Preoperative preparation must comprise detailed plan regarding closure of defect and flap selection. Vacuum drains are mandatory and edges of a flap are sewn without tightening. Stitches are laid in layer 1 to avoid ischemia, and lesion must be checked every 6 hours with mandatory application of antibiotics [9,10]. Objective Demonstration of surgical technique in creation of V-Y sliding fasciocutaneous flap for cove-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
ring the defect following the surgical excision of vulvar cancer and evaluation of obtained results. Method Seven patients with invasive vulvar cancer, at which the primary reconstruction of the defect was covered with V-Y fasciocutaneous flaps, were operated in the period from 2005 to 2008. The age of patients ranged from 59 to 75 years (x = 65.5). Diagnosis was confirmed prior the operation, based on histopathological examination of tissue specimen obtained by multifocal biopsies from at least three different spots. Histologically, all patients had squamous cell carcinoma (5 well differentiated, 1 moderately differentiated and 1 poorly differentiated). CT examination of pelvis ( CT scan - Somatom Sensation Cardiac 64 ) was performed at all patients prior the surgery with special attention to examination of lymph nodes in lesser pelvis and inguinal regions. All patients were operated after the preparations which included ECG, internist examination, chest X ray, and standard blood and urine laboratory analyses. Stage of the disease was determined postoperatively according to contemporary FIGO (Federation International Gynecologist Obstetritian) classification, based on the presence of metastases in regional inguinal lymph nodes and the largest measured diameter of vulvar tumor. Table 1 shows clinical data of patients and applied therapeutic procedures. All patients recived preoperative prophylatic antibiotics treatment as well as heparin anticoagulation and “bandaging“ of lower extremities. All patients were asquainted with the risks of operative treatment and possible complications and their personal written consent was obtained together with the history data. Following surgical treatment, patients were sent to the Oncological Consilium at the Clinic. Since 1994 at our department “butterfly an block“ incision was replaced by separate inguinal incisions followed by second-act wide locale excision or radical vulvectomy. “S“ shaped incision is made 1 cm below the anterior superior iliac spine towards the symphysis and then convexly and vertically downwards – 4 cm beneath the pubic tubercle. Then, using sharp scissors, preparation of the fat tissue and of the superficial group of inguinal lymph nodes with strict ligation of blood vessels of this region is performed.
The great saphenous vein is ligated in the lower corner of the “S“ incision, whereas the fat tissue is removed together with lymph nodes with repeated ligation of the saphenous vein in the region of its enterance into the femoral vein [11]. Wide excision of vulvar tumor is performed depending on the localization of tumor in depth to the fascia of urogenital diaphragm, fascia lata or above the pubic bone (Figure 1). Radical vulvectomy is surgical removal of complete vulva (clitoris, labia minora and majora, posterior commissure) in depth to the above mentioned fasciae [12]. The tip of the V-Y flap, created in the shape of the triange, is marked in the region of the m. gluteus maximus projection, while blood supply is provided by fascial plexus, which receives blood from internal pudendal artery and skin-muscle perforative vascular branches [8, 13]. The skin is incised down to the underlying muscle fascia with meticulous electrocauterization. The flap is mobilized by elevating the underlying muscular fascia proximally and distally (Figure 2). The amount of mobilization can be determined according to defect size. Caution is required to avoid injury to perforators as much as possible. This flap is advanced in V-Y fashion and is secured to the recipient site, reaching the vaginal inner wall with no tension [14]. After the dog-ear is removed, the skin is closed layer by layer. Watertight closure should be performed on the vaginal mucosa. We apply Dermabond ( Ethicon Inc., Somerville, N.J.) to lower the risk of postoperative infections from the bacterial contamination and vaginal discharge (Figure 3).
Figure 1. Wide excision of vulvar tumor is performed depending on the localization of tumor in depth to the fascia of urogenital diaphragm, fascia lata or above the pubic bone 2011
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Figure 2. The flap is mobilized by elevating the underlying muscular fascia proximally and distally
Figure 3. Watertight closure should be performed on the vaginal mucosa : Dermabond ( Ethicon Inc., Somerville, N.J.) Results Diameter of the tumor ranged from 15 to 60 mm (x = 36,4 mm). Two patients (28,6%) were in initial FIGO I stage, while remaining 5 patients (71,4%) were in advanced FIGO stages II and III. Primary surgical excision of the vulvar tumor with the histologically confirmed negative margins in the healthy tissue, which ranged between 10 to 30 mm (x = 17,7 mm), were performed at all 7 patients. Depending on the size and localization of tumor, wide local excision was performed at 4 (57,1%) patients, and radical vulvectomy at 3 (42,9%) patients. The number of removed lymph nodes on each inguinal side ranged from 11 to 19 (x = 15), and they were divided into two groups: 2012
superficial around vena saphena magna, and deep below cribriform fascia. Lymph nodes metastases were detected at 2 (28,6%) patients, which classified them into FIGO III stage of the disease. In both cases, tumors had the largest diameter of 20 mm, and the types of squamocellular carcinoma were moderately (Grade 2) and poorly (Gr 3) differentiated. At 1 patient, inguinal lymphadenectomy was not performed due the poor general health (previous cerebrovascular insult, disturbance of heart rhythm, senium). Instead, adjuvant pelvic and inguinal radiotherapy was performed postoperatively. Preoperative CT scan examination of this patient did not show enlarged inguinal and pelvic lymph nodes ( the largest diameter of the lymph node was up to 3 mm). We placed the total of 11 V-Y fasciocutaneous flaps. Depending on the size of the defect following the surgical excision of vulvar tumor, V-Y fasciocutaneous sliding flap was created at one (3- 42.9%) or both sides (4- 57.1%). The duration of the surgery was 110-240 minutes (x = 155 minutes), while average blood loss was 250 ml (150-350 ml). There were no intraoperative complications. Postoperative complications occurred at 2 patients (18.2%), who presented with partial superficial dehiscence at the junction of bilaterally created V-Y flaps in perineal region. These complications were treated conservatively. Postoperative hospital stay was on average 11.2 days [7-18]. Local recurrence was noted at 1 patient in perianal region, 3 years after the wide local tumor excision and placement of bilateral V-Y flaps. Consilium of oncologist decided to treat it with adjuvant chemoradiation. Discussion Defects in the vulvar region which came to existence after surgical tumor excision were reconstructed in the past by primary premise, skin grafts or application of flaps. Regarding functional aspects of vulva reconstruction, there is no evidence that flap application is superior to other stated methods [15,16]. Classification of flaps was done according to the layers of tissues included into the flap (sliding, fascicular, myocutaneous) as well as according to the method of vascularization. Application of fascicular flaps in vulva defects
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
reconstruction became in recent years the surgical method of choice because of ease in creation of excellent cosmetic results [17, 18]. Fascicular flap includes, besides skin and hypodermic tissue, deep fascia. Because of better vascularization through fascia, it yields better effects than skin flaps. The V-Y flap can be used to cover extensive vulvar defects in the vulvoperineal region which includes the anterior comisura, the labia majora, minora and the perineum. The apex of triangular flap is marked on the gluteal fold and the flap is an open wound margin. This flap is supplied by underlying fascial plexus derived from perforators of the internal pudendal artery and musculocutaneous perforators of underlying muscle. The sensory supply of this flap comes from the posterior cutaneous nerve of the thigh and the pudendal nerve [8, 13]. All flaps survived withouth major complications. In two (18,2 %) patients , partial dehiscence occurred at the junction of the two advanced flaps and perineal skin, which were healed by conservative treatment which is similar to the results of PaikKwon et al., where dehiscence was detected in 3 (17.6%) cases [14]. All patients had sensation on the flap. Local recurrence occurred in only 1 (14.3%) case, 3 years after the operation, and was treated with chemoradiation. All scars from the procedure are confined to the vulvoperineal area and reconstruction is performed in a single stage. The only problem is the introduction of hairy skin of the remaining labium. Conclusion Based on the postoperative complications, incidence of local recurrence, donor-site scar, thickness and degree of flap advancement, the fasciocutaneous V-Y flap is a good method for reconstruction of vulvoperineal defect after radical tumor excision.
References
1. Sankaranarayanan R Ferlay J. Worldwide burden of gynecological caner: the size of the problem. Best Pract & Res Clin Obstet Gynecol 2006 ; 20:207-225. 2. Janda M, Obermair A, cellas D et al. Vulvar cancer patients quality of life- a qualitative assessment. Int J Gynecol Cancer 2004 ; 14:875-81. 3. Oonk MHM, Hollema H, de Hullu JA et al. Prediction of lymph node metastases on vlvar cancer - a review. Int J Gynecol Cancer 2006 ; 16:963-71. 4. Land R, Herod J, Moskovic E et al. Routine computerized tomography scanning, groin ultrasound with or without fine needle aspiration cytology in the surgical management of primary squamous cell carcinoma of the vulva. Int J Gynecol cancer 2006 ; 16: 312-7. 5. Hudson CN, Shulver H, Lowe DC. The surgery of inguino-femoral lymph nodes: is it adequate or excessive? Int J Gynecol Cancer 2004 ; 14:841-5. 6. Giselle BG, Manuel AP. An update on vulvar cancer. Am J Obstet Gynecol 2001 ; 185 : 294-7. 7. Djurdjevic S, Janjic Z, Hadzic B, Milosevic V. Invasive condylomatous vulvar carcinoma associated with multifocal low genital tract neoplasia. A case report. Eur J Gynecol Oncol 2000 ; XXI, n. 6, 5968. 8. Moschella F, Cordova A. innervated island flaps in morphofunctional vulvar reconstruction. Plastic and Reconstructive Surgery 2000 ; Vol. 105 (5), 1649-1657. 9. Persichetti P, Simone P, Berloco M et al. Vulvo-perineal reconstruction: Medial thigh septo-fascioal island flap. Ann Plast Surg 2003 ; 50; 85-9. 10. Höckel M, Dornhofer N. Anatomical reconstruction of After Vulvectomy. Obstet Gynecol 2004 ; 103:1125-8. 11. Djurdjevic S, Segedi D. Block dissection of inguinofemoral lymph nodes using separate ”S” incision in surgical treatment of vulvar carcinoma. Med Pregl 2004 ; LVII (7-8) : 343-8. 12. Hacker N.F. Current Management of Early Vulvar cancer. Ann Acad Med Singapore 1998; 27 : 68892.
Journal of Society for development in new net environment in B&H
2013
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
13. Carramaschi F, Ramos ML, Nisida AC et al. V-Y flap for perineal reconstruction following modified approach to vulvectomy in vulvar cancer. Int J Gynecol Obstet 1999 ; 65:157-.161. 14. Paik-Kwon L, Moon-Seop C, Sang-Tae A et al. Gluteal Fold V-Y Advancment Flap for Vulvar and vaginal Reconstruction: A new Flap. Plastic and Reconstructive Surgery 2006 ; Vol. 118 (2) : 401-6. 15. Reid R. Local and distant skin flaps in the reconstruction of vulvar deformities. Am J Obstet gynecol 1997 ; 177:1372-83. 16. Landoni F, Proserpio M, Maneo A et al. Repair of the perineal defect after radical vulvar surgery: Derect closure versus skin flaps reconstruction. Australian and New Zeland Journal of Obstet and Gynecol 2008 ; Vol 35 (3): 300-4. 17. Hashimoto I, Nakanishi H, Nagae H et al. The gluteal-fold flap for vulvar anatomical reconstruction: Anatomic study and adjustment on flap volume. Plast Reconstr Surg 2001 ; 108:1998-2002. 18. Paul A. Bourne. Sociodemographic correlates of age at sexual debut among women of the reproductive years in a middle-income developing nation. HealthMED, 2011, Volume 5, Number 1: 3-17.
Correspondings authors Srdjan Djurdjevic, Department of Gynecology and Obstetrics, Clinical Center of Vojvodina, Novi Sad, Serbia, E-mail: winter@eunet.rs Mirjana Bogavac, Department of Gynecology and Obstetrics, Clinical Center of Vojvodina, Novi Sad, Serbia, E-mail. mbogavac@yahoo.com
2014
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Investigation of the work accidents based on the statement of the nurses at the hospital in Turkey
Ceylanım Ceylan1, Ayşe Beşer2
1 2
Dokuz Eylul University Education and Research Hospital, Inciraltı, Izmir,Turkey, Dokuz Eylul University School of Nursing, Inciraltı, Izmir,Turkey.
Abstract Aim: This study aims to investigate the work accidents considering the statements of the nurses working in a university hospital. Methods: This is a descriptive study. All the nurses (527) working in the hospital were tried to be reached. 71.4 percent of them agreed to participate in the study (n=405). By the survey form consisting of nineteenth questions; socio-demographic characteristics, work history and the work accidents of the last six months were investigated. Results: The mean age of the nurses was 32.3±0.3. 60 percent of the nurses were married, 29.1 percent had less than four years of professional experience, and 33.1 percent were working in the surgical units. Nurses thought that chemicals like medicines had the worst effects for their health. The ratio of the work accidents experienced by nurses in the last six months was 60 %. Cutting and piercing injuries accounted for the biggest part of the work accidents (42%). Work accident ratio was found higher for the nurses working in the surgical units less than four years. Ratio of verbal violence encountered by nurses was found higher than physical violence. Glide and fall injuries were caused mostly by slippery ground. Conclusion: The results are important for hospital management to take necessary precautions and for other institutions, as well. Key Words: nurse, work accidents, accident type, hospital
Introduction Healthy and safe work environment is crucial especially for health workers. Considering this fact, International Council of Nurses (ICN) based its 2006 topic on safe environment and safe employment and 2007 topic on positive practice and work environment (1). In a work environment, healthy workers were reported to improve health condition and life quality of the patients (2). 70 percent of the nurses work in hospitals and frequently encounter dangers in the work environment (3). Nurses spend more time with patients and directly deal with their treatment; therefore, the possibility of health risk is higher for them than other health workers (2). Nursing includes stress related risk factors such as long work periods, excessive workloads, time oppression, difficult or complex tasks, insufficient recreational breaks, monotone and physically bad working conditions (place, temperature, lightning etc.). Nurses work in dangerous and risky environment, which increases the rate of work accidents. Present or possible dangers and risks in the work environment were reported to increase professional diseases, work accidents, health problems related to work, disability and inability situations, and to create similar conditions (4). Cutting-piercing injuries, being exposed to blood and body fluids, splash of blood and body fluids on mucose membranes, glide-fall and violence are among the work accidents most frequently encountered by health workers (5). Cutting and piercing injuries were reported as the most frequent work accident type, and needle piercing as its most frequent form (6). 2015
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Nursing, in which needles are most frequently used, is under serious risk of contagious disease caused by accidental needle piercing. In the study made by National Institute for Occupational Safety and Health (NIOSH) on 2.247 health workers in 2002, 155 individuals were determined to experience cutting-piercing injury (7). Another important work accident was being to exposed to blood and body fluids. In a study conducted among the health workers in seven different rural regions of India, the rate of being exposed to blood and body fluids in the last year was 63%, and the nurses comprised 42.6% of this case (8). These rates show similarity in Turkey, too (9). Splash of blood and body fluid on mucose membranes is another accident source. In a study conducted in Turkey, splash of blood and body fluid on mucose membrane was seen in 57% of the nurses during cutting tool injuries (10). Violence at workplace is defined as a problem related to working environment that affects the productivity and safety of the workers negatively (11, 12). In a study conducted in England, 72.8% of the health workers were exposed to non-physical violence and 21.3% to physical violence in 12 months (13). And in the studies conducted in the hospitals of Turkey, violence rate was reported as 60% (14, 15). Corporal illness was reported to be higher in nurses than other health personnel. And the most important reason of this situation was the glide-fall injuries. In a study investigating the tissue trauma and injuries of 209 medical personnel, 47% of them was caused during the transportation of patients, 45% by collision and 48% by glide-fall (16). Determining the work accidents encountered during the execution of the work would be beneficial to take necessary precautions. The number of studies on this subject is very limited in Turkey, and there is no national data at present. Findings obtained in this study demonstrate the importance of the subject by determining the work accidents of nurses, and therefore, be guiding principles to take necessary precautions. For this reason, it was aimed to determine the rate of the total accidents of the last six months and effective variables, based on the statements of the nurses working in the hospital.
Methods Type of Research Study was planned as a descriptive research. Sample In the study, it was aimed to reach 567 nurses working in the Practice and Research Hospital of the Dokuz Eylül University; therefore, no sampling was made. Units of the nurses consisted of emergency, surgery and intensive care units (n=179), internal services (n=132), surgical services (n=167), polyclinics (n=11), special centers (n=67) and administrative units (n=11). 71.4 % of the nurses could be reached (Table 2). The reasons for inability to reach the nurses were 35% of passive denial (postponement to a later date and not showing up or re-postponement), 30% of refusal to participation, 30 % of inability to find in their work plots, and 5% of unclear reasons. Instrument Data were collected with questionnaire forms covering socio-demographic characteristics and work history after examining the literature on the subject. Work accidents (within the last six moths) were considered in seven different groups as follows: cutting-piercing injuries, being exposed to blood and body fluids, splash of blood and body fluids on mucose membrane, tissue trauma caused by gliding-falling, being exposed to aggression and having traffic accident on way to work and others. Data Collection Data were collected by the researcher. Each interview was completed in 15 minutes. Data Analysis The Statistical Package for Social Sciences (SPSS 15.0) was used to compute frequency and
2016
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
descriptive statistics related to demographic data. Chi-square analysis was applied between the work accidents of the last six months and the variables of socio-demographic and work history. Statistical significance was set at p<0.05. Ethics Consideration Ethical committee approval was granted by Dokuz Eylül University, School of Nursing to conduct the study. Written consent to collect data was obtained from Practice and Research Hospital of Dokuz Eylül University. The purpose of the study was explained to each nurse, and their consent was asked to participate in study. Results Demographics 60 % of the nurses were married. 66.4% were university graduates, and 28.6% had associate degree. 72.8% of them had 5-8 hours of daily sleep. The mean age of the nurses was 32.3±0.3. 29.1% of the nurses had 0-4 years of work experience. 38.3% had been working for this institute 0-4 years. 33.1% were working in the surgical services, and 27.4% in internal services. 58.5% had been working in the same service for 0-5 years. Daily work hours of 79.5% were between 10-14 h. and weekly working days of 95.6% were between 4-6 days. 79.3% were working on shift basis, and 20.6% had 9 or more shifts. 60.7% were pleased of their units. 66.2% thought that there were materials-appliances-machineries in the workplace to affect their health condition negatively. 72.3% didn’t take any training on work accidents and protective methods. The Accident Types of the Last Six Months 60 % of the nurses (243) stated to have work accident within the last six months. Distribution of the work accident types was given in Table 1. 42% of the nurses were exposed to cutting-piercing injuries, 30.1% blood and body fluids, 13.6% splash of blood and body fluids on mucose membrane, 9.6%
gliding-falling injuries, 21.5% aggression and 3.7% traffic accident on their way to work (Table 1). Table 1. Distribution of the work accident types of the nurses within the last six months (n=243)
Work Accident Types Number* Percentage (%) Cutting and Piercing 170 42.0 Injuries Exposing to Blood and 122 30.1 Body Fluids Splash of Blood and Body Fluids on 55 13.6 Mucose Membranes Glide-Fall Accidents 39 9.6 Exposing to Violence 87 21.5 Traffic Accident on 15 3.7 way home or work Others 13 3.2
* More than one option selected
Comparison of the Accident Types of the Last Six Months Considering the SocioDemographic Characteristics of the Nurses Results of the statistical analysis are given in Table 2. Difference between the marital status of the nurses and accident occurrence was found statistically significant (p=0.025). Single nurses had accidents more frequently than married ones. Difference between the graduated schools and accidents occurrence was found statistically significant (p=0.043). Difference was derived from the nurses graduated from Open University (distance learning). All the Open University graduates had accident. Difference between the daily sleep time and accident occurrence was found statistically significant (p=0.018). Difference was derived from the nurses sleeping over 8 hours a day. These nurses had less accident (Table 2). Comparison of the Accident Cases according to Work History of the Nurses Related results of the statistical analysis are given in Table 3. Difference between accident occurrence and occupational period of the nurses was found statistically significant (p=0.002). Nurses with less than four years work experience had more accidents. 2017
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 2. Comparison of the work accidents within the last six months according to socio-demographic characteristics of the nurses (n=405)
Socio-Demographic Characteristics Marital Status Married Single Education Level Undergraduate Two Years Degree Open University Health Vocational Highschool Daily Sleep Time Less than 5 h 5-8 h More than 8 h Total Having Work Accident Yes Number 135 108 162 64 3 14 17 188 38 243 % 55.6 66.7 60.2 55.2 100.0 82.4 60.7 63.7 46.3 60.0 No Number 108 54 107 52 0 3 11 107 44 162 % 44.4 33.3 39.8 44.8 0.0 17.6 39.3 36.3 53.7 40.0 Total Number % 243 162 269 116 3 17 28 295 82 405 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 100.0 c2 p
5.000
0.025*
8.141
0.043*
8.089
0.018*
*p<0.05
Difference between accident occurrence and the period nurses spent in the same institution was found statistically significant (p=0.036) (Table 3). Nurses working in the same institution for less than four years had more accidents. Difference between the units where the nurses worked and the accident occurrence was found statistically significant (p=0.001) (Table 3). Nurses working in emergency, surgery and intensive care units had more accidents. And the difference between the shift number per month and accident occurrence was found statistically significant (p=0.000) (Table 3). Nurses having nine or more shifts had more work accidents. On the other hand, the difference between the accident occurrence and working with appliances and materials having harmful effects on human health was found statistically significant (p=0.000) (Table 3). Nurses working with this kind of elements had more work accidents. Discussion In this study, more than half of the nurses were found to have work accident within the last six months. In similar studies, accident rate changed between 25-60% (13,16). In a study carried out in Turkey, it was reported that 55% of the nurses 2018
working in the hospital had work accident (17). In this study, rate of having training on protective methods against work accidents was determined highly low. From this respect, high accident rate of nurses could be caused by the lacking knowledge on protective methods, and the lacking precautions due to the fact that many accidents weren’t reported. Every accident is important and suggestive for the later possible accidents. Therefore, accidents should be investigated in detail, and necessary precautions should be taken. Characteristics of the Work Accidents of the Last Six Months In the study, the most frequent accident was found cutting-piercing injuries. Majority of the nurses had this kind of accident 1-2 time(s), which was a highly significant result. In a study carried out in Egypt, the most frequent work accident experienced by the health workers was found to be cutting-piercing injuries (35.6%), and the reasons were the inadequate use of protective methods (18). In a study carried out in Turkey, it was reported that 51.9% of the nurses had cutting-piercing injuries during closing the cover of the syringe (17). In this study, the reason for the most frequ-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 3. Comparison of the Work Accidents Considering the Work Histories of the Nurses (n=405)
Having Work Accident Work History Characteristics Professional Experience 0-4 year 5-9 year 10-14 year More than 15 year Work Period 0-4 year 5-9 year 10-14 year More than 15 year Working Units Emergency, Operating Room and Intensive Care Internal Units Surgical Units polyclinics Special Centers Work Period in the Unit 0-5 year 6-11 year More than 12 year Daily Work Hours 5 hours 8 hours 10-14 hours Work days in a week 0-3 day 4-6 day Working on shift Yes No Shift Number in a Month Hiç 1-2 times 3-5 times 6-8 times More than 9 times Satisfaction Level from Units Satisfied Unsatisfied Other Use of equipments that might be harmful for health Yes No Training on Work Accidents Yes No Total Yes Number % 88 49 53 53 107 49 43 44 47 73 94 3 26 151 62 30 2 44 197 8 235 199 44 37 20 34 71 81 153 61 29 184 59 74 169 243 74.6 51.6 55.8 54.6 69.0 55.1 54.4 53.7 44.3 65.8 70.1 60.0 53.1 63.7 53.4 57.7 50.0 55.7 61.2 44.4 60.7 62.0 52.4 50.0 66.7 46.6 58.7 75.7 62.2 56.0 58.0 68.7 43.1 66.1 57.7 60.0 No Number 30 46 42 44 48 40 36 38 59 38 40 2 23 86 54 22 2 35 125 10 152 122 40 37 10 39 50 26 93 48 21 84 78 38 124 162 % 25.4 48.4 44.2 45.4 31.0 44.9 45.6 46.3 Total Number % 118 95 95 97 155 89 79 82 c2 p
100.0 100.0 15.117 0.002* 100.0 100.0 100.0 100.0 8.570 100.0 100.0 100.0 100.0 19.104 0.001* 100.0 100.0 100.0 100.0 3.552 100.0 100.0 100.0 100.0 100.0 0.963 0.169 0.036*
55.7 106 34.2 29.9 40.0 46.9 36.3 46.6 42.3 111 134 5 49 237 116 52
50.0 4 44.3 79 38.8 322 55.6 18 39.3 387 38.0 321 47.6 84 50.0 33.3 53.4 41.3 24.3 37.8 44.0 42.0 31.3 56.9 74 30 73 121 107 246 109 50 268 137
0.618
100.0 1.281 100.0 100.0 2.563 100.0
0.258 0.109
100.0 100.0 20.199 0.000* 100.0 100.0 100.0 100.0 1.317 100.0 100.0 100.0 100.0 0.518
24.738 0.000*
*P<0.05
33.9 112 42.3 293 40.0 405
100.0 2.378 100.0 100.0
0.123
Journal of Society for development in new net environment in B&H
2019
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
ent accident, cutting-piercing injuries, could be caused by the effort to close the cover of the needle and insufficient use of the protectors. In addition, the nurses were forced to carry out many tasks in a short time, protective materials (like glows, treatment tray etc.) were inadequate and nurses didn’t follow the necessary protection procedures. Rate of the nurses reporting an accident was rather low, which indicates that they should be more informed on the subject. Nurses were exposed to blood and body fluids 1-2 time(s) during the treatment of the patients (aspiration, mouth care etc.) and the intravenous injection. In a study carried out in France, this kind of accident was reported to occur most frequently during injection or taking blood (19). In this study, majority of the nurses exposed to blood and body fluids were employed in the services requiring urgent intervention. Most important reasons for this were found as the inadequate numbers of protective materials, lacking knowledge on the subject and intensive working conditions. Nurses should be trained on the possible health risks and the protection methods. In the study, it was determined that nurses were exposed to splash of blood and body fluids on mucose membranes maximum 1-2 time(s). These accidents occurred during the treatment of the patients and in the mid and last four hours of the shift. Participant nurses stated that they couldn’t be protected due to the lack of protective materials, and most of them didn’t report the accident. Trape et al. reported that 55% of the nurses had accident during intravenous injection, and 92% didn’t report accidents because they disregarded the accidents due to the high occurrence frequency, and also they didn’t have sufficient time (20). In this study, the reasons why the nurses didn’t use protective materials were the high work density and the inexistence of these materials in the work units. Nurses had glide-fall injuries 1-2 time(s). Theses accidents occurred in the services, and most of the nurses didn’t report the accidents, nor did they take any action afterwards. In a another study, it was reported that 48% suffered from muscle-skeleton injuries due to the gliding, and 47% due to the impact (21). In a study carried out in Turkey, wet ground and that nurses had to lift the patients during the transportation were showed as the rea2020
sons for glide-fall accidents (22). To prevent glide-fall accidents, environment should be kept in order, and ground shouldn’t be left wet after cleaning. In this study, high rate of glide-fall accidents could be caused by these facts. 27.6% of the nurses were exposed to violence five or more times, and the most common of them was verbal violence. In a study carried out in Kuwait, it was determined that 48% of the nurses were exposed to verbal violence, and 7% to physical ones (23). In a similar study carried out in İzmir-Turkey, it was reported that the nurses were exposed to verbal violence more frequently (24). They stated to encounter violence generally at the beginning of the dayshift. In a another study was reported that the 38 nurses were exposed to mobbing. And 55.2% of them were graduates of bachelor degree and 52.7% of them were single. Moreover 86.9% of them are service nurses and 63.2% of them are working in clinics of interior branches (12). In this study, the reason why the nurses were exposed to violence in the first hours could be the fact that their work stress was increased, for they had to carry out daily routines in a little time. Violence generally occurred in patient rooms. Most of the nurses didn’t report the violence, and 47.1% didn’t take any action. This problem should be reported to management to take the necessary precautions. The dimensions of the communication between patients and nurses should be evaluated. The reason why nurses didn’t take any action after being exposed to violence could be either their disregard or the insufficient safety precautions. Most of the nurses stated to have traffic accident 1-2 time(s) on the way to home or work. The most important reasons of the accidents were overstrain, weakness and the lack of attention caused by the work. Intoxication and burns caused by chemicals came first among the other accidents nurses had. The rate of the mercury intoxication caused by the breaking degree was 15.4%. Nurses had their accidents in the first and last four hours of the shifts. Most of the accidents occurred in the services, and nurses generally didn’t report them. Kıran determined the rate of mercury intoxication as 12% in his study (25). Intoxications caused by chemicals could lead serious health problems. Therefore, nurses should be more careful for the protective methods. Common reason why nurses
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
didn’t take any action after work accidents could be the fact that they didn’t have enough time and didn’t believe the existence of a responsible department to apply. Comparison of the Work Accidents Considering the Socio-Demographic Characteristics of Nurses In the study, single nurses were found to have more accidents than married ones. Tabak et al. reported similar findings in their study, as well (26). In this study, most of the nurses began their professional lives in the same hospital where they still worked. With the increasing work experience, they were employed in the units with lower work intensity. Most of the single nurses were the new recruits, and had less work experience than married ones; however, they were employed in the services with high risks. Theses facts could be linked to the high accident rate of single nurses. In the study, the difference between the graduated schools and accidents occurrence was found statistically significant. All the Open University graduates had work accidents. In a study, nurses with higher education level were found to have less needle accident (26). In a study carried out in Izmir-Turkey, accident rate was found lower for the nurses with higher education level (27). Open University graduates were older; therefore, they didn’t use protective equipments, which could have caused the accidents. In addition, Open University was a distant education system for the nurses graduated from health vocational high schools, and it is not being implemented in Turkey at present because it was not found beneficial. Therefore, high accident rate of these nurses could be attributed to the lacking education and skills. In the study, nurses sleeping more than eight hours a day had fewer accidents. In a study carried out in Norway, it was reported that work accidents were caused mostly due to the loss of balance after night shift (28). In another study carried out in Turkey, it was determined that nurses having sleep disorder were exposed to violence more often than others because they became more aggressive and agitated when they were sleepless (29). In this study, it was possible
that the fear for not finishing jobs in time, loss of attention and nervousness of the nurses with sleep disorder could lead the accidents. Comparison of the Work Accidents Considering the Work History of the Nurses In the study, work accident rate was found higher for the nurses working four or less years in the institute. There have been studies reporting that work accident rate was higher in less experienced nurses (8,19). However, there have also been studies stating no significant difference (29). Results obtained in this study could be attributed to the inability and inexperience of the newly recruited nurses. In the study, it was found that nurses working in the surgical units were exposed to work accident more frequently. Operating rooms, emergency and psychiatry services were the placed where work accidents occurred more frequently (10,26,29). These results could be caused by the fact that newly recruited and inexperienced nurses were employed in these services. In the study, nurses having nine or more shifts per month were found to have more work accidents. Many studies have reported that physiological, psychological and neurological problems like insomnia, loss of attention, fatigue, etc. were observed in the person working on shift, and these increased the accident possibility (18,30). In this study, shift number of the nurses was found to decrease with growing experience. Therefore, newly recruited and inexperienced nurses had more shifts in a month, and that increased their accident rate. In the study, nurses with the opinion that work equipments were harmful for their health were found to have more work accidents. In another study, the most frequent accident rate was determined for the nurses using cutting-piercing equipments like needles (31). Similar results were reported in a study implemented in Turkey (32). Working with harmful equipments increased the accident rate. Despite the high number of materials that increase the accident possibility, the number of protective materials is rather inadequate; therefore, a healthy and safe work environment should be taken into consideration once again. 2021
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Conclusions Nurses constitute a great part of the health workers. They encounter many risks and accidents during their professional lives. Lacking regulations for work environment, inadequate protective materials, low conscious and training level of nurses regarding protective methods for work risks are the factors that increase the accident rate. Therefore, in terms of ensuring the safety of personnel, institutional culture plays a very important role in dealing with the risks (33). Especially hospital managements should take necessary precautions and make surveillance on site to prevent work accidents, and the trainings should be constant. Moreover, a workplace health unit should be established to observe and investigate work accidents in every hospital, and accident reports should be kept in order. References
1. http:// www.ich.ch . Accessed, 12 June 2008. 2. Parlar S. A neglected situation in health personnel: a healthy working environment. TAF Preventive Medicine Bulletin.2008 7(6): 547-554. 3. http:// www.who.int/entity/occupational_health/regions/en/ . Accessed 23, May 2008. 4. Clarke SP, Sloane DM, Aiken LH. Effects of hospital staffing and organizational climate on needlestick injuries to nurses. AM J PUBLIC HEALTH. 2002 92(7): 1115-1119. 5. http:// www.ilo.org. Accessed, 20 June 2008. 6. Özkan Ö, Emiroğlu ON. Worker health and job security services for hospital health workers. Cumhuriyet University School of Nursing Journal. 2006 10 (3): 34-40. 7. NIOSH. Health care worker research. 2002 Ohio: 25. 8. Kermode M, Jolley D, Langkham B, Thomas MS, Crofts N. Occupational exposure to blood and risk of bloodborne virus infection among health care workers in rural North Indian Health Care Settings. AJIC 2005; 333: 4-41.
9. Azap A, Ergönül Ö, Memikoğlu K, Yeşilkaya A, Altunsoy A, Bozkurt G, Tekeli E. Occupational exposure to blood and body fluids among health care workers in Ankara Turkey.AJIC 2005; 33:48-52. 10. Sencan I, Sahin I, Yıldırım M, Yeşildal N. Unrecognized abrasions and occupational exposures to blood-borne pathogens among health care workers in Turkey. Occupational Medicine. 2004; 54:202–206. 11. Fletcher T, Brakel S, Cavanaugh L. Violence in the workplace: new perspectives in forensic mental health services in The USA. BJPsych 2000;176: 339-344. 12. Okanlı A, Karakaş AS, Ozkan H. The Relationship between mobbing and assertiveness in nurses. HealthMED. 2011;5( 3): 609-615. 13. Lanza M, Zeiss RA, Rierdan J. Non-physical violence. AAAOHN 2006; 54:9,367. 14. Alçelik A, Deniz F, Yeşildal N, Mayda AS, Şerifi BA. Assessment of health problems and life habits of nurses serving in AIBU Faculty of Medicine. TAF Preventive Medicine Bulletin 2005 4(2):55- 66. 15. Yeşildal N.Assessment of occupational accidents and violence in health services. TAF Preventive Medicine Bulletin 2005 5(4):88-115. 16. Memish A, Almuneef M, Dillon C. Epidemiology of needlestick and sharps injuries in a tertiary care center in Saudi Arabia. AJIC 2002; 30:23441. 17. Akbulut A. Infections risk and protection in the health personnel: infections which are transmitted via blood. Journal of Hospital Infections 2004; 8:132-139. 18. Talaat M, Kandeel A, Shoubary W, Bodenschatz C, Khairy I, Oun S, Mahoney FS. Occupational exposure to needlefstick injuries and hepatitis B vaccination coverage among health care workers in Egypt. AJIC 2003; 31:469-74. 19. Venier AG, Vincent A, L’Heriteau F, Floret N, Senechal H, Abiteboul D, Reyneaud E, Cougnard B, Parneix P. Surveillance of occupational blood and body fluid expoures among French healthcare workers in 2004. Infection Control Hospital Epidemiol 2007; 28:10,1196-1201.
2022
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
20. Trape-Cardoso M, Schenck P. Reducing percutaneous injuries at an academic health center: a 5-year review. American Journal of Infection Control Practice Forum 2004; 32: 5. 21. Öhman U, Bylund P, Björnstig U. Impairing injuries among medical personel. WJ NR 2002; 24:788. 22. Alpat S. Occupational risks for health workers. Society and Doctor 2009;4. 23. Salim MA, Ahmad KA, Shadia K, Najwa EG, Mariam AR. Violence against nurses in healthcare facilities in Kuwait. International Journal of Nursing Studies 2002; 39:469–478. 24. Ölmezoğlu ZB, Vatansever K, Ergör A.Assessment of İzmir metropolitan area first aid workers exposure to violence. Society and Health Journal 1999 14(6): 420-425. 25. Kıran S. Assessment of the relationship between health workers experience of occupational factors and health/complaint. Doctoral dissertation, Dokuz Eylul University Health Scientific Institution. 2003: Izmir. 26. Tabak N, Shıaabana AM, Shasha S. The health beliefs of hospital staff and the reporting of needlestick injury. JCN 2006; 15:1228–1239. 27. Turgay A, Sarı D, Genç R. Nurses’ knowledge of glove usage, needle injuries and exposure to blood-body liquids. Aegean University School of Nursing Journal 2005; 22, 365-374. 28. Eriksen W, Bruusgaard D, Knardahl S. Work factors as predictors of sickness absence: a three month prospective study of nurses’ aides. Occup Environ Med 2003; 60:271-278. 29. Hesketh KL, Duncan SM, Estabrooks CA, Reimer MA, Giovennetti P, Hyndman K, Acorn S. Workplace violence in Alberta and British Columbia Hospitals. Health Policy. 2003;63:311-321. 30. Maul I, Laubli T, Klipstein A, Krueger H. Course of low back pain among nurses: a longitudinal study across eight years. Occup Environ Med 2003;60:497-503. 31. Shah SF, Bener A, Kaabi SA, Al Khal AL, Samson S.The epidemiology of needle stick injuries among health care workers in a newly developed country. Safety Science 2006; 44:387–394.
32. Ağkoç S. Occupational Risks for Doctors, Istanbul Faculty of Medicine, A Study on Speciality for Medicine Students” Master of Medicine, 2005:Istanbul. 33. Ulusoy H, Çingöl N. Nurse Managers’ and staff nurses’ assessment and evaluation of organizational culture.HealhMED. 2011; 5(1): 136-145. Correspondence autor Ayşe Beşer, Dokuz Eylul University School of Nursing, Inciraltı, Izmir, Turkey, E-mail: ayse.beser@deu.edu.tr
Journal of Society for development in new net environment in B&H
2023
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
A Novel model for inference of gene regulatory networks
Blagoj Ristevski1, Suzana Loskovska2
1 2
Department of Information Systems Management, Faculty of Administration and Information Systems Management, St. Kliment Ohridski University – Bitola, Macedonia, Department of Computer Science and Informatics, Faculty of Electrical Engineering and Information Technologies, Ss. Cyril and Methodius University – Skopje, Macedonia.
Abstract Gene regulatory networks (GRNs) are complex networks consisted of nodes representing genes, transcription factors, microRNAs and edges that represent the interactions between nodes. GRNs can expose and depict underlying cells’ gene regulatory mechanisms. In this paper, we propose a new model for inference of GRNs. This model includes prior knowledge into network inference. Our model was applied on generated gene expression time series with different number of genes and time points and one subset of experimental data received from colorectal cancer microarray experiment. To validate the inference capabilities of the proposed model, we compare the ROC curves and AUC values for proposed model and the common used models: dynamic Bayesian networks, Boolean networks and graphical Gaussian models. The proposed model has shown competitive inference capabilities in comparison with other models. Key words: gene regulatory networks, inference models, validation, ROC curve, AUC value 1. Introduction Gene regulatory networks (GRNs) are consisted of genes, proteins, metabolites and other network components, which interact mutually. For clearer presentation and understanding of these complex biological processes, inferring of gene regulatory interactions between genes, RNAs, proteins and metabolites is required. The inference of GRNs based on available gene expression data is a very complex and difficult task considering that the raw data used for inferring contain biological and tech2024
nical noise. Additionally, microarray gene expression data refer to a smaller number of experimental conditions or time points, compared to the number of genes whose expressions are measured. These shortcomings of microarray data lessen the precision and accuracy of the networks’ inference. The accuracy and precision of an inferred network can be increased using other types of biological data and prior knowledge such as knowledge from scientific papers, protein-DNA interactions data and other available databases for gene regulatory pathways [1]. In this paper, we propose a new model for inference of GRNs. The network inference is performed in two phases. In the first phase, the model derives prior knowledge for gene regulations, whereas in the second phase, this knowledge is integrated into inference of the GRNs. The remainder of this paper is organized as follows. In the second section, we briefly describe the commonly used inference models: Boolean networks, Bayesian and dynamic Bayesian networks and graphical Gaussian models. In the following section, we describe the methodology of the proposed model for GRNs inference. The data simulations, experimental data and data transformation are described in the fourth section. Finally, the discussion and concluding remarks, as well some further directions towards improvement of GRNs inference are presented in the last section. 2. Related works One of the simplest models for reconstruction of GRNs is that based on Boolean networks. These networks are consisted of a set of nodes and
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
a set of edges, where nodes represent the genes and edges represent the interactions between genes [22]. In Boolean networks, gene expression levels are discretized and presented by two states 1 and 0, which correspond to overexpressed and underexpressed gene expression levels, respectively. Two level discretization of the gene expression data leads to information loss that lessens the accuracy of inferred networks [22]. Bayesian networks are a special type of directed acyclic graph defined as a triple (G, F, q), where G denotes the structure of the graph, F is the set of probability distributions, and q is the set of parameters for F [13]. The structure of the graph G consists of a set of n nodes X1, X2, ..., Xn and a set of directed edges between nodes. The nodes (genes) correspond to the random variables and directed edges show the conditional dependences between the random variables. The GRNs inference using Bayesian networks is accompanied by structure and parameter learning. The aim of the learning is finding the network structure and parameters, which best fit the true regulatory interactions. Because of complexity during their learning, Bayesian networks are suitable when they are applied to small networks with tens to hundred genes [14]. Bayesian networks are extended to model time features by the introduction of dynamic Bayesian networks (DBNs). The main disadvantages of dynamic Bayesian networks are their inference accuracy that depends on number of genes and the excessive computational time needed for networks learning and inference. Graphical Gaussian models (GGMs) employ partial correlation coefficients to determine the conditional independencies between genes. GGMs can distinguish direct or indirect interactions between genes, unlike the correlation networks where the edges present correlation between genes [15]. Beside of above-mentioned models, other models are used too, such as models based on Petri networks, neural networks, linear and nonlinear differential and difference equations systems. The methods which include prior biological knowledge into GRNs inference are described in [2] and [5]. To reduce insufficient accuracy of the inferred networks by above-mentioned models, we propose a new model that includes a priori knowledge.
3. Methodology of the proposed model Inferring networks using GGMs compared to Boolean networks and DBNs has shown better inference capabilities. GGMs can deal with large datasets comprised of thousands of genes, and the network inference is very fast, compared to DBNs, which can infer only small networks having tens of genes at the most [14]. Hence, we have chosen the GGMs in the first phase of the proposed model, because they are a good base for uncovering the “hub” genes, which are included in many regulatory pathways. 3.1 First phase of proposed model The GRNs structure G represents a directed acyclic graph which can be represented by adjacency matrix. The elements of the adjacency matrix Gij can be either 1 or 0, which refers to the presence or absence of a directed edge between i-th and j-th node of the network G, respectively. In the first phase, gene expression data as input datasets are used. Partial correlation coefficients are obtained by employing GGMs [7]. As a result of the first phase of the proposed model, a matrix of prior knowledge Gprior is obtained, whose elements are based on partial correlation coefficients. After computing the partial correlation coefficients, the minimum and maximum values pcormin and pcormax are calculated by Eq. 1 and Eq. 2, respectively:
p c o r m i n = m i n { p c o r i j }, 1 £ i , j £ N ....... (1) p c o r m a x = m a x { p c o r i j }, 1 £ i , j £ N ..... (2)
where pcorij is the partial coefficient between the i-th and j-th node and N is the number of genes in the network. Then, the elements of the matrix of prior knowledge Gprior are computed by the following equation:
Journal of Society for development in new net environment in B&H
2025
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
1 p c o ri j - p c o r m i n 1 + ⋅ G p r i o ri j = 2 p c o r m a x - p c o r m i n 2 ... (3) 0, i f p c o r i j < p c o r m i n o r e d g e d i r e c t i o n i s f r o m j t o i
For the elements of the matrix of prior knowledge Gpriorij the following is valid:
0 £ G p r i o r i j £ 1 ....................... (4)
e - b G p r ior (G ) P(G|b )= ................. (6) Z (b ) where the denominator is normalization constant calculated from all possible network structures G by the equation:
'
The value Gpriorij=0 denotes that there is no directed edge between i-th and j-th node, and the value Gpriorij=1 signifies the greatest clue of the presence of a directed edge between node i and node j. The closer Gpriorij to 0 is, the greater clue for absence of edge is and the closer to 1 Gpriorij is, the greater clue for presence of a directed edge between i-th and j-th gene is. The obtained matrix of prior knowledge Gprior presents a basis for the second phase of the proposed model. 3.2 Second phase To integrate the prior knowledge obtained from first phase, the second phase defines a function Gprior' as a measure of matching between the given network G and the obtained prior knowledge Gprior. This function is named as a network energy E [2]. The function Gprior' of network G with N nodes and prior knowledge Gprior obtained from the first phase is calculated according to the following equation:
Z ( b ) = ∑ e -b G pr ior
G ∈G
'
(G )
................ (7)
The parameter b determines the influence of prior knowledge employed in network inference. When b tends to 0, prior distribution does not provide information about network structure. When b ® ¥, prior distribution defined by Eq. 7 has a maximum for structures with smallest energy [1]. In the second phase of the proposed model, a structure Bayesian learning is carried out using Markov chain - Monte Carlo simulations [8] [16]. 4. Data and results To validate the proposed model for network inference, we have employed simulated and experimental gene expression time series data. We performed two kinds of simulations to gain different size datasets: Gaussian and SynTReN gene expression data. Apart from networks inference from simulated data, we used experimental data to perform GRNs inference. We used gene expression time series data obtained from colorectal cancer microarray experiment. To validate inferred networks we employed the commonly used validation criteria such as receiver operating characteristic (ROC) curve and AUC value. ROC curve is a chart where on the x-axis the false positive rate (fpr=FP/(FP+TN)) and on the y-axis the true positive rate (tpr=TP/(TP+FN)) are applied. TP, FN, TN and FP denote true positive, false negative, true negative and false positive, respectively [19] [21]. The values of the ROC cu-
G p r i o r '(G ) =
i , j =1
∑
N
G i j - G p r i o ri j
.. (5)
If prior knowledge matches with the network structure G completely, then Gprior'=0. The Gprior’ value increases if there is a significant deviation between prior knowledge and the true structure of the network G. The integration of prior knowledge Gprior is according to prior distribution of the network structure G, which follows Gibbs distribution [1], given by the following equation: 2026
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
rve belongs to the unit square in the first quadrant. If the ROC curve follows the equation y=x then it means a random guess of the class of absent or present edges. When the ROC curve is above the line y=x, the inference performance is better. The AUC value is the area covered by the ROC curve with the x-axis. The AUC values belong to the interval [0, 1], where the closer to 1 the value is, the better inference performance is [19] [21]. The inference with Boolean networks is by using the R package BoolNet [6], the dynamic Bayesian networks are inferred using the R package G1DBN [18]. The inference of GGMs networks, as well as obtaining of prior knowledge for proposed model is by employing the R package GeneNet [7]. The MCMC simulations for the second phase of the proposed model and the representation of the ROC curves is performed using BNSL MATLAB toolbox [8]. 4.1 Inferring GRNs from simulated Gaussian data The simulation of Gaussian data is performed by simulation of partial correlation matrix P with entries uniform distributed over interval (-1, 1). The matrix P should be positive-definite matrix, so its diagonal elements are calculated by the following equation: p ii =
where e is a small constant. The covariance matrix Σ is obtained by inverting of the matrix P. Time series of gene expression data are generated according to multivariate normal distribution N (0, Σ) [20]. We have simulated 9 time series gene expression datasets denoted as DataGi_j, where i refers to the number of genes (5, 10 and 15 genes) and j refers to the number of time points (5, 10 and 50 time points). Datasets are simulated by the R package GeneNet [7], so the percent of present edges in the networks is 15%. To compare the inference capabilities of the proposed model with GGMs, Boolean networks and DBNs, we have employed these models on simulated Gaussian datasets. From the ROC curves illustrated in Fig. 1, it can be concluded that the proposed model has better inference performances than GGMs, especially than Boolean networks and DBNs. For small number of genes, DBNs shows the worst inference performance compared to other models. Table I shows the corresponding AUC values for Boolean networks, DBNs and GGMs. The charts presented in Fig. 2 illustrate AUC values depending on data dimensions: number of genes and number of time points. Only for DataG15_10, GGMs surpass the proposed model. Fig. 2 and Table I show that the proposed model shows the best inference capabilities for the most datasets. 4.2 Inferring GRNs from synthetic gene expression data generated by SynTReN To validate the proposed model, additionally, we generated 9 time series gene expression data by
5 time points 0,857 0,690 0,345 0,643 0,648 0,352 0,276 0,448 0,648 0,544 0,512 0,632 10 time points 1,000 0,536 0,345 1,000 0,733 0,312 0,299 0,674 0,757 0,580 0,593 0,766 50 time points 1,000 0,738 0,286 1,000 0,795 0,421 0,276 0,782 0,858 0,502 0,505 0,856
j, j ≠i
∑
p i j + e ....................... (8)
Table I. AUC values obtained by GRNs inference from simulated Gaussian datasets
Number of genes 5 Model novel model Boolean networks dynamic Bayesian networks graphical Gaussian models novel model Boolean networks dynamic Bayesian networks graphical Gaussian models novel model Boolean networks dynamic Bayesian networks graphical Gaussian models
10
15
Journal of Society for development in new net environment in B&H
2027
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Figure 1. ROC curves obtained by GRNs inference from simulated Gaussian datasets a) DataG5_5, b) DataG5_10, c) DataG5_50, d) DataG10_5, e) DataG10_10, f) DataG10_50, g) DataG15_5, h) DataG15_10 and i) DataG15_50 the generator of synthetic gene expression data – SynTReN [17]. The SynTReN generator generates data, which are very plausible to the real biologic gene expression data [20]. Generated data by SynTReN generator refer to the referent gene regulatory network of E. coli. Time series gene expression datasets are denoted as DataSi_j, where i refers to the number of genes (5, 10 and 15 genes) and j refers to the size of time series (5, 10 and 50 time points). The obtained ROC curves are shown in Fig.3. These ROC curves show that the proposed model has better inference performances than GGMs, especially than Boolean networks for most datasets. The proposed model is followed by DBNs, which show better inference capabilities for 3 datasets. 2028
a)
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
b) c) Figure 2. AUC values of inferred GRNs from simulated Gaussian data referred to a) 5 genes, b) 10 genes and c) 15 genes depending on time series size
Figure 3. ROC curves obtained by GRNs inference from simulated datasets by SynTReN generator a) DataS5_5, b) DataS5_10, c) DataS5_50, d) DataS10_5, e) DataS10_10, f) DataS10_50, g) DataS15_5, h) DataS15_10 and i) DataS15_50
Journal of Society for development in new net environment in B&H
2029
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
To survey the inference capabilities of these models, Table II shows the corresponding AUC values. The charts presented in Fig. 4 illustrate AUC values depending on data dimensions: number of genes and number of time points. Only for DataS5_5, GGMs surpass the proposed model. Fig. 4 and Table II show that the AUC values, which correspond to the proposed model, are the highest for most datasets, and for several cases are in the second place. Unlike GGMs that can deal with smaller time series data, inference with DBNs show better capabilities when the number of time points increased. 4.3 Inferring GRNs from experimental colorectal gene expression data Apart from networks inference from simulated data, we used experimental data to perform GRNs inference. We used microarray gene expression time series data that refer to genes in colorectal cancer measured in 4 time points. The data from experiment M-EXP-390 are downloaded from ArrayExpress [9]. After preprocessing and logarithm transformation of the gene expression data, 13 genes were selected according to available scientific databases and publications that described regulatory mechanisms between genes, transcription factors and other regulatory networks’ components such as: KEGG [12], TRANSFAC [3], JASPAR [4], DAVID [11] and [10]. The official names
of the selected genes are: MLH1, MSH6, APC, DCC, SMAD4, SMAD2, TP53, KRAS, MSH3, MSH2, TGFBR2, PTEN, and LKB1 (STK11). The obtained ROC curves are depicted in Fig. 5 and the corresponding AUC values are shown in Table III. These ROC curves and the AUC values have shown that the proposed model, DBNs and GGMs have similar inference capabilities surpassing the inference with Boolean networks.
a)
b)
Table II. AUC values obtained by GRNs inference from synthetic datasets generated by SynTReN generator
Number of genes 5 Model novel model Boolean networks dynamic Bayesian networks graphical Gaussian models novel model Boolean networks dynamic Bayesian networks graphical Gaussian models novel model Boolean networks dynamic Bayesian networks graphical Gaussian models 5 time points 0,510 0,370 0,470 0,570 0,577 0,562 0,485 0,514 0,592 0,558 0,542 0,589 10 time points 0,530 0,530 0,590 0,440 0,658 0,519 0,443 0,553 0,565 0,489 0,577 0,512 50 time points 0,560 0,520 0,610 0,540 0,643 0,509 0,530 0,573 0,583 0,521 0,574 0,555
10
15
2030
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
5. Discussion and concluding remarks We propose a novel model for GRNs inference. The inference of this model is achieved in two phases. In the first phase, prior knowledge was extracted using partial correlations from GGMs and in the second phase, this knowledge was integrated performing structure Bayesian learning and Markov chain – Monte Carlo simulations. The proposed model for GRNs inference has shown a very good inference performance when it was applied to simulated Gaussian data. Except in one case, the model has shown better inference performance compared to Boolean and dynamic Bayesian networks, as well as GGMs. For the most simulated time series data by SynTReN generator, the inference of the proposed model was better than Boolean networks and GGMs. For SynTReN generated data, DBNs follow the proposed model. In the third case, the inference by DBNs has a better inference performance than the proposed model, which was followed by GGMs and Boolean networks. The AUC values of the proposed model are ranged either in the first or second place. From the AUC values and ROC curves, it can be noticed that the novel model is very competitive compared to other above-mentioned models. In the case of GRNs inference from real gene expression data obtained by experiment EMEXP-390, a validation problem occurs because there are no “gold standard” networks with true interactions between genes. When the proposed model, DBNs and GGMs are applied on gene expression data, similar AUC values are obtained. Otherwise, the inference with Boolean networks has shown significantly lower capabilities in comparison with other models. Expectedly, the inference with GGMs was better when the models were employed on simulated Gaussian data in comparison with GGMs inference of data generated by SynTReN. Unlike GGMs that can deal with smaller time series data, inference with DBNs was better when the number of time points increased. The validation of the employed models has shown that the proposed model in the most cases is able to infer GRNs more accurately compared to other models. The comparison of inference model point to that beside microarray gene expressi2031
c) Figure 4. AUC values of inferred GRNs from synthetic datasets generated by SynTReN referred to a) 5 genes, b) 10 genes and c) 15 genes depending on time series size
Figure 5. ROC curves obtained by GRNs inference from experimental colorectal gene expression subdataset consisted of 13 genes In the case of GRNs inference from experimental colorectal gene expression, a validation problem occurred because there are no “gold standard” networks with true interactions between genes. In other words, there is no “true” referent network in terms of which the inferred networks would be compared. Table III. AUC values obtained by inference from selected 13 genes’ expression time series data received from experiment E-MEXP-390
Model novel model Boolean networks dynamic Bayesian networks graphical Gaussian models AUC values 0,637 0,540 0,668 0,690
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
on data, prior knowledge and other data such as ChIP-chip, ChIP-Seq, microRNA data and should be used for GRNs inference. Another problem for validation of inferred networks is that there are no “gold standard” networks, which present the true regulatory interactions between genes. Thus, as a further work, additional efforts towards upgrading the existing databases for regulatory mechanisms between genes, proteins, metabolites and other components should be made. References
1. A. V. Werhli and D. Husmeier, Reconstructing Gene Regulatory Networks with Bayesian Networks by Combining Expression Data with Multiple Sources of Priori Knowledge, Statistical Applications in Genetics and Molecular Biology, Vol. 6, 2007. 2. S. Imoto, T. Higuchi, T. Goto, K. Tashiro, S. Kuhara and S. Miyano, Combining Microarrays and Biological Knowledge for Estimating Gene Networks via Bayesian Networks, Proceedings of the Computational Systems Bioinformatics (CSB ‘03), 2003. 3. E. Wingender et al., The TRANSFAC system on gene expression regulation, Nucleic Acids Research, Vol. 29, No. 1 pp. 281-283, 2001. 4. A. Sandelin, W. Alkema, P. Engström, W. W. Wasserman, and B. Lenhard, JASPAR: an open-access database for eukaryotic transcription factor binding profiles, Nucleic Acids Res. 2004. 5. W. Zhao, E. Serpedin and E. R. Douherty, Recovering Genetic Regulatory Networks from Chromatin Immunoprecipitation and Steady-State Microarray Data, EURASIP Journal on Bioinformatics and Systems Biology, Vol. 2008. 6. C. Nuessel, M. Hopfensitz, D. Zhou and H. Kestler, Package ‘BoolNet’ – Generation, reconstruction, simulation and analysis of synchronous, asynchronous and probabilistic Boolean networks, CRAN, 2010-06-16. 7. J. Shäfer, R. Opgen-Rhein and K. Strimmer, Package ‘GeneNet’ – Modeling and Inferring Gene Networks, CRAN, 2008-11-17.
8. D. Eaton and K. Murphy, Bayesian Network Structure Learning (BNSL) – A Software Package for Matlab, 2007, http://www.cs.ubc.ca/~deaton/ struct/bnsl.html. 9. http://www.ebi.ac.uk/microarray-as/ae/. 10. V. Gonzalo, J.J. Lozano, J. Muñoz, F. Balaguer, M. Pellisé et al., Aberrant Gene Promoter Methylation Associated with Sporadic Multiple Colorectal Cancer, PLoS ONE 5(1), 2010. 11. D. W. Huang, B. T. Sherman and R. A. Lempicki, Systematic and integrative analysis of large lists using DAVID bioinformatics resources, Nature Protocols, Vol. 4 No. 1, 2009, http://david.abcc. ncifcrf.gov. 12. KEGG: Kyoto Encyclopedia of Genes and Genomes, http://www.genome.jp/kegg/pathway/hsa/ hsa05210.html. 13. N. Friedman, M. Linian, I. Nachman and D. Pe’er, Using Bayesian Networks to Analyze Expression Data, 4-th Annual International Conference on Computational Molecular Biology, 2000. 14. M. Grzegorczyk and D. Husmeier, Improving the structure MCMC sampler for Bayesian networks by introducing a new edge reversal move, Machine Learning, 71: 265-305, 2008. 15. J. Schäfer and K. Strimmer, Learning Large – Scale Graphical Gaussian Models from Genomic Data, CPP776, Science of Complex Networks: From Biology to the Internet and WWW, CNET 2004, pp. 263-276. 16. D. Eaton and K. Murphy, Bayesian structure learning using dynamic programming and MCMC, Proceedings of the 23th Confererence on Uncertainty in Artificial Intelligence UAI 2007. 17. T. Van den Bulcke, K. Van Leemput, B. Naudts, P. van Remortel, H. Ma, A. Verschoren, B. De Moor and K. Marchal, SynTReN: a generator of synthetic gene expression data for design and analysis of structure learning algorithms, BMC Bioinformatics, 2006. 18. S. Lebre and J. Chiquet, Package ‘G1DBN’ – A package performing Dynamic Bayesian Network inference, CRAN, 2008-01-23.
2032
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
19. P. Sonego, A. Kocsor and S. Pongor, ROC analysis: applications to the classification of biological sequences and 3D structures, Briefings in Bioinformatics, Vol. 9 no. 3, 2008, pp. 198-209. 20. Y. in Yuan and C. Tsun Li, A Bayes Random Fields Approach for Integrative Large-Scale Regulatory Network Analysis, Journal of Integrative Bioinformatics 5(2):99, 2008. 21. J. Huang and C. X. Ling, Using AUC and Accuracy in Evaluating Learning Algorithms, IEEE Transactions on Knowledge and Data Engineering, Vol. 17, No.3 2005. 22. S. A. Kauffman, Metabolic Stability and Epigenesis in Randomly Constructed Genetic Nets, Journal of Theoretical Biology, 1969, pp. 437-467. Corresponding author Blagoj Ristevski, Department of Information Systems Management, Faculty of Administration and Information Systems Management, St. Kliment Ohridski University – Bitola, Macedonia, E-mail: blagoj.ristevski@uklo.edu.mk
Journal of Society for development in new net environment in B&H
2033
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Erosive nature of dental defect case report
Ivana Stojsin, Tatjana Brkanic, Duska Blagojevic, Aniko Ferenc Medical Faculty of Novi Sad, Vojvodina Dental Clinic, Serbia
Abstract Dental erosion is defined as the irreversible loss of hard dental tissues caused by the long-term and often repetitive acid activity that dissolves the surface layer of hydroxyapatite and fluoroapatite crystal structure, where the aggressive knox is not of bacterial origin. The aim of this paper is to present general dental erosions as a consequence of exogenous factors and the potential cumulative effect of gastroesophageal reflux. This case report describes a 42-year-old man, who visited the Clinic for Dentistry of Vojvodina looking for the treatment of the wears on his teeth. Certain defects have been perceived in gingival thirds of vestibular surfaces of the upper and lower front teeth, in particular, yellow-brownish alterations on the bottom. Furthermore, the horizontal grooves have also been found in dentin. On the incisal edges of the upper incisors, one could observe worn sinusoidal form, whereas the incisal edges of lower anterior teeth turned into a recessed striate surface. These teeth wears react to coldness and mechanical irritation caused by a toothbrush. Composite restorations in teeth 23 and 24 appeared to be prominent. The first phase of the therapeutic process comprised the identification of the etiologic factor and introduction of the patient with the latter, preventive measures and the need to eliminate the cause of the disease. The patient was recommended to use the straw while drinking, rather than shaking the content in the mouth. Furthermore, it is also advisable to increase the intake of cheese, milk and almond. Chewing gums lead to the increased salivary secretion, and thus, they are highly recommendable. The patient was also told to reduce the intake of tropical and berry fruit and consume plain water instead of mineral water, Fanta and Cola. The Protocol on Oral Hygiene emphasizes the im2034
portance of brushing the teeth in the morning and after meals (at least three times a day), with a soft toothbrush, avoiding the use of abrasive paste and in accordance with the Bass brushing technique. The teeth should be brushed 30 minutes after waking up in the morning and after the consumption of acidic food and drinks. The resistance of the enamel to the acid agents can be increased by the use of fluoride in the form of a solution, lozenge or varnish. The second phase of the treatment was reflected in the reconstruction of anatomical and morphological characteristics of teeth with composite and elimination of dental hypersensitivity. The third phase will be done after obtaining the results of gastroenterologist and control of the implementation of precautionary measures. If the reflux disease is diagnosed, the patient will be advised to wear occlusal night guards. The problem of the partial edentulism will be solved with upper and lower removable partial denture. Key words: dental erosion, dental defects. Introduction Dental erosion is defined as the irreversible loss of dental hard tissues caused by the long and often repetitive acid activity which dissolves the surface layer of the crystal structure of hydroxyapatite and fluoroapatite, where cause is not of an aggressive bacterial origin [1]. The formation of defects in dental tissues is caused by the dissolution of calcium and phosphate from the enamel, which leads to the collapse of surface enamel structure. Depending on the origin of the acid, erosions can be divided into: endogenous, exogenous and idiopathic. Endogenous erosion develops as a result of the maturity of gastric hydrochloric acid into the oral cavity; this is the case of anatomical abnormalities such as reflux disease, hiatus hernia and
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
diverticulosis of the esophagus, mental disordersbulimia, chronic alcoholism, rumination, general medical conditions and diseases such as uremic state, peptic ulcers, morning vomiting in pregnancy. Exogenous erosion is caused by the acids that are inserted into the oral cavity through the diet, by the consumption of fruit, various juices, sodas and special drinks, medicines such as vitamin C, aspirin etc. Some occupations can also cause the appearance of exogenous erosion. These include wine tasters, professional swimmer and workers in the chemical industry. Erosive changes, whose existence cannot be explained by any currently known cause, are called idiopathic erosions. In the earliest stages, dental erosions are manifested in the form of smooth, glossy, seemingly polished tooth surface, whereas the advanced changes have a specific morphology. Changes that occur on the vestibular and oral tooth surfaces can be manifested in different round, oval, irregular shapes; however, one thing is common for all of them – their width is larger than their depth. Sometimes they may appear in the form of flattened surface. Defects in the enamel-cement border appear in the wedged shape. The changes that occur on the biting surfaces of the teeth of the lateral region are manifested as cupped recesses on the locations of nodules, whereas the incisal edge turns into a grooved surface, with the bottom in dentin. Case Report A 42-year old man came to the Dental Clinic of Vojvodina, Faculty of Medicine, University of Novi Sad, Department of Diseases of the teeth with erosive changes in the vestibular surfaces of upper and lower teeth and worn incisal surfaces of incisors Primarily, he complained about the yellowish changes on the upper and lower front teeth and wear of incisal edges of lower front teeth. In addition to these symptoms, the patient also complained about bad breath, a burning sensation over the heart, belching, grinding and tension in the muscles of mastication. Three years ago, the patient was diagnosed with gastritis. As far as the medicines are concerned, the patient consumes Ranisan and Andol. The dietetic history lists made on a daily basis (for the past year) note the consumption of citrus
fruit and berries as well as the daily intake of at least 1 liter of soda in the form of mineral water, Fanta and Coca Cola. The patient used to eat pickled food three times a week. History data about the oral hygiene reveals that patient brushes his teeth twice a day, using the horizontal technique. Objective examinations showed good oral hygiene. The patient has the erosive changes that occur on the vestibular surfaces of upper and lower teeth, the vestibular and occlusal surfaces of upper and lower molars and the incisal edges of upper and lower teeth. Voluminous defects are observed in the gingival third of the vestibular area of the upper and lower front teeth, in particular yellowbrownish changes in the form of the tertiary dentin, that appear on the bottom [Figure 1, 2]. The form of the defects on the upper central incisors testifies about the existence of restoration in the gingival third of the vestibular area [Figure 2].
Figure 1. Inadequate composite dental fillings on tooth 23 and 24
Figure 2. Erosive changes in vestibular surfaces of upper central incisor One can also observe the horizontal grooves in dentin [Figure 2, 4] corresponding abrasive changes that are more intense due to erosive demineralization 2035
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
funds. On the incisal edges of the upper incisors, one can see worn sinusoidal form [Figure 1, 2], whereas the incisal edges of lower anterior teeth turned into a recessed striate surface [Figure 3, 5]. Furthermore, the existences of defects that match abrasion combined with erosive changes [Figure 4] appear in the vestibular gingival third area. The changes respond to cold and mechanical irritation of the toothbrush. Figure 5. Wrap around indentations on the incisal surfaces of lower anterior teeth In this case the patient was advised to reduce the intake of food and liquids that are known to have erosive potential. He was also familiarized with the fact that it is better to intake the drinks with the straw and swallow them right away, rather than shaking the content in the mouth. The patient was advised to increase the intake of cheese, milk, almonds. The patient was encouraged to use chewing gums as they lead to the increased salivary secretion. The patient was told to reduce the input of citrus fruit and berries, and consume plain water instead of mineral water, Fanta and Coca-Cola. Minimal consumption of pickled food is also recommended. Preventive measures focus on training the patient for adequate oral hygiene and change in nutritional habits. The Protocol on Oral Hygiene emphasizes the importance of brushing the teeth in the morning and after meals (at least three times a day) with a soft toothbrush, avoiding the use of abrasive paste and in accordance with the Bass brushing technique. The teeth should be brushed 30 minutes after waking up in the morning and after the consumption of acidic food and drinks. The resistance of the enamel to the acid agents can be increased by the use of fluoride in the form of a solution, lozenge or varnish. Given the existence of bad breath from his mouth, firing over the heart accompanied by belching, which leads to a sense of relief, the patient was sent to the gastroenterologist since these symptoms correspond to gastroesophageal reflux. The second phase of the therapy procedure is reflected in the reconstruction of anatomical and morphological characteristics of teeth with composite, elimination of dental hypersensitivity and the establishment of adequate amount of occlusion. The elimination of dentinal hypersensitivity
Figure 3. Worn incisal edge lower teeth
Figure 4. Abrasive erosive changes on the gingival third of the vestibular surfaces of lower anterior teeth On teeth 23 and 24 one can observe visible fillings acting as grown [Figure 1]. The clinical examination showed the decreased vertical dimension of the occlusion and changes in the region of angles corresponding to angular cheilitis. The definitive restorations show great facets. The lack of teeth in the lateral region is of unknown etiological origin. It has long been confirmed that there is no successful treatment without removing the causes of diseases. The first step of the therapeutic process was the identification of the etiologic factors and the introduction of the patient with them, as well as with all precautionary measures and the need to eliminate the cause of the diseases. 2036
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
will be achieved by applying composites eroded surface, and using Colgate sensitive toothpaste. The third step in the therapy will be taken after obtaining the results of Gastroenterologist and control of the implementation of precautionary measures. If the reflux disease is diagnosed, the patient will be advised to wear occlusal night guard. The problem of the partial edentulism will be solved with upper and lower removable partial denture. Discussion The formation of defects of dental erosion is caused by the decomposition of solid dental tissues due to the existence of a critical pH in the oral cavity after the due date of acidic foods, drinks or gastric contents. This value for the hard dental tissue amounts to pH = 5.5 and occurs during the saturation of such solutions (saliva, liquid component of dental plaque) with the mineral particles that make up the enamel. If the pH is above the critical value, it can lead to the precipitation, and if is below, the solution is unsaturated which can cause demineralization [2]. There are two main reasons for the dissolution of enamel acids. The first reason is that the acidic hydrogen ions react with the ionic product (OH) from hydroxyapatite (Ca10 (PO4) 6 (OH) 2) and produce water. Thereby, the reaction has a bad influence on the consistency of products, which can further lead to the hydroxyapatite demineralization. Another reason for the dissolution are the inorganic phosphates which occur in saliva and dental plaque fluid components in four different forms and as H3PO4, H2 PO4-, HPO4 2-, PO4 3- . As pH has a direct impact on the proportion of these elements, the decrease of pH leads to the decrease of inorganic phosphate and demineralization. Non-ionized form of acids diffuses through interprysmatic space and dissolves the minerals below the surface layer, which leads to the mobilization of calcium and phosphate and the consequent increase in pH value of fluid within the salivary pellicle or saliva on the contact surface [3]. The process terminates if there is no new influx of acid. It is important to stress that the erosive changes are directly dependent on the number and duration of acid activity, and not on the type of acid and the ways of its maturities in the oral cavity.
Many studies suggest the connection of the occurrence of dental erosion with frequent consumption of soft drinks and other acidic foodstuff [4]. The current model of "healthy life" leads to the development of dental erosion because it involves the use of considerable amounts of citrus fruit and vegetables, as well as the intensive fluid intake which is reduced to the excessive intake – not of water, which is what our bodies need most, but the intake of soda / sparkling water, Coca-cola, juice from citrus fruits etc. [5]. We are familiar with the pH value of these favored drinks. PH value of lemon juice ranges 1.8 - 2.4; orange juice 2.8 - 4.0, Coca-Cola 2.7, juices from berries 3.2 - 3.6 [6]. Svi oni iskazuju kiselost koja je znatno niža od kritične vrednosti za demineralizaciju čvrstih zubnih tkiva, te nije čudo da dovode do razvoja dentalnih erozija. All of these express the acidity that is much lower than the critical value for the demineralization of hard dental tissues, thus, it is not surprising that they lead to the development of dental erosion. According to the medical history, the patient consumes "healthy life"; however, if he wants to preserve his tooth structure, he needs to reduce the consumption of the aforementioned. If the dentist suspects of the gastric reflux patients, must be referred to further investigation, which includes endoscopic, histological and manometric methods to determine the function of the sphincter, the efficiency of peristalsis, presence of mucosal erosion and swallowing function [7]. Detection of dental erosion on the back teeth can be the first symptom of gastroesophageal reflux, and deceptive GERD. Gastroesophageal reflux disease (GERD) is a chronic condition in which there is a return of gastric contents from the stomach into the esophagus. The correlation between GERD and dental erosion was first established 1971. In addition to the dental erosion, clinical gastroesophageal reflux is accompanied by the feeling of sour taste in the mouth, chest pain, epigastric pain, burping, bad breath, and difficulty in swallowing, especially hot drinks. Latent reflux disease implies the existence of gastric reflux without the above mentioned subjective symptoms. Dental erosion can also occur in the mouth of patients who have undiagnosed latent reflux disease, thus the dentist can relate the erosion of unknown etiology to the possible presence of deceptive GERD [7]. Erosive 2037
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
esophagitis, Barrett’s esophagus, and lung abscess laringopharingitis can be considered to be the possible complications of gastric disease. Barrett esophagus (metaplasia of gastric mucosa with intestinal metaplasia in the esophagus) is a premalignant condition that developed by 10% of patients with GERD. For this reason, the diagnosis of gastroesophageal reflux is of great importance in the prevention of premalignant lesions of esophagus. Reconstruction of eroded areas should be done with the use of adhesive composite systems with the highest power setting (14), with mandatory elimination of etiologic factors. Otherwise, the destruction of dental tissue continues. Conclusion In accordance with the data from the dietary history and the fact that changes are mainly localized on vestibular surfaces of teeth, we can conclude that in this case, the etiology factor is of exogenous origin. Unpleasant symptoms such as: bad breath, burning in the area heart, burping and the existence of cup recesses in the projection peak cusp of lower molars also show endogenous etiology in the form of gastroesophageal reflux. This case shows how inadequate diet with excessive intake of acidic foods and beverages and the use of soft drinks leads to the occurrence of dental erosion. The intensity of the loss of tooth structure increases if GERD appears. Therefore, the correction of dietary habits and introducing the patient with the preventive measures are one of the first steps that need to be taken if exogenous factors are to be eliminated. The identification and further steps are of great importance for the definite diagnose and treatment of the disease and early detection of potentially malignant changes in gastroesophageal region. References
1. Stojšin I., Dental manifestations of gastric reflux - a case report , Serbian dental J 2007; 54(2): 125-131 2. Stojšin I., Drobac M., Stojanac I., Petrović Lj., Dental Erosion - pathogenesis, prevention and sanitation - Review paper, Stomatološki informator 2006; 19: 1-20
3. Featherstone JDB, Rodgers BE. Effect of acetic, lactic and other organic acids on the formation of artificial carius lesions, Caries Res 1981;15: 377-85 4. Gambon D. L., Brand H. S., Nieuw Amerongen A. V., Soft drink, software and softening of teeth - a case report of tooth wear in the mixed dentition due to a combination of dental erosion and attrition The Open Dentistry Journal 2010; 4(1):198-200 5. Lussi A., Dental erosion: From diagnosis to therapy Monographs in oral science, Karger, 2006 6. Young WG, Diet and nutrition for oral health advice for patients with tooth wear, Australian Dental Association News Bull 1995;July: 8-10 7. Dena A. Ali, Ronald S. Brown, Luciano O. Rodriguez, Edward L. Moody, Mahmoud F. Nasr,Dental erosion caused by silent gastroesophageal refluks disease - clinical practice, JADA Continuing Education, American Dental Assosiation 2002; 133(6): 734-737 8. Yip H-K K., Smales J. R., Kaidonis A. J., The diagnosis and control ofextrinsic acid erosion oftooth substance - clinical practice, Dental Article Review and Testing – DART July August 2003; 1: 350-353 9. Verzak Ž., Čuković-Čavka S., Čuković-Bagić I., Prikaz slučaja bulimijom inducirane dentalne erozije kod adolescentice - prikaz slučaja, Acta Stomatologica Croatica 2007;4(3) :260-267 10. Litonjua A. L., Andreana S., Bush J. P., Tobias S. T., Cohen E. R., Noncarious cervical lesions and abfractions - Clinical practice, J Am Dent Assoc 2003;134(7):845-850. 11. Bartlett D. & Ganss C. & Lussi A., Basic Erosive Wear Examination (BEWE): a new scoring system for scientific and clinical needs - review, Clin Oral Invest 2008; 12(1): S65–S68 12. Zero T. D., Lussi A., Erosion – chemical and biological factors of importance to the dental practitioner, - review, FDI/World Dental Press, 2005 13. Bartlett W. D., The role of erosion in tooth wear: etiology, prevention and management - Clinical practice, International Dental Journal 2005; 55: 277-284 14. Sarajlija M. Comparative investigation of bond strength to dentin of three one bottle adhesive systems, HealthMED 2008; 2(3):114-121 Corresponding author Ivana Stojsin, Medical Faculty of Novi Sad, Vojvodina Dental Clinic, Serbia, E-mail: healthmedjournal@gmail.com
2038
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Retrospective Analysis of Intoxication Patients Admitted to Intensive Care Unit: Evidence Based Management vs Personal Experience
Cem Ertan1, Ender Gedik2, Neslihan Yucel1, F. Sinem Akgun1, Sibel Aslan2, Türkan Togal2, M. Ozcan Ersoy2
1 2
Inonu University Faculty of Medicine, Department of Emergency Medicine, Malatya, Turkey, Inonu University Faculty of Medicine, Department of Anesthesiology and Reanimation, Malatya, Turkey.
Abstract Objective: Intoxication is a major problem in emergency departments (ED). Patients shall either be hospitalized or discharged after ED care. This decision requires a thorough evaluation of the patients’ risk of mortality and cost effective approach. Aim of this study was to define characteristics of our poisoning patients and appropriateness of their hospitalization decisions to ICU. Methods: Adult patients hospitalized to ICU following admittance to ED within three years period with acute poisoning were retrospectively enrolled. Demographics, poisoning data, former psychiatric history, ICU follow up information, outcome at hospital discharge and in the first 28 days and predominant pathological clinical findings were recorded. Results: Our study group accounted for 3.6 per 1000 ED visits and 16.6% of ICU admittance. Mean age of the patients was 30.21±12.83 years, F/M ratio was 2.2 and 48.9% of the patients were married. Foremost encountered substances were psychoactive drugs (39.4%). 94.2% of our patients were suicidal and 39.8% of them used two or more agents. Intubation and mechanical ventilation was performed for 14 patients (5.1%), mean duration for intubated follow up was 7.07 days. Only two patients with caustic ingestions were dead (0.8%). Mean hospitalization period was 4.78±8.77 days and mean ICU bed use was 2.62±3.18 days. Total hospitalization duration was ≤48 hours 198 (72.3%) patients and > 48 hours in 76 patients (27.7%).
Conclusion: We speculate that, high rates of early discharge from ICU may support the necessity of a solid ICU admission criterion. Key Words: Intoxication, Emergency Department, Intensive Care Introduction Intoxication constitutes one of the major patient groups in the emergency department (ED) practice, rates of poisoning related ED visits vary between 0.2 to 9.3 visits per 1000 population in the literature.1,2,3 Although the causes of poisoning and the source of the poison are considered to be important in patient management, main factors guiding the basics of care in the ED are general status of the patient, vital signs, and the properties of substance or drug, if accessible. Confirmation of the patient history and adequacy of the physical examination affect the early prognosis of the patient along with the physician’s clinical experience. Following the initial evaluation of the patient in the emergency department, patient will either be hospitalized or discharged. This decision requires a thorough evaluation of the patients’ probable risk of mortality and cost effective approach at the same time. Inaccurate discharge decisions or hospitalization of a patient requiring intensive care in medical wards may increase mortality. On the other hand unnecessary hospitalization causes escalated health care costs and inappropriate occupation of the invaluable intensive care unit (ICU) beds. In the literature there is a wide range of len2039
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
gth of stay (LOS) both in ICU or ward beds. While Reiniluoto et al and Özköse et al stated a LOS shorter than 24 hours, Haennsen et al has given a range of 1 to 175 days of hospitalization.4,5,6 Due to the needs of and opportunities provided by our hospital, most of the acute poisoning patients are transferred to our tertiary level ICU following their primary care in our ED. Aim of this study is to define the characteristics of our poisoning patients admitted to the ICU and inquire the appropriateness of ICU transfers of these patients after the completion of ED care, based on their length of stay in the ICU and the criteria proposed by Krenzelok et al in 1996, and reviewed by Mokleshi et al in 2003 (Table 1).7,8 Table 1. Criteria for admission of the poisoned patients to the ICU. (Adapted from Mokhlesi B, Leiken JB, Murray P et al. Adult toxicology in critical care. Part I: General approach to the intoxicated patient. Chest, 2003. 123(2): p. 577-92.)
Respiratory depression (PaCO2 > 45mmHg) Emergency intubation Seizures Cardiac arrhythmia (second-or third-degree atrioventricular block) Systolic BP < 80 mmHg Unresponsiveness to verbal stimuli Glasgow coma scale score < 12 Need for emergency dialysis, hemoperfusion, or ECMO* Increasing metabolic acidosis Pulmonary edema induced by toxins (including inhalation) or drugs Hypothermia or hyperthermia including neuroleptic malignant syndrome Tricyclic or phenothiazine overdose manifesting anticholinergic signs, neurologic abnormalities, QRS duration > 0.12s, or QT > 0.5s Body packers and stuffers Concretions caused by drugs Emergency surgical intervention Administration of pralidoxime in organophosphate toxicity Antivenom administration in Crotalidae, coral snake, or arthropod envenomation Need for continuous infusion of naloxone Hypokalemia secondary to digitalis overdose (or need for digoxin- immune antibody Fab fragments)
Methods The patients hospitalized to ICU following admittance to the Department of Emergency Medicine at a tertiary care hospital within a three years period with history or symptoms regarding acute poisoning with drugs or other chemicals were retrospectively enrolled. Patients younger than 17 years old were seen and admitted in the pediatric ED and ICU respectively and therefore not included to our study. On the other hand, patients whose exposures could not be defined were excluded from the study. The study design was approved by the local Ethics Committee. Records and demographics of the intoxication patients hospitalized to reanimation unit were collected by authors and transferred to a standardized data abstract sheet from electronic database systems of our hospital (Corteks® and Enlil®) and ICU patient archives, which kept records of the poisoning patients. Epicrisises of the patients and ICU follow up sheets were inquired retrospectively using appropriate ICD10 codes for intoxication to analyze for clinical parameters and therapeutical aspects. Demographic data included age, gender, date and time of the visit, marital status, and vital signs on admission. Former psychiatric and suicidal history of the patient, if any, was also questioned. The data about poisoning included route and source of exposure, characteristics of the exposed poison, and whether the intoxication was intentional or not. Follow up information during hospitalization included ICU LOS, duration of invasive mechanical ventilation, total hospital LOS in case the patients were transferred to the psychiatry ward, predominant clinical findings of the patients, outcome at hospital discharge and in the first 28 days. Predominant pathological clinical findings of the patients were classified as neurologic (focal or generalized seizures, headache, altered level of consciousness), psychiatric (agitation, delirium, depression), cardiac (bradicardia, tachycardia, arrhythmias, hypo/ hypertension), and respiratory problems (dyspnea, permanent tachypnea, apnea, aspiration). Patients were classified into either of two groups due to their length of stay in the ICU as over 48 hours or less. Patients requiring invasive mechanical ventilation and hemodynamic monitorization in both groups were also emphasized.
*ECMO= extracorporeal membrane oxygenation.
2040
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Statistical analysis was performed using the ‘16.0’ version of the ‘SPSS for Windows’ software package. Study variables were described by means, standard deviations, and percentages. Correlations of variables with group I and group II were analyzed by chi-square and Fisher’s exact test. P values of less than 0.05 were considered statistically significant. Results There were 282 patients hospitalized to ICU following admittance to the Department of Emergency Medicine between January 2007 and December 2009 with history or symptoms regarding acute poisoning. 8 of these patients were excluded from the study due to incomplete data. Poisoning patients were approximately 1.1% of the total ED admissions at the same time period, whether they were admitted to the ICU or not. Our study group of 274 patients, which is limited to ICU hospitalizations, accounted for 3.4 per 1000 ED visits and 16.6% of total ICU admittance. Mean age of the patients was 30.21 (16-81, SD: 12.83), 86 of the patients (31.4%) were male with an overall F/M ratio of 2.2 and 134 of the patients were married (48.9%). We clustered the patients in age groups into decades such as 16-25, 26-35, 36-45 and older than 45. Proportional dispersion was as 49.6%, 24.8%, 12.4% and 13.1% respectively. There was a statistically significant female dominancy in the 16-25 (F/M= 106/30) and 26-35 (F/M= 48/20) age groups (p<0.0001). Poisoning related visits (Table 2) were more common in winter (n=95, 34.7%), followed by spring (n=74, 27.0%), summer (n=57, 20.8%) and autumn (n=48, 17.5%). Substances those have been exposed to or used by the patients included antidepressants/antipsychotics other than tricyclic antidepressants (TCAs) (n=57, 20.8%), TCAs (n=51, 18.6%), organophospates (n=43, 15.7%), multiple/mixed drugs (n=35, 12.8%), non steroidal anti-inflammatory drugs and paracetamol (n=22, 8%), antiepileptic drugs (n=19, 6.9%), cardiovascular drugs (n=15, 5.5%), super warfarins (n=11, 4%), carbamates (n=7, 2.6%), carbon monoxide (n=7, 2.6%), caustic chemicals (n=5, 1.8%) and antihistamines (n=2, 0.7%). Oral
route established 94.2% of all cases (n=258), 12 patients inhaled the toxin, two were exposed via skin (0.75%) and two patients injected (one intravenous and one intramuscular) the chemicals (0.75%). There were no alcohol or illicit drug related intoxications in our patient group. Table 2. Characteristics of patient group
Mean Age (±SD) Age Groups 16-25 26-35 35-45 > 45 Gender Female / Male Marital status Married Single Divorced/Widoved GCS 15 13-14 <13 Season Winter Spring Summer Autumn Symptom Neurologic Psychiatric Cardiac Respiratory Intubated (±SD) Mean Duration LOS (±SD) ICU Hospital n 30.21±12.83 136 68 34 36 188 / 86 134 125 15 45 9 1 95 74 57 48 114 94 31 18 7.07±12.62 2.62±3.18 4.78±8.77 %
49.6 24.8 12.4 13.1 68.6 / 31.4 48.9 45.6 5.5 81.8 16.4 1.8 34.7 27 20.8 17.5 41.6 34.3 11.3 6.6
Patients with intentional exposures constituted 94.2% of our patients (n= 246). While 146 of these patients (60.2%) attempted suicide using only one drug or chemical, 98 of the patients (39.8%) used two or more agents. Within the same group there were 98 patients (39.8%) with a previous psychiatric history, 31 (12.6%) of these patients previously intended to commit suicide at least once and 64 (65.3%) of them used their own prescribed medica2041
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
tions for their intention. Use of psychiatric medications were frequent in this group, 56 of the patients (57.1%) used TCAs or other antidepressants/antipsychotics. In our study group there were no patients intoxicated with alcohol or recreational drugs. The signs and symptoms of the patients were evaluated, the dispersion was as follows; neurological symptoms in 114 patients (41.6%), psychiatric symptoms in 94 patients (34.3%), cardiac symptoms in 31 patients (11.3%), and respiratory problems in 18 patients (6.6%). Intubation and mechanical ventilation was performed for 14 patients (5.1%). Mean duration for intubated follow up was 7.07 days (2-50, SD: 12.62) with one exceptional patient of 50 days of intubated and 5 days of nonintubated follow up at the ICU (Table 2). Following their ICU care, 240 (87.6%) of the patients were discharged directly from the reanimation
unit and 32 of the patients (11.7%) were transferred to psychiatry ward. Only 2 of the patients (0.7%) were dead during the ICU follow up, both had intentional caustic ingestions and died at their third day due to profound intractable acidosis which did not respond to conventional haemodilaysis. Our search at the database showed that while 257 of the 272 patients (94.5%) discharged from the ICU had no recurrent visits, neither to ED nor psychiatry clinic, seven (2.6) patients had visited psychiatry clinic and eight of the patients (2.9%) were still hospitalized at psychiatry ward at the end of the first 28 days. The appropriateness of ICU hospitalizations was inquired using the criteria for admission of the poisoned patients to ICU (Table 1). 15 (5.5%) of the 274 patients could not be evaluated due to missing data regarding these criteria. Of the remaining 259 patients, 164 (59.9%) had no matching
Table 3. Comparison of Group I and Group II by study variables
Male (%) Mean Age (±SD) Death (%) Marital status (%) Married Single Divorced/Widoved Exposure Route (%) Oral Inhalation Other Exposure Purpose (%) Intentional Unintentional Exposed Drugs (%) TCAs Organophosphate Analgesics Non-TCA psychoactive drugs Carbamates Cardiovascular Superwarfarins Caustics CO Antiepileptics Antihistamines Mixed/Combined drugs Group I (n=198) 61 (30.8%) 29.3±12.68 0 (0%) 98 (49.5) 89 (44.9) 11 (5.6) 192 (97) 5 (2.5) 1 (0.5) 184 (92.9) 14 (7.1) 38 (19.2) 25 (12,6) 18 (9.1) 40 (20.2) 6 (3) 13 (6.6) 6 (3) 3 (1.5) 4 (2) 16 (8.1) 2 (1) 27 (13.6) Group II (n=76) 25 (32.9%) 31.2±13.24 2 (2.6%) 36 (47.4) 36 (47.4) 4 (5.2) 66 (86.8) 7 (9.2) 3 (3.9) 62 (81.6) 14 (18.4) 13 (17.1) 18 (23.7) 4 (5.3) 16 (21.1) 1 (1.3) 2 (2.6) 5 (6.6) 2 (2.6) 3 (3.9) 3 (3.9) 0 (0) 9 (11.8) P 0.9 0,3 0.1 0.9 0.8 0.9 0.003* 0,04* 0,1 0,01* 0,01* 0.8 0.04* 0.4 0.9 0.7 0.3 0.3 0.9 0,6 0,3 0.9 0.8 95 %CI -10,27 to 14,47 -0,98 to 6,18 -11,11 to 15,31 -10,69 to 15,69 -5,53 to 6,33 2,23 to 18,17 -0,15 to 13,55 -1,06 to 7,86 1,88 to 20,72 1,88 to 20,72 -7,99 to 12,19 0,48 to 21,72 -2,64 to 10,24 -10,50 to 10,70 -1,78 to 5,18 -0,98 to 8,98 -2,47 to 9,67 -2,86 to 5,06 -2,87 to 6,67 -1,58 to 9,98 -0,4 to 2,4 -6,88 to 10,48
* p < 0,05
2042
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
criteria. 60 of the patients (21.9%) were recorded to be unresponsive to verbal stimuli, 14 (5.1%) had a GCS value less than 12, 6 patients (2.2%) had symptomatic TCA intoxication, other 6 (2.2%) had seizures, 4 (1.5%) had a PaCO2 lower than 45 mmHg, 2 patients (0.7%) needed emergency intubation, 2 patients had Pralidoxime administered, and only one patient was recorded to have a systolic pressure below 80 mmHg (0.4%). While only 22,6% of the patients with no positive criteria were hospitalized for more than 2 days, 34,7% of the patients with at least one positive criteria were hospitalized for more than 2 days (p=0,33). Mean total hospital length of stay was 4.78 days (1-65, SD: 8.77) and mean ICU length of stay was 2.62 days (1-50 days, SD: 3.18). Total hospital length of stay was 48 hours or less in 198 (72.3%) patients (group I) and over 48 hours (group II) in 76 patients (27.7%). Characteristics of the groups are presented in Table 3. Discussion Poisoning is a common and sometimes lifethreatening health issue for our country, as it is for the world.1,2 Our hospital is the foremost medical center in our territory. Therefore virtually all serious intoxication patients somehow end up in our facility. In this study we retrospectively analyzed the demographics, ICU care period and the early follow up of our intoxication patients. Islambulcihar et al found that, a total of 5.4% of all admitted cases were poisoning related in their study.6 On the other hand, Hanssen et al declared a rate of 1.8 per 1000 and Lee et al found 4.2 per 1000 poisoning related visits to ED.9,10 The 2007 Annual Report of the American Association of Poison Control Centers’ National Poison Data System (NPDS) informed a rate of 8.1 per 1000 population.11 Turkish Statistical Institute stated the crude suicidal rates for years 2007 and 2008 among Turkey as 3.98 and 3.96 per 1000 population respectively.12 Due to the specific formation of our patient population, we studied with a more purified group. In our study, hospitalization rates of poisoning patients to ICU was higher than Sencan and colleagues’ study where they had 13.4% (n=121) intoxication patient admittance rate to
their ICU in a three years period.13 We speculate that, the high ICU hospitalization rate in our study may be associated with tertiary care provided in our hospital and lack of appropriate long term care in other regional hospitals. Although there are different reports in literature, female to male (F/M) ratios range between 0.9 to 3.0.1,2,6,10,14 Our F/M ratio was 2.2, which is within this range and similar to Ayoglu and colleagues’ 2.1.15 A significantly high proportion of our patients were younger than 25 years old and patients younger than 35 years old constituted more than a half of our patients. This finding is also supported by the literature.6,9,10,13 In a mid-eastern study, majority of suicidal exposures were revealed to be young married females, and authors connected this dispersion to familial problems, failure in love affairs and economical problems.6 On the contrary, in their study conducted in Chicago, USA, Khlifi et al found that 69.3% of their patients were singles; compared to 12.3% married patients.16 In our study there was no statistically significant difference between married and single patient groups. This may be due to some specific and general stressors probably affecting each group equivalently: while loneliness and lack of attachment may be considered as specific reasons for single people; child issues (not having one or problems about children they have) and extramarital affairs might be examples for married people, and negative socio-economical movements in the society may motivate both married and single people to attempt suicide. Islambulcihar et al reported that the most of the poisoning patients in their series were admitted in spring and least in autumn.6,9-11 Although most of the patients in our study were hospitalized in winter, lowest poisoning related admission rate in our study was also found in autumn. Unemployment and poverty are frequent stressors in our agricultural territory, where summer is the most occupied season and winter is the least. We believe inoccupation and availability of pesticides are the main reasons underlying our patients’ seasonal dispersion. Also, Turkey is a country which highly benefits from the sun in the summer days, lack of sunshine in the winter days may cause predisposition to depression. In the literature the list of exposed poisons varies. McCaig et al declared that one fifth of the ex2043
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
posed drugs in their study group were unspecified, 8.2% were analgesics and 5.4% were psychotropic agents.1 A study from Oman also indicated analgesics as the most frequent cause of specific drug poisoning.9 On the other hand there are many studies revealing psychoactive drugs, including benzodiazepines and other sedative-hypnotics, as the foremost exposed drug group.6,10,11 Psychoactive drugs (TCA’s, other antidepressants and antipsychotics) were the most frequently exposed toxic substances in our study, followed by pesticides (organophosphates and carbamates). Among all TCAs was the most common drug, just as it was in the 11 years experience of Unverir and colleagues.17 In our country, TCAs are easy to reach even without a prescription, cheap to buy and available to create a serious and life-threatening situation. We believe these are the main reason of this frequent tendency to this drug. The second most common substances of exposure were organophosphates and carbamates. Since apricot cultivation is the main source of income in our territory, organophosphates and carbamates can easily be obtained and found in many houses. Our results support that either intentional or unintentional poisoning may easily occur due to readily approachable substances. In 1987, Hawton et al reported that, 40–50% of the medically serious suicide attempts had one previous attempt, 12–20% are likely to attempt again within a year, and 12–16% had a history of 5 or more previous attempts.18,19 A history of previous psychiatric problems was evident in about forty percent of our suicidal patients, and more than ten percent of these patients had at least one more previous suicide attempt. Ayoglu et al and Unverir et al reported similar incidences in their studies.15,17 We also found that, patients on psychoactive medication used their own drugs, mostly TCAs, for their intentions. A study mainly focused on antidepressant poisonings in Turkey also showed that TCAs were the drug of choice for self-harm.17 Many routes of exposure for poisoning including ingestion, injection, inhalation and even rectal/vaginal routes are reported.6,9,16,20 In our study oral route constituted the majority of exposures. Oral medications and chemicals are easy to reach and apply. Therefore, it is not surprising that oral route is the major way of substance intake when one intents to commit suicide. In the literature, 2044
suicidal intoxications are the most encountered types of poisoning, and most attempters use only one drug or chemical.5,6,8-11,13,15A vast majority of our patients were exposed to the poison deliberately, with the intention to commit suicide, and more than a half of them used only one substance for their intention. The number and content of exposed substances are important, because interactions of the co-ingested substances may cause more morbid and mortal effects due to adverse drug reactions (ADRs) than the main substance regardless of the intention.21,22 Intubation and mechanical ventilation are necessary measures in case patients have low Glasgow Coma Scale (GCS) scores, respiratory failure, and serious carbon monoxide poisoning and status epilepticus.8,15 The need for intubation varies about 4-21.2%.15,17,23 Definitive airway measures were deemed necessary for five percent of our patients, which is within this range. In our study, intubated patients were found to have a longer ICU LOS (> 2 days) as might have been expected. Death rate during our 3 years experience, which is less than one percent, is rather pleasing. In the study by Lee et al, 4.2% of all poisoning patients and 11.2% of hospitalized or transferred patients had a fatal progress.10 Depending on the study population, overall poisoning mortality in literature varies between 0.01% and 6.9% worldwide, and 0% and 14% in Turkey.1-3,6,11,18,24-27 We believe, despite a relatively high rate of intubated patients, our low mortality rate is probably associated with the high proportions of patients with an ICU LOS less than 2 days, which may indicate unnecessary ICU hospitalization and our low mortality rates may be due. The indications for ICU admission of the poisoned patient are debated in the literature. Brett et al proposed a list of 8 situations for ICU admission and denoted that no ICU interventions were deemed necessary for patients who did not represent PaCO2 > 45 mmHg, need for endotracheal intubation, toxin-induced seizures, cardiac arrhythmias, QRS duration > 0.12 s, systolic BP < 80 mm Hg, second- or third degree atrioventricular block, and unresponsiveness to verbal stimuli no ICU interventions.28 Others enlarged the list to 19 items.8,29,30 The retrospective nature of our study is a major limiting factor in our efforts to validate the appropriateness of our patients admission decisions to ICU.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The data we were able to reach thru the patients’ charts showed that more than half of our patients were admitted to our ICU without a proper indication, probably only via common sense. A vast majority of our patients were discharged directly from ICU, and those except this group were transferred only to psychiatric ward. In the 28th day, only eight of the patients (2.9%) were still hospitalized at the psychiatry ward and only seven (2.6%) patients had visited psychiatry clinic following their disposition. Although more than 90% of our patients were poisoned intentionally, only about a ten percent of them required in-patient psychiatric treatment. This finding probably indicates the impulsive nature of the suicide attempts. The total hospitalization period in our study is longer than the literature suggests. Reiniluoto et al stated 94% of their patients had a LOS shorter than 24 hours, and Özköse et al reports a mean LOS of 0.7 days.4,5 The contradistinction of our results reflects the differences between the patient groups. Our study group is consisted of patients who were already entitled for ICU hospitalization, which therefore did not include self discharges from ED and ward hospitalizations of probably shorter periods, unlike the aforementioned studies. On the other hand, while poisoning with organophosphates, and unintentional exposures are found to be significantly related with longer hospitalization, intentional exposures and oral route of exposure to poison are related with total hospital LOS ≤ 48 hours. We could not find any data regarding the factors affecting total hospital length of stay in the literature. Conclusion The high rate of patients discharged from ICU within 48 hours may indicate unnecessary hospitalization to ICU. Although we did not measure the effects of the poisoning patients to the health care costs, ICU beds are far more expensive than regular ward beds. Unless a criterion is used for ICU hospitalizations of poisoning patients, cost effective management may not be warranted. Our results suggesting that impulsive suicidal attempts are more common in our territory, also supports the necessity of a solid criterion for ICU admissions.
Acknowledgements This research received no specific grant from any funding agency in the public, commercial, or not-for-profit sectors. We would like to thank Meryem Dikenli and Aslı Esra Sağlam for their efforts during data collection process. References
1. McCaig LF, Burt CW. Poisoning-related visits to emergency departments in the United States, 19931996. Journal of Toxicology, Clinical Toxicology, 1999; 37(7): 817-26. 2. Akkose S, Bulut M, Armagan E et al. Acute poisoning in adults in the years 1996-2001 treated in the Uludag University Hospital, Marmara Region, Turkey. Clinical Toxicology (Philadelphia), 2005; 43(2): 105-9. 3. Litovitz TL, Klein-Schwardz W, Caravati EM et al. 1998 Annual report of the American Association of Poison Control Centers Toxic Exposure Surveillance System. American Journal of Emergency Medicine, 1999; 17; 435-487 4. Reiniluoto OL, Kivistö KT, Pohjola-Sintonen S, Luomanmäki K et al. A prospective study of acute poisonings in Finnish hospital patients. Human & Experimental Toxicology, 1998; 17; 307 5. Ozkose Z, Ayoglu F. Etiological and demographical characteristics of acute adult poisoning in Ankara , Turkey. Human & Experimental Toxicology, 1999; 18: 614–618. 6. Islambulchilar M, Islambulchilar Z, Kargar-Maher MH. Acute adult poisoning cases admitted to a university hospital in Tabriz, Iran. Human & Experimental Toxicology, 2009; 28; 185 7. Krenzelok EP, Leikin JB. Approach to the poisoned patient. Dis Mon. 1996 Sep;42(9):509-607. 8. Mokhlesi B, Leiken JB, Murray P, Corbridge TC. Adult toxicology in critical care. Part I: General approach to the intoxicated patient. Chest, 2003. 123(2): p. 577-92. 9. Hanssens Y, Deleu D, Taqi A. Etiologic and demographic characteristics of poisoning: A prospective hospital-based study in Oman. Clinical Toxicology, 39 (4), 371–380 (2001)
Journal of Society for development in new net environment in B&H
2045
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
10. Lee H-L, Lin H-J, Yeh ST-Y, Chin CH, Guo HR. Etiology and outcome of patients presenting for poisoning to the emergency department in Taiwan: A prospective study. Human & Experimental Toxicology, 2008; 27; 373 11. Bronstein AC, Spyker DA, Cantilena Jr LR, Green JR et al. 2007 Annual report of the American Association of Poison Control Centers’ National Poison Data System (NPDS): 25th annual report. Clinical Toxicology, (2008) 46, 927–1057 12. Turkish Statistical Institute Suicide Statistics - 2008. Turkish Statistical Institute Prime Ministry Republic of Turkey, 2008. http://www.turkstat.gov.tr 13. Sencan A, Adanır T, Aksun M, et al. The relationship of demographic and etiological characteristics with mortality in acutely poisoned patients admitted to intensive care unit. Jounal of Turkish Anesthesiology and Reanimation Association (Türk Anestezi ve Reanimasyon Derneği Dergisi), 2009; 37(2):80-85 14. Tufekci IB, Curgunlu A, Sirin F. Characteristics of acute adult poisoning cases admitted to a university hospital in Istanbul. Human & Experimental Toxicology, 2004; 23: 347–351. 15. Ayoğlu FN, Ayoğlu H, Kaptan YM, Turan OI. A retrospective analysis of cases with acute poisoning in Zonguldak, Turkey. Journal of Turkish Anaesthesiology and Intensive Care, 2009; 37(4):240-248 16. Khilifi M, Zun L, Johnson G, Harbison R. Etiological characterization of acute poisonings in the emergency department. Journal of Emergency, Trauma and Shock, 2009; 2; 159-63 17. Unverir P, Atilla R, Karcioglu O, Topacoglu H, et al. A retrospective analysis of antidepressant poisonings in the emergency department: 11-year experience. Human & Experimental Toxicology, 2006; 25: 605–612. 18. Hawton K, Catalan J. Attempted suicide: A practical guide to its nature and management. Oxford: Oxford University Press, 1987. 19. Modai I, Hirschmann S, Hadjez J, et al. Clinical evaluation of prior suicide attempts and suicide risk in psychiatric inpatients. Crisis, 2002; Volume 23 (2): 47–54 20. Vukas N, Horman I, Ljubuncic N, et al. Preliminary risk assessment of the occupational exposure to Toluene and Ethyl Acetate in wood industry. HealthMED 2010. 4; 4; 901-906
21. Knudsen K, Jonsson U, Abrahamsson J. Twentythree deaths with g-hydroxybutyrate overdose in western Sweden between 2000 and 2007. Acta Anaesthesiol Scand 2010; 54: 987–992 22. Najjar MF, Aziz NA, Hassan Y. et al. Predictors of polypharmacy and adverse drug reactions among geriatric in patients at Malaysian hospital. HealthMED 2010. 4; 2; 273-283 23. Sungur M, Guven M. Intensive care management of organophosphate insectiside poisoning. Critical Care, 2001, 5:211-215 24. Bruyndonckx RB, Meulemans AI, Sabbe MB, Kumar AA, et al. Fatal intentional poisoning cases admitted to the University Hospitals of Leuven, Belgium from 1993 to 1996. European Journal of Emergency Medicine, 2002, 9, 238-243 25. Seydaoglu G. Epidemiology of poisoning (Zehirlenmenin epidemiyolojisi). In: Satar S. Edt. Clinical Toxicology in the Emergency Department (Acilde Klinik Toksikoloji). 19-38, 2009, Adana 26. Pinar A, Fowler J, Bond GR. Acute poisoning in Izmir, Turkey – A pilot epidemiologic study. Journal of Toxicology, Clinical Toxicology, 1993; 31(4):593-601 27. Göksu S, Yildirim C, Kocoglu H, et al. Characteristics of acute adult poisoning in Gaziantep, Turkey. Journal of Toxicology, Clinical Toxicology, 2002; 40(7):833-7 28. Brett AS, Rothschild N, Gray R, et al. Predicting the clinical course in intentional drug overdose: implications for the use of the intensive care unit. Archieves Internal Medicine 1987; 147:133–137 29. Hamad AE, Al-Ghadban A, Carvounis CP, et al. Predicting the need for medical intensive care monitoring in drugoverdosed patients. Journal of Intensive Care Medicine 2000; 15:321–328 30. Kulling P, Persson H. The role of the intensive care unit in the management of the poisoned patient. Medical Toxicology 1986; 1:375–386 Corresponding author Cem Ertan, Inonu University Faculty of Medicine, Department of Emergency Medicine, Malatya, Turkey, E-mails: cemertan@inonu.edu.tr, cem_ertan@hotmail.com
2046
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Liver slices are the optimal model for mimicking apoptosis activation in vitro
Irina Milisav1,2, Dusan Suput1
1 2
Institute of Pathophysiology, Faculty of Medicine, University of Ljubljana, Slovenia, Faculty of Health Sciences, University of Ljubljana, Slovenia.
Abstract Tissue slicing enables sectioning of tissue with metabolically active cells. The cutting of untreated rat and human liver tissues has been optimized recently to produce uniformly thick tissue slices of 200 mm. There are no reports in the literature about the optimal slice thickness to study induction of apoptosis. Therefore, the objective of our study was to determine the optimal slice thickness that would enable performing a uniform pharmacological treatment as well as reproducible slicing. The native slices of liver from 80 mm to 200 mm are suitable for studies of biochemical pathways and metabolism, however, only the slices of 80 mm are a reliable model for apoptosis triggering in liver. These slices are the best model for studying apoptosis initiation in liver, since the pathways of apoptosis triggering are changed in the primary liver cells (hepatocytes) due to stress during their isolation. Tissue slices are important in vitro models for studying metabolism and may become useful for evaluation of medical procedures in cell therapies and regenerative medicine. Key words: Liver slices, apoptosis, organotypic culture, caspase activity 1. Introduction Cell cultures, especially those of primary cells, are important models for studying biochemical and physiological phenomena. The primary cell cultures of isolated hepatocytes are being used as models to study drug metabolism or drug effects on liver; the human primary hepatocytes are believed to be the closest model for studying metabolism in vitro [1]. Nevertheless, there are some metabolic changes that occur upon culturing of primary he-
patocytes. It was shown recently that the pathway of apoptosis triggering in primary hepatocytes differs from the one within the intact tissue [2]. The preapoptotic cell stress response, which occurs as a consequence of stress during hepatocytes’ isolation, makes even the best possible cellular model, the primary hepatocytes, unsuitable for studying apoptotic pathways in the intact tissue. Tissue slicing is a new technique, which enables sectioning of a tissue with metabolically active cells. It was used for the production of organotypic slice cultures, mainly of the brain [3-5]. Cutting the intact soft tissues is generally more challenging than producing brain slices, however, more and more tissues are being successfully used in research, like pancreatic [6, 7], heart [8], lung [9], breast [10] and liver tissues [11, 12]. For example, the tissue slices were used for studying electrophysiology of pancreatic beta cells [6], evaluation of gene therapy vectors in pancreatic tissue [7] and lungs [10], for pharmacological drug testing in heart [8], lungs [9] and liver [10]. Therefore, tissue slices are good models for studying intracellular biochemical pathways. Tissue slices are useful also in molecular medicine; e.g. they were used for evaluation of gene therapy vectors in human pancreatic tissue cells already [7]. Liver is one of the soft tissues’ organs which are generally pre-treated with gelatine or low melting point agarose to enable cutting thin homogeneous slices [10, 12]. Recently the cutting of untreated rat and human liver tissues has been optimized to produce uniformly thick tissue slices of 200 mm [11]. There are no references in the literature about the optimal slice thickness for the study of apoptosis triggering. Therefore, the objective of our study was to determine the optimal slice thickness for the study of apoptosis triggering. Slices of 80 mm, 100 mm and 200 mm thickness survive in cul2047
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
ture with only background levels of caspase activity. We determined that the 80 mm liver slices are optimal since they enable reproducible apoptosis triggering by staurosporine (STS) with the highest activity of caspase 3. Equal treatment also triggers apoptosis in 100 mm and 200 mm slices, however, apoptosis seems to be induced in a smaller proportion of cells, presumably only in cells located in the outer most layers of the tissue sample. Therefore, 80 mm liver slices are a reliable model for apoptosis triggering in tissue and can mimic intact tissue better than the primary cells. 2. Material and Methods All basic chemicals and materials were purchased from Sigma (Taufkirchen, Germany) and Merck (Darmstadt, Germany) if not stated otherwise. Preparation of tissue slices Liver was isolated from adult male rats (Wistar- Hannover, 200-300 g), which were treated as for the isolation of primary hepatocytes [13]. Isolated liver were placed into William’s medium E with penicillin and streptomycin (50 U/ml, each), insulin (0.1 U/ml) and 1 mM hydrocortisone hemisuccinate. Off-cuts of about 1 cm3 were sliced further with Leica VT1200 S vibrating blade microtome (Leica Microsystems GmbH, Wetzlar, Germany) in an ice cold William’s E medium as described above. The tissue slices were collected into a 24-well tissue culture plate (Nunc, Roskilde, Denmark) containing the William’s E medium and incubated with or without 1 mM STS for 6 hours in a humidified atmosphere with 95 % air and 5 % CO2 at 37 °C. Measurement of caspase activity The tissue slices were homogenized in cell culture lysis buffer (Promega, Madison, WI, USA). Protein concentrations were determined by BCATM Protein Assay Kit as described by the supplier (Pierce, Thermo Scientific, Rockford, USA). The 2048
activities of caspase-3 were deduced from formation of luminescent substrates by using CaspaseGlo 3/7 Assay (Promega, Madison, WI, USA) according to the supplier’s protocol. Each sample contained 20 mg of protein. Statistical analyses Percentage of relative activity of caspase-3 in a sample was calculated by dividing the luminescence values of treated or untreated cells with the average of luminescence values of untreated cells from each independent experiment. The data from at least tree independent experiments were plotted by Sigma Plot 11.0 (Systat Software, San Jose, CA, USA). Statistical analyses were done by Statistical Package for the Social Sciences, version 15.0 (SPSS Inc., Chicago, IL, USA); KruskalWallis rank sum test was used to compare more than 2 groups unequal variances). When indicated, post hoc analyses were performed by Dunnett T3. We considered values of samples as statistically significant when P<0.01. 3. Results and Discussion Fresh liver without pre-treatment was cut into 50 mm, 80 mm, 100 mm and 200 mm thick slices. The 50 mm slices were not uniformly thick even by visual inspection and shedding of cells into the surrounding medium was observed during cutting. Therefore these slices were not used any further. Other slices appeared uniformly cut, which was deduced from visual inspection and by reproducible levels of cleavage of caspase-3 substrate DEVD even after 6 hours incubation (Figure 1, untreated). The incubation of untreated controls for 6 hours after isolation enables to control the quality of slices, since the damaged cells would likely die of apoptosis, as can be observed in some primary hepatocytes immediately after isolation [2]. The similar level of DEVDase activities in the STS-treated slices of 100 mm and 200 mm also supports that these slices were uniformly cut. This agrees with the published results, in which the 200 mm slices were confirmed to be uniformly thick by re-slicing and measurement by confocal micros-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
copy [11]. In conclusion, the native slices of liver from 80 mm to 200 mm are suitable for studies of biochemical pathways and metabolism. The DEVDase activity was measured on induced and control tissue slices cultured for 6 hours after isolation. The STS was added to appropriate samples immediately after isolation. Although the resulting DEVDase activity can be detected sooner after the induction of apoptosis by STS, it was determined previously that this activity reaches its maximum at about 6 hours from STS treatment [2]. The levels of DEVDase activity are higher in STS treated samples compared to their uninduced controls by about 50 to 400 % (Figure 1). These differences are statistically significant among all samples (P=3.5 x 10-8, Kruskal-Wallis rank sum test). The levels of DEVDase activity also differ between the slices of different thickness. There is no statistically significant difference between the treated and untreated samples in slices of 100 mm and 200 mm (P=0.033 and P=0.219, respectively, Dunett T3 post hoc test). On the contrary there is a sharp increase of DEVDase activity indicating caspase-3 activation in 80 mm slices upon the treatment with STS (P=0.009, Dunett T3 post hoc test). We propose that this increase is due to the uniform induction of caspase-3 activity throughout the 80 mm tissue slice, as opposed to the activation of only outermost layers of cells in the thicker slices.
cence of the cleaved caspase-3 substrate (DEVD. aminoluciferin). Each sample contains data from 3 independent tissue isolations; from each isolation there are at least 3 parallel tissue samples for each group. DEVDase activity of STS treated tissue slices differ significantly among the samples (P=3.5 x 10-8, Kruskal-Wallis rank sum test). DEVDase activity among untreated and STS treated samples of 80 mm is highly significant (P=0.009, Dunett T3 post hoc test). Conclusion Tissue slicing is a powerful tool for studying the processes as they occur in vivo. Even soft tissues like the liver can be cut into slices without pre-treatment; these slices are thin enough to enable uniform pharmacological treatment. Only the slices of 80 mm are useful as a model for studying apoptosis activation in liver, which is of importance, since the primary hepatocytes do not mimic the intact tissue for this purpose. Therefore, liver tissue slices are the best known in vitro model for studying liver metabolism so far. They may be useful for evaluation of medical procedures in cell therapies and regenerative medicine. Acknowledgements We thank Alenka Frangež for technical assistance. This work was supported by Grant P30019 from Ministry of Higher Education, Science and Technology of Republic of Slovenia.
Figure 1. Caspase-3 activity in untreated and STS treated tissue slices Apoptosis was induced by exposing the liver slices of 80, 100 and 200 mm to 1 mM staurosporine for 6 hours (STS). The caspase activity of tissue slices was infered from increased luminesJournal of Society for development in new net environment in B&H
2049
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
References
1. J.V. Castell, M.J. Gomez-Lechon. In: In Vitro Methods in Pharmaceutical Research. Academic press, San Diego, CA, 1997, pp. 129-154. 2. D. Nipič, A. Pirc, B. Banič, D. Šuput, I. Milisav. Pre-apoptotic cell stress response of primary hepatocytes. Hepatology, 2010, 51, 2140-2151. 3. I.E. Holopainen. Organotypic hippocampal slice cultures: a model system of study basic cellular and molecular mechanisms of neuronal cell death, neuroprotection, and synaptic plasticity. Neurochem. Res. 2005, 30, 1521-1528. 4. C. Rae, F.A. Nasrallah, S. Bröer. Metabolic effects blocking lactate transport in brain cotical tissue slices using an inhibitor specific to MTC1 and MTC2. Neurochem. Res. 2009, 34, 1783-1791. 5. S. Law, G. Raisman, D. Li. Organotypic slice co-cultures reveal that early postnatal hippocampal axons lose the ability to grow along the fimbria, while retaining the ability to invade and arborise in septal neutrophil. Eur. J. Neurochem. 2010, 31, 1352-1358. 6. M. Rupnik. The physiology of rodent beta-cells in pancreas slices. Acta Physiol. 2009, 195, 123-138. 7. M.A. van Geer, K.F.D. Kuhlmann, C.T. Barker, F.J.W. ten Kate, R.P.J. Oude Elferink, P.J. Bosma. Ex-vivo evaluation of gene therapy vectors in human pancreatic cancer tissue slices. World J. Gastroenter. 2009, 15, 1359-1366. 8. A. Bussek, E. Wettwer, T. Crist, H. Lohmann, P. Camelliti, U. Ravens. Tissue slices from mammalian hearts as a model for pharmacological drug testing. Cell Physiol. Biochem. 2009, 24, 527-536. 9. R. Nave, R. Fisher, N. McCracken. In vitro metabolism of beclomethasone dipropionate, budesonide, ciclesonide, and fluticasone propionate in human lung precision-cut tissue slices. Respiratory Res. 2007, 8, 65. 10. M.A. Stoff-Khalili, A. Stoff, A.A. Rivera, N.S. Banerjee, M. Everts, S. Young, G.P. Siegal, D.F. Richter, M.Wang, P. Dall, J. M. Mathis, Z.B. Zhu, D.T. Curiel. Preclinical evaluations of transcriptional targeting strategies for carcinoma of the breast in a tissue slice model system. Breast Cancer Res. 2005, 7, R1141-R1152.
11. M. Zimmermann, J. Lampe, S. Lange, I. Smirnow, A. Könngsrainer, C. Hann-von-Weyhern, F. Fend, M, Gregor, M. Bityer, U. M. Lauer. Improved reproducibility in preparing precision-cut liver tissue slices. Cytotechnology 2009, 145-172. 12. J. A. Harrigan, B. P. McGarrigle, T. R. Sutter, J. R. Olson. Tissue specific induction of cytochrome P450 (CYP) 1A1 and 1B1 in rat liver and lung following in vitro (tissue slice) and in vivo exposure to benzo(a)pyrene. Toxicology in vitro 2006, 20, 426-438. 13. I. Milisav, D. Nipič, D. Šuput. The riddle of mitochondrial caspase-3 from liver. Apoptosis 2009, 14, 1070-1075. Corresponding author Irina Milisav, Institute of Pathophysiology, Faculty of Medicine, University of Ljubljana, Slovenia, E-mail: irina.milisav@mf.uni-lj.si
2050
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Automatic identification breast cancer using multiresolution algorithm
Marina Djokovic1, Aleksandar Peulic1, Nenad Filipovic2
1 2
Technical Faculty Cacak, University of Kragujevac, Serbia, Faculty of Mechanical Engineering Kragujevac, University of Kragujevac, Serbia.
Abstract In this paper, we present a multiresolution scheme to detect stellate lesions in mammograms. Multiresolution analysis is used to analyze the images at different frequencies with different resolutions. First we removed the noise from mammograms using Multiresolution analysis and then we detected tumors. Then, using the Embedded Zerotree Wavelet (EZW) algorithm, we compressed denoising mammographic image and showed that by applying the algorithm to detect tumors in the compressed image we obtained the same results as in the case of non-compressed images. Experimental results obtained from the mammographic images of patients recorded in the Clinical Center in Kragujevac, show that using multiresolution algorithm can be detected tumors of different sizes. Key words: Multiresolution analysis of mammograms, Discrete Wavelet Transformation, Embedded zerotree wavelet, Breast cancer. Introduction Mass noncommunicable diseases, such as cancer, are the leading cause of death worldwide [1]. Breast cancer is the most common cancer among women in the world. Rehabilitation in oncology is mentioned in the mid 60’s of the 20th century, when, due to quantitative and qualitative achievements in oncology, first of all in breast oncology, the need for complete or maximally possible functional training of the patients with malignant diseases had occurred [2]. Breast cancer screening with mammography has been shown to be effective for preventing breast cancer death. All women who belong to the age gro-
up 40 – 64 should be included in a regular screening program every year. This research included women between 40 and 64. On the first mammographic examination one screens mediolateral and craniocaudal mammograms [3]. However mammography screening can be harmful to women. One of the major problems is anxiety or lack of peace of mind in mammography screening [4]. The anatomy of the breast is very complex [5]. Each breast contains between 15 to 20 lobes that are connected to the nipple through a complex structure of converging ducts. Each lobule consists of 10 to 100 terminal duct lobular units, the areas where breast cancer originates. Therefore, in many countries breast cancer screening programs using mammography have been started to detect cancers as early as possible. An important development that may help to improve the performance in breast cancer screening as well as clinical practice is computer aided diagnosis (CAD). Mammograms have to be digitized before automated methods can search them for abnormalities. It is hoped that CAD can help to decrease the number of errors, both false negatives (malignant cases that were not recalled) and false positives (cases that are recalled unnecessarily). Software can help searching for suspicious signs, or could help classifying lesions or microcalcifications in benign or malignant types. Important work was done to transform the mammogram in such away that it can be printed or examined on a monitor optimally [6, 7]. The dark area near the skin line can be enhanced and the pectoral muscle can be filtered out, largely reducing the intensity range in the mammogram [8, 9]. Good contrast will be available in the whole area of interest, both in the pectoral area as well as near the skin line. 2051
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
If the mass is surrounded by a radiating pattern of spicules, it is called a stellate lesion. Not all tumors have a central mass, especially lobular carcinomas are often only detectable due to an architectural distortion of the breast tissue. However, in practice a whole spectrum of appearances from lesions without a central mass, lesions with both a mass and spicules to lesions without any spiculation is found. The central mass is a more or less circular bright region with a diameter between 5 mm and 5 cm. Sometimes a mass looks very much like normal glandular structure, and is only detectable due to asymmetry between the left and right breasts. These approaches perform some kind of image subtraction, and can also be used to detect temporal changes when a mammogram is compared with an older mammogram of the same breast. Matching two breasts is a complicated procedure because there is only an approximate correspondence between the normal tissue in the two breast. The aim of this investigation is detection of such stellate patterns without relying on the presence of a central mass. When a mass is surrounded by spicules, it is likely to be malignant. Many stellate lesions are easier to detect by their spicules than by their central mass, and for architectural distortions it is the only sign. The presence of spiculations or a more diffuse stellate appearance in mammograms is almost pathognomonic of breast cancer. Therefore, the detection of stellate lesions is very important in the characterization of breast cancer. Unfortunately, it is also very diffcult. A stellate lesion has an irregular center with ill-defined borders radiating spicules that may extend from several millimeters to centimeters in size. Features usually are local and extracted within a certain neighborhood [10]. In many cases the stellate pattern of spicules is the most important sign. Dealing with noise in mammograms is very important for microcalcification detection algorithms. A major problem with denoising images by filtering is that filtering leads to blurring of the image. Hence filtering can be practically used only to remove noise which is out of the band of frequencies of the signal. The wavelet decomposition of a signal not only indicates the frequency content of the signal, but also the temporal or spa2052
tial position of that component. Hence, by working in the wavelet domain, it should be possible to reduce the blurring of image edges which occurs in image denoising by filtering [11]. Denoising, the task of removing or suppressing uninformative noise from signals, is an important part of many signal or image processing applications. Wavelet transform, which was put forward by the mathematicians at first, is a signal processing technique. The Wavelet technique can be applied to various fields such as applied mathematics, signal processing, sound and picture compressing techniques [12]. Wavelets are common tools in the field of signal processing. The popularity of wavelets in denoising is largely due to the computationally efficient algorithms as well as to the sparsity of the wavelet representation of data. By sparsity we mean that majority of the wavelet coefficients have very small magnitudes whereas only a small subset of coefficients have large magnitudes. This small subset contains the interesting informative part of the signal, whereas the rest of the coefficients describe noise and can be discarded to give a noise-free reconstruction [13]. The best knownwavelet denoising methods are thresholding approaches. In hard thresholding all the coefficients with greater magnitudes than the threshold are retained unmodified as they are thought to comprise the informative part of data, while the rest of the coefficients are considered to represent noise and set to zero. However, it is reasonable to assume that coefficients are not purely either noise or informative but mixtures of those. In soft thresholding the coefficients with magnitudes smaller than the threshold are set to zero, but the retained coefficients are also shrunk towards zero by the amount of the threshold value in order to decrease the effect of noise assumed to corrupt all the wavelet coefficients [13]. The drawbacks of thresholding schemes are that they may lead to discontinuities in the wavelet coeffcient values at the threshold values (in case of hard thresholding), and that they direct thresholding schemes do not take into account inter-scale correlations [11]. Wavelet image coding has been fertile area of research in the image processing community in recent years particurarly in relation to image compression. It does not only provide a good compression result, but it is also suitable for progressive
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
transmissions and provides a multi resolution capability. However, applying the wavelet transform on images for compression alone does not reduce the amount of data to be compressed, since it may remove some of the redundancy and decorrelate the neighbour pixels [14]. We used intensity adjustment to improve an image. Intensity adjustment is an image enhancement technique that maps an image's intensity values to a new range. An image lacks contrast when there are no sharp differences between black and white. Brightness refers to the overall lightness or darkness of an image. In this process, pixel values below a specified value are displayed as black, pixel values above a specified value are displayed as white, and pixel values in between these two values are displayed as shades of gray. The result is a linear mapping of a subset of pixel values to the entire range of grays, from black to white, producing an image of higher contrast. The following figure shows this mapping. Note that the lower limit and upper limit mark the boundaries of the window, displayed graphically as the red-tinted window [15].
Figure 2. Mammographic image before increase contrast
Figure 1. Relationship of pixel values to display range Given that we process a monochrome picture, reinforcing the contrast will be seen more clearly stellate lesions on mammograms. Figures 2. and Figure 3. shows that the stellate lesions clearly observed in the picture with enhanced contrast. Figure 2. represents the mammographic image before increase contrast. Figure 3. represents the mammographic image after increase contrast.
Figure 3. Mammographic image after increase contrast Materials and Methods Multiresolution analysis Multiresolution analysis is designed to give good time resolution and poor frequency resolution at high frequencies and good frequency resolution and poor time resolution at low frequencies. This approach makes sense especially when the 2053
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
signal at hand has high frequency components for short durations and low frequency components for long durations. The continuous wavelet transform was developed as an alternative approach to the short time Fourier transform to overcome the resolution problem. The wavelet analysis is done in a similar way to the STFT analysis, in the sense that the signal is multiplied with a function, (it the wavelet), similar to the window function in the STFT, and the transform is computed separately for different segments of the time-domain signal. The continuous wavelet transform is defined as follows: ...... (1) As seen in the above equation , the transformed signal is a function of two variables, τ and s , the translation and scale parameters, respectively. y(t) is the transforming function, and it is called the mother wavelet . The term translation is used in the same sense as it was used in the STFT; it is related to the location of the window, as the window is shifted through the signal. This term, obviously, corresponds to time information in the transform domain. However, we do not have a frequency parameter, as we had before for the STFT. Instead, we have scale parameter which is defined as 1/frequency. The term frequency is reserved for the STFT. The parameter scale in the wavelet analysis is similar to the scale used in maps. As in the case of maps, high scales correspond to a non-detailed global view (of the signal), and low scales correspond to a detailed view. Similarly, in terms of frequency, low frequencies (high scales) correspond to a global information of a signal (that usually spans the entire signal), whereas high frequencies (low scales) correspond to a detailed information of a hidden pattern in the signal (that usually lasts a relatively short time). In today's world, computers are used to do most computations. It is apparent that neither the FT, nor the STFT, nor the CWT can be practically computed by using analytical equations. It is therefore necessary to discretize the transforms. First consider the discretization of the scale axis. Among that 2054
infinite number of points, only a finite number are taken, using a logarithmic rule. The most common value for the base of the logarithmis 2 because of its convenience. If 2 is chosen, only the scales 2, 4, 8, 16, 32, 64,...etc. are computed. The time axis is then discretized according to the discretization of the scale axis. Since the discrete scale changes by factors of 2 , the sampling rate is reduced for the time axis by a factor of 2 at every scale. Expressing the above discretization procedure in mathematical terms, the scale discretization is S=S0j, and translation discretization is τ=k S0j τ0 where S0>1 and τ0>0. When discretized dilation and tanslacija replace the continuous wavelet function: ..................... (2) obtain the discretized wavelet function: ............. (3) Although the discretized continuous wavelet transform enables the computation of the continuous wavelet transform by computers, it is not a true discrete transform. As a matter of fact, the wavelet series is simply a sampled version of the CWT, and the information it provides is highly redundant as far as the reconstruction of the signal is concerned. This redundancy, on the other hand, requires a significant amount of computation time and resources. The discrete wavelet transform (DWT), on the other hand, provides sufficient information both for analysis and synthesis of the original signal, with a significant reduction in the computation time. The main idea is the same as it is in the CWT. A time-scale representation of a digital signal is obtained using digital filtering techniques. Recall that the CWT is a correlation between a wavelet at different scales and the signal with the scale (or the frequency) being used as a measure of similarity. The continuous wavelet transform was computed by changing the scale of the analysis window, shifting the window in time, multiplying by the signal, and integrating over all times. In the discrete case, filters of different cutoff frequencies are used to analyze the signal at different scales.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The signal is passed through a series of high pass filters to analyze the high frequencies, and it is passed through a series of low pass filters to analyze the low frequencies. The resolution of the signal, which is a measure of the amount of detail information in the signal, is changed by the filtering operations, and the scale is changed by upsampling and downsampling (subsampling) operations. Subsampling a signal corresponds to reducing the sampling rate, or removing some of the samples of the signal. The DWT analyzes the signal at different frequency bands with different resolutions by decomposing the signal into a coarse approximation and detail information. DWT employs two sets of functions, called scaling functions and wavelet functions, which are associated with low pass and highpass filters, respectively. The decomposition of the signal into different frequency bands is simply obtained by successive highpass and lowpass filtering of the time domain signal. The original signal x[n] is first passed through a halfband highpass filter g[n] and a lowpass filter h[n]. After the filtering, half of the samples can be eliminated according to the Nyquist’s rule, since the signal now has a highest frequency of p /2 radians instead of p . The signal can therefore be subsampled by 2, simply by discarding every other sample. This constitutes one level of decomposition and can mathematically be expressed as follows: .................. (4)
At every level, the filtering and subsampling will result in half the number of samples (and hence half the time resolution) and half the frequency band spanned (and hence double the frequency resolution) [16]. The difference between this transformation and Fourier transformation is that it is known time of occurrence frequency. However, the time during which these frequencies will have a resolution which depends on the level at which they appear. If the main information signal contained in very low frequencies, their temporal location will not be very accurate, because only a few samples used to represent the signals at these frequencies. This algorithm provides good temporal resolution for high frequencies and good frequency resolution for low frequency signals. Frequencies that are not highlighted in the original signal will have very low amplitude and that part of the signal obtained by the discrete wavelet transformation can be discarded without significant loss of information, which significantly reduces the amount of data. In the case of two-dimensional signals such as images, in this way is formed multiresolution pyramid, shown in Figure 4. At each higher level is kept image two times less resolution than it was at the previous level and image details needed for the reconstruction of the signal.
where yhigh[k] and ylow[k] are the outputs of the highpass and lowpass filters, respectively, after subsampling by 2. This decomposition halves the time resolution since only half the number of samples now characterizes the entire signal. However, this operation doubles the frequency resolution, since the frequency band of the signal now spans only half the previous frequency band, effectively reducing the uncertainty in the frequency by half. The above procedure, which is also known as the subband coding, can be repeated for further decomposition.
Figure 4. Multiresolution pyramid Multiresolution representation of images in each level of decomposition consists of a discrete image approximation at lower resolution, and three image detail. Approximation corresponds to part of the spectrum which is obtained by lowpass filtering (LP) in both directions in the frequency plane. One of the image detail is obtained with horizontal LP and vertical highpass filtering (HP), the second vertical LP and horizontal HP filtering, 2055
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
while the diagonal detail images obtained by HP filtering in both directions. Multiple repeat leads to images with worsening resolution, which corresponds to a pyramidal decomposition, Figure 5.
Figure 5. Pyramidal decomposition of image Filtering images using wavelet transformation An image is often corrupted by noise during its acquisition or transmission. The de-noising process is to remove the noise while retaining and not distorting the quality of the processed image. The traditional way of image de-noising is filtering. A lot of research about non-linear methods of signal de-noising has been developed. These methods are mainly based on thresholding the Discrete Wavelet Transform (DWT) coefficients, which have been affected by additive white Gaussian noise [17]. The general wavelet denosing procedure is as follows: - Apply wavelet transform to the noisy signal to produce the noisy wavelet coefficients to the level which we need. - Select appropriate threshold limit at each level and threshold method (hard or soft thresholding) to best remove the noises. - Inverse wavelet transform of the thresholded wavelet coefficients to obtain a denoised signal.
The thresholding techniques are simple non-linear techniques that eliminate all the subband coefficients that their magnitude is under a certain threshold. The remaining coefficients remain either unaffected, which is called hard-thresholding or modified, which is called soft thresholding. The soft thresholding techniques eliminate the coefficients with magnitude less than the pre-specified threshold and shrink the rest of them. The reconstruction of the “clean” image, after the thresholding process, is performed with the inverse wavelet transform. The quality of the reconstructed image, which will contain some noise and may be distorted, is measured either subjectively by an optical evaluation or objectively by the Signal to Noise Ratio [17]. The de-noising algorithms, which are based on thresholding, suggest that each coefficient of every detail subband is compared to a threshold level and is either retained or killed if its magnitude is greater or less respectively. The approximation coefficients are not submitted in this process, since on one hand they carry the most important information about the image and on the other hand the noise mostly affects the high frequency subbands [17]. The type of the threshold is either hard or soft. Figure 6 indicates the two types of thresholding, which can be expressed analytically as follows. Hard threshold: Soft threshold: ............... (5) ....... (6)
where x is the input signal, y is the signal after threshold and T is the threshold level.
Figure 6. Threshold types (a) Original signal; (b) Hard; (c) Soft
2056
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The hard type does not affect the coefficients that are greater than the threshold level, whereas the soft type causes shrinkage to these coefficients [17]. For de-noising we used Haar wavelet. Figure 7 shows Haar wavelet's scaling function φ(t) and mother wavelet function ψ(t).
φ(t) = φ(2t) + φ(2t − 1) ................... (9) ψ(t) = φ(2t) − φ(2t − 1) The Haar transform is the simplest of the wavelet transforms. This transform cross-multiplies a function against the Haar wavelet with various shifts and stretches, like the Fourier transform cross-multiplies a function against a sine wave with two phases and many stretches. The Haar transform can be thought of as a sampling process in which rows of the transform matrix act as samples of finer and finer resolution. Image de-noising is executed by applying a two-level wavelet decomposition, wavelet Haar, and the threshold of 44.5. In Figure 8 shows the original mammography images and the estimated mammography images.
(a) (b) Figure 7. Wavelet Haar: (a) Scaling function; (b) Wavelet function The Haar wavelet's mother wavelet function ψ(t) can be described as: φ(t) and mother wavelet function ψ(t). ............... (7)
Its scaling function (t) can be described as: ................. (8) The Haar wavelet has several notable properties: 1. Any continuous real function can be approximated by linear combinations of and their shifted functions. This extends to those function spaces where any function therein can be approximated by continuous functions. 2. Any continuous real function can be approximated by linear combinations of the constant function, and their shifted functions. 3. Wavelet/scaling functions with different scale m have a functional relationship:
Figure 8. The original image (left) and the estimated image (right) Many methods for setting the threshold have been proposed. The most time-consuming way is to set the threshold limit on a case-by-case basis. The limit is selected such that satisfactory noise removal is achieved. For a Gaussian noise, if we apply orthogonal wavelet transform to the noise signal, the transformed signal will preserve the Gaussian nature of the noise, which the histogram of the noise will be a symmetrical bell-shaped curve about its mean value. From theory, four times the standard deviation would cover 99.99% of the noise. Therefore, we could set the threshold be 4.5 times of the standard deviation of the wavelettransformed signal to remove the Gaussian noise in the signal. We have known that the wavelet transform is constituted by different levels. The maximum level to apply the wavelet transform depends on how many data points contain in a data set. One factor 2057
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
that affects the number of level we can reach to achieve the satisfactory noise removal results is the signal-to-noise ratio in the original signal. Image data compression using discrete wavelet transformation Compressions based on wavelet transform are the state-of-the-art compression technique used in medical image compression. For medical images it is critical to produce high compression performance while minimizing the amount of image data so the data can be stored economically. The wavelet-based compression scheme contains transformation, quantization, and lossless entropy coding [18]. Modern radiology techniques provide crucial medical information for radiologists to diagnose diseases and determine appropriate treatments. Since more and more medical images are in digital format, more economical and effective data compression technologies are required to minimize mass volume of digital image data produced in the hospitals [18]. A measure of achieved compression is given by the compression ratio (CR) and the Bit-Per-Pixel (BPP) ratio. CR and BPP represent equivalent information. CR indicates that the compressed image is stored using CR % of the initial storage size while BPP is the number of bits used to store one pixel of the image. For a grayscale image the initial BPP is 8. For a truecolor image the initial BPP is 24, because 8 bits are used to encode each of the three colors (RGB color space) [15]. The challenge of compression methods is to find the best compromise between a low compression ratio and a good perceptual result. Typically, compression scheme can be categorized into two major categories: lossless and lossy compressions. Lossless image compression can be achieved if the original input image can be perfectly recovered from the compressed data while lossy image compression cannot regenerate the original image data. Lossy image compression, however, is able to maintain most details of the original image that is useful for diagnosis. The precise detail preservation of an image is not usually strictly required because the degraded part of 2058
the image is often not visible to a human observer. But the lossy image compression is not very commonly used in clinical practice and diagnosis because even with a slight data loss, it is possible that physicians and radiologists missed the critical diagnostic information that could be a decisive element for the diagnosis of a patient and the following treatment [18]. Medical image compression based on wavelet decomposition has become a state-of-the-art compression technology since it can produce notably better medical image results compared to the compression results that are generated by Fourier transform based methods such as the discrete cosine transform [18]. In general, there are three essential stages in a transform-based image compression system: transformation, quantization, and lossless entropy coding. Figure 9 depicts the encoding and decoding processes in which the reversed stages are performed to compose a decoder. The only different part in the decoding process is that the de-quantization takes place and it is followed by an inverse transform in order to approximate the original image. The purpose of transformation stage is to convert the image into a transformed domain in which correlation and entropy can be lower and the energy can be concentrated in a small part of the transformed image. Quantization stage results in loss of data because it reduces the number of bits of the transform coefficients. Coefficients that do not make significant contributions to the total energy or visual appearance of the image are represented with a small number of bits or discarded while the coefficients in the opposite case are quantized in a finer fashion. Such operations reduce the visual redundancies of the input image. The entropy coding takes place at the end of the whole encoding process. It assigns the fewest bit code words to the most frequently occurring output values and most bit code words to the unlikely outputs. This reduces the coding redundancy and thus reduces the size of the resulting bit-stream [18].
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Figure 9. Block diagram of the general compression and decompression processes 1. Transformation Wavelet transform exploits both the spatial and frequency correlation of data by dilations (or contractions) and translations of mother wavelet on the input data. It supports the multiresolution analysis of data i.e. it can be applied to different scales according to the details required, which allows progressive transmission and zooming of the image without the need of extra storage. Another encouraging feature of wavelet transform is its symmetric nature that is both the forward and the inverse transform has the same complexity, building fast compression and decompression routines. The implementation of wavelet compression scheme is very similar to that of subband coding scheme: the signal is decomposed using filter banks. The output of the filter banks is downsampled, quantized, and encoded. The decoder decodes the coded representation, up-samples and recomposes the signal [19]. Details of multiresolution analysis are explained above. 2. Quantization The embedded zerotree wavelet (EZW) is an effective algorithm employed in quantization stage. The EZW algorithm was one of the first algorithms to show the full power of wavelet-based image compression. At a given compression ratio in bit rate, EZW is able to achieve the best image quality and encode the image so that all lower bit rate encodings are embedded at the beginning of the final bit-stream. An embedded coding is a process of encoding the transform magnitudes
that allows for progressive transmission of the compressed image. Zerotrees are a concept that allows for a concise encoding of the positions of signi_cant values that result during the embedded coding process. The EZW algorithm is based on four key concepts: 1) a discrete wavelet transform or hierarchical subband decomposition, 2) prediction of the absence of significant information across scales by exploiting the self-similarity inherent in images, 3) entropy-coded successive-approximation quantization, and 4) universal lossless data compression which is achieved via adaptive arithmetic coding [20]. In the EZW’s algorithm, the information on which the coefficients are significant is generated and then encoded via quantization. The significance map determines whether a DWT coefficient is to be quantized as zero or not. A wavelet coefficient x is considered insignificant with respect to a given threshold T if |x| ≤ T . Otherwise a coefficient is called significant. Since the wavelet decomposition has the hierarchical structure in which each coefficient can be related to a set of coefficients that is at the next finer resolution level, a tree structure depicted in Fig. 5 can be defined as the concept of descendants and ancestors. The coefficient at the coarse scale is called the parent, and all coefficients corresponding to the same spatial location at the next finer scale of similar orientation are called children. For a given parent, the set of all coefficients at all finer scales of similar orientation corresponding to the same location are called descendants. Similarly, for a given child, the set of coefficients at all coarser scales of similar orientation corresponding to the same location are called ancestors. Figure 10 shows that parents must be scanned before children. Also note that all positions in a given subband are scanned before the scan moves to the next subband [20]. Given a threshold T to determine whether or not a coefficient is significant, a coefficient x is said to be an element of a zerotree root (ZRT) for the threshold T if itself and all of its descendents are insignificant with respect to the threshold T. An element of a zerotree for threshold T is a Zerotree root if it is not the descendant of a previously found zerotree root for threshold T, i.e., it is not predictably insignificant from the discovery of a zerotree root at a coarser scale at the same thre2059
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
shold. For the case which not all the descendants are insignificant, the coefficients are encoded as isolated zero (IZ). For encoding a significant coefficient, the symbol POS and NEG are used. Therefore, given a threshold T, the wavelet coefficients can be represented by the four symbols: zerotree root (ZRT), isolated zero (IZ), positive significant (POS) and negative significant (NEG) [18]. To perform the embedded coding, successive-approximation quantization (SAQ) is applied. SAQ is related to bit-plane encoding of the magnitudes. The SAQ sequentially applies a sequence of thresholds To,…, TN-1, to determine significance, where the thresholds are chosen so that Ti = Ti-1 /2. The initial threshold To is chosen so that |Xj|<2T0 for all transform coefficients xj [20]. During the encoding (and decoding), two separate lists of wavelet coefficients are maintained. At any point in the process, the dominant list contains the coordinates of those coefficients that have not yet been found to be significant in the same relative order as the initial scan. The subordinate list contains the magnitudes of those coefficients that have been found to be significant. For each threshold, each list is scanned once . During a dominant pass, coefficients with coordinates on the dominant list, i.e., those that have not yet been found to be significant, are compared to the threshold T, to determine their significance, and if significant, their sign. This significance map is then zerotree coded. Each time a coefficient is encoded as significant, (positive or negative), its magnitude is appended to the subordinate list, and the coefficient in the wavelet transform array is set to zero so that the significant coefficient does not prevent the occurrence of a zerotree on future dominant passes at smaller thresholds. A dominant pass is followed by a subordinate pass in which all coefficients on the subordinate list are scanned and the specifications of the magnitudes available to the decoder are refined to an additional bit of precision. More specifically, during a subordinate pass, the width of the effective quantizer step size, which defines an uncertainty interval for the true magnitude of the coefficient, is cut in half. For each magnitude on the subordinate list, this refinement can be encoded using a binary alphabet with a “1” symbol indicating that the true value falls in the upper half of the old uncertainty interval and a “0” symbol 2060
indicating the lower half. The string of symbols from this binary alphabet that is generated during a subordinate pass is then entropy coded. Note that prior to this refinement, the width of the uncertainty region is exactly equal to the current threshold. After the completion of a subordinate pass the magnitudes on the subordicate list are sorted in decreasing magnitude, to the extent that the decoder has the information to perform the same sort. The process continues to alternate between dominant passes and subordinate passes where the threshold is halved before each dominant pass. [15]. In the decoding operation, each decoded symbol, both during a dominant and a subordinate pass, refines and reduces the width of the uncertainty interval in which the true value of the coefficient (or coefficients, in the case of a zerotree root) may occur. The reconstruction value used can be anywhere in that uncertainty interval. The encoding stops when some target stopping condition is met, such as when the bit budget is exhausted. The encoding can cease at any time and the resulting bit stream contains all lower rate encodings [20].
Figure 10. Scanning order of the subbands for encoding a significance map 3. Entropy coding The output symbol stream is an input to an entropy encoder to complete the last stage of the compression without adding distortion. The lo-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
ssless entropy encoding process replaces the symbol stream produced in the quantization stage with a sequence of binary codewords which is called a bit stream. The probability of the corresponding symbol is proportional to the length of a codeword. The smallest possible number of bits that is required to represent a symbol sequence can be defined as the entropy of the symbol source: .................... (10) Here the pi is the probability of the ith symbol. In the optimal case, the sum of the probability would be equaled to 1 and the ith symbol would be . We can define the entropy as the expected length of binary code over all possible symbols [18]. Image compression results For image compression we use the Haar wavelet and EZW algorithm. Key parameter for image compression using EZW algorithm is number of loops that growing give a better picture and a lower compression ratio. Figure 11 compares the original image and image compressed using the EZW algorithm, 6 loop and Haar wavelet. Figure 12. The original image and image compressed using EZW algorithm (9 loops) and Haar wavelet Satisfactory compression ratio, satisfactory bitpixel ratio and satisfactory image quality is obtained using the EZW algorithm with 12 loop and the Haar wavelet, shows Figure 13.
Figure 13. The original image and image compressed using EZW algorithm (12 loops) and Haar wavelet Results and discussion The basic idea is to detect breast tumors using image parameters which are reliably known to contain tumor. Necessary data about the image that contains the tumor and by which we detect a tumor are the central pixel coordinates and latitude and longitude (expressed by the number of pixels) of images representing the tumor. From the image we know that contains a tumor, we extract the tumor that have the following parameters: mean pixel intensity value is 166.7601 and the standard deviation is 32.9223. Based on these values we are looking for parts of the uncultivated image to detect the tumor with the approximate values of the same parameters. Standard deviation 2061
Figure 11. The original image and image compressed using EZW algorithm (6 loops) and Haar wavelet Compression ratio and the ratio of bit-pixels are very small, which is good, but picture quality is very poor. For this reason it is necessary to increase the number of loops. If instead of the 6 loops use the 9 loop compression ratio and the ratio of bit-pixel is a small increase in benefit quality of compressed images but the quality of compressed images is still unsatisfactory, as shown in Figure 12.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
and mean pixel intensity value we calculated as the following. Let (i; j) be the spatial location in the mammogram at row i and column j; uij be the pixel brightness at (i; j). For each M-by-N image, the standard deviation is the square root of the variance and is given by the following equation: ................... (11) where µ is the mean of the input matrix u and is given by the following equation: ....................... (12) After removing the noise on both images, to calculate the values of the parameters that characterize the tumor, we separated the tumor with a known location. Figure 14 shows previously processed image that is image which is used for detecting tumors. Figure 15. Tumor which is used for detecting other tumors After extracting the known tumor, we calculated mean pixel intensity value and standard deviation of that known tumor. Then we defined the width and height for part of image whose parameters are checked, here it is 100 pixels for both, and tolerances for mean pixel intensity value and sdandardne deviation. Then, on the image where we need to detect tumor, we search for part size 100x100 with mean pixel intensity value and standard deviation which are approximately equal to the mean pixel intensity value and standard deviation of known tumor, taking into account the tolerances. Figure 16 shows the result of that search, original mammography breast image without increased contrast, with detected tumors.
Figure 14. Mammography image with detected tumor which is used for detection of other tumors Figure 15 shows the tumor which is detected on mammography image from Figure 14. Figure 16. Mammography image with detected tumors 2062
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Figure 17 shows the part of mammographic image with enhanced contrast, that is tumor detected in Figure 16.
mograms of which is the one reliably known to contain tumor, and for others it is not known. Initial results that we obtained show that it is possible to compress mamograms using multiresolution mammogram analysis and EZW algorithm and the result of detection of the tumor did not change compared to the detection of tumors in uncompressed mammograms. In future work, we will try to improve the technique of automatic detection of tumors by comparing standard deviation of gradient orientation histogram and the standard deviation of the folded gradient orientations of the two mammograms. Acknowledgment The part of this research is supported by Ministry of Science in Serbia, Grant III41007. References
1. Novakovic B, Jovicic J, Milic N, Jusupovic F, Grujicic M, Djuric D: Nutrition care process in cancer, HealthMED Journal, 2010; Vol. 4, No. 2, pp 427433. 2. Popovic-Petrovic S, Tomic S, Popovic M: Rehabilitation in oncology, HealthMED Journal, 2010; Vol. 4, No. 4, pp 815-818. 3. Kunosic S, Ceke D, Kopric M, Lincender L: Determination of mean glandular dose from routine mammography for two age groups of patients, HealthMED Journal, 2010; Vol. 4, No. 1, pp 125131. 4. Bölükbaş N, Erbil N, Nuran Kahraman A: Determination of the Anxiety Level of Women Who Present for Mammography, HealthMED Journal, 2011; Vol. 5, No. 3, pp 543-548. 5. Tabar L, Dean P: Teaching atlas of mammography, Georg Thieme Verlag, New York, 1985. 6. Aylward SR, Hemminger BM, Pisano ED, Johnston RE: Mixture modeling for digital mammogram display and analysis, In Karssemeijer N, Thijssen MAO, Hendriks JHCL, Van Erning, editors LJTO, Digital Mammography, Kluwer, Dordrecht, 1998; pp 305–312.
Figure 17. Tumor detected in Figure 16 The results of detecting tumor in mammogram before and after compression of mammogram are very similar, almost the same. The reason is the fact that the values of standard deviation and mean pixel intensity of image part which represent the tumor, before compression and the value of standard deviation and mean pixel intensity of image part which represent the tumor, after compression, almost the same. As we said, before compression, image part which represent the tumor has the following parameters: mean pixel intensity value is 166.7601 and the standard deviation is 32.9223. After compression, mean pixel intensity value and the standard deviation of image part which represent the tumor are 166.6986 and 32.1573, respectively. Conclusion Discrete wavelet transformation analyzes the image at different frequency bands, different resolutions, decomposing the image in a coarse approximations and detailed informations. Using two-dimensional wavelet analysis images can be effectively compressed without sacrificing image quality. Using two-dimensional wavelet analysis we can effectively remove noise from the image. The problem of developing algorithms to detect tumors is the inability of a competent testing due to lack of high-quality database of digital images. In this paper we presented an automatic method of detecting breast cancer, comparing the standard deviation and mean pixel intensity of two mam-
Journal of Society for development in new net environment in B&H
2063
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
7. Netsch T, Biel M, Peitgen HO: Display of highresolution digital mammograms on crt monitors. In Karssemeijer N, Thijssen MAO, Hendriks JHCL, Van Erning LJTO, editors, Digital Mammography, Kluwer, Dordrecht, 1998; pp 313–320. 8. Byng JW, Critten JP, Yaffe MJ: Thickness-equalization processing for mammographic images, Radiol, 1997; pp 564–568. 9. Karssemeijer N, Brake GM: Detection of stellate distortions in mammograms, IEEE Trans Med Imag, 1996; pp 611–619. 10. Liu S, Delp EJ: Multiresolution detection of stellate lesions in mammograms, Santa Barbara, CA, USA, 1997; pp 109 - 112 . 11. Afonso M, Joshi SD: A wavelet based scheme for adaptive noise canceling from images, Proceedings of the 28th General Assembly of the International Union of Radio Science (U.R.S.I.) 2005. 12. Kıyak İ, Kentli F, Gökmen G: Analyzing End Effect of Single-Sided LIM by Using Wavelet Filter Bank, TTEM - Technics Technologies Education Management Journal, 2011; Vol. 6, No. 1, pp 61-68. 13. Ojanen J, Heikkonen J: MDL and wavelet denoising with soft thresholdin, Submitted to 2008 Workshop on Information Theoretic Methods in Science and Engineering, 2008. 14. Khalifa O: Wavelet coding design for image data compression, The International Arab Journal of Information Technology, 2005; Vol.2, No.2, pp 118-127. 15. Wavelet Toolboox, For use with MATLAB. 16. Polikar R: The wavelet tutorial, Rowan University, College of Engineering Web Server, Glassboro, New Jersey, USA, 1996. 17. Ellinas JN, Mandadelis T, Tzortzis A, Aslanoglou L: Image de-noising using wavelets, T.E.I. of Piraeus Applied Research Review, 2004; Vol. 9, No.1, pp 97-109. 18. Ding JJ: Introduction to Medical Image Compression Using Wavelet Transform, National Taiwan University Graduate Institute of Communication Engineering, 2007. 19. Talukder KH, Harada K: Haar Wavelet Based Approach for Image Compression and Quality Assessment of Compressed Image, IAENG International Journal of Applied Mathematics, 2007; Vol. 36, No. 1.
20. Shapiro JM: Embedded Image Coding Using Zerotrees of Wavelet Coefficients, IEEE Transactions on Signal Processing, 1993; Vol. 41, No. 12, pp 3445-3462. Corresponding author Marina Djokovic, Technical Faculty Cacak, University of Kragujevac, Serbia, E-mail: marina.m.djokovic@gmail.com
2064
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Deaths in Hotels
Muhammet Can¹, Riza Yilmaz², Isil Pakis³ ¹ University of Balıkesir, Medical School, Department of Forensic Medicine, Balıkesir, Turkey, ² University of Karaelmas, Medical School, Department of Forensic Medicine, Zonguldak, Turkey, ³ University of Acibadem, Medical School, Department of Forensic Medicine, Istanbul, Turkey.
Abstract Background: Deaths occurring in hotels are the result of several causes like asphyxia due to fire, intoxication and multiple traumas on the body. Methods: In this study, 28359 death records of the Council of Forensic Medicine, Istanbul, Turkey between 1 January 2000 and 1 January 2008 were analyzed retrospectively and 76 cases of deaths identified in hotels were included. Data about these cases were evaluated regarding age, sex, marital status, occupation, nationality, history, scene investigation and autopsy findings and cause of death. Results: The mean age of the cases was 39.69±4.32 (range between 1 and 78 years). Sixty (78.9%) males and 16 (21.1%) females with a male/female ratio of 3.75 were recorded. Nationality was Turkish in 58 (76.3%) cases and foreign in 18 (23.7%) cases. Autopsy was performed in 75 (98.7%) cases. Conclusion: We concluded that safety measures targeting detailed booking and health records at entry to hotels, improving security measures against firearms at airports, correcting deficiencies in basic facilities like electricity and ensuring barricades and lifeguards at the beaches and pools and implementing legal arrangements like physicians at place of work could lower death rates. Key Words: Hotel, death, autopsy, scene investigation Introduction Individuals with limited housing options might also live in motels, sometimes with rent subsidised by welfare agencies. These housing situations can be important indicators of socioeconomic deprivation beyond that which can be determined on the basis of income alone [1]. Homeless and margi-
nally housed individuals living in shelters, rooming houses, or hotels have significantly higher mortality rates than individuals with incomes in the lowest fifth of the distribution [2]. Compared with the entire cohort, life expectancy was shorter by 13 years for men and eight years for women living in shelters; 11 and nine years, respectively, for those living in rooming houses; and eight and five years, respectively, for those living in hotels [3]. Many excess deaths were attributable to diseases related to alcohol and smoking and to violence and injuries, much of which might have been related to substance misuse. There were also many excess deaths related to mental disorders and suicides. Other research suggests that expanding the implementation of recent innovations in supported housing programmes for people with addictions and mental illness could be instrumental in reducing the number of excess deaths [4]. The most common methods of suicide for the Manhattan nonresidents were long fall, hanging, overdose, drowning, and firearms; the most common locations included hotels and commercial buildings [5]. Between 1978 and 1997 the Institute of Legal Medicine of the Hannover Medical School examined 17 fatal autoerotic deaths. One of the them were found in a hotel room [6]. Hotels are economic, social and socially controlled establishments that provide paid lodging and meals, usually on a short-term basis to be preferred by physical components like structure, technical equipment, comfort and service conditions and moral components like social value and quality of service and staff [7]. Hotels are used by national and international guests with travel and business purposes. Service is provided by hotel employee. Deaths occurring in hotels are the result of several causes like asphyxia due to fire, intoxication and multiple traumas on the body [8-15]. 2065
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The aim of this study was to determine the causes of deaths hotels to investigate hotel neglect and deficiencies in preventable deaths and to discuss possible precautions. Methods All cases submitted to the First Specialization Board of the Council of Forensic Medicine, Ministry of Justice between 1 January 1999 and 1 January 2008 were reviewed. The First Specialization Board is an official expert commission and serves as a supreme board in Turkey. Cases are submitted to this board by the courts from all over the country demanding a more detailed examination and a final conclusion. The Board consists of a general surgeon, a cardiovascular surgeon, a neurosurgeon, a gynecologist, an internist, a cardiologist, a hematologist, an immunologist, a pathologist and three forensic specialists. This Board evaluates the whole material in the files and tries to determine the cause of death and prepares a final report. The final reports are detailed in origin and preserved by the Council of Forensic Medicine. In this study, 28359 death records of the Council of Forensic Medicine, Istanbul, Turkey between 1 January 1999 and 1 January 2008 were analyzed retrospectively and 76 cases of deaths identified to have occurred in hotels were included. Data about these cases were evaluated regarding age, sex, marital status, occupation, nationality, history, scene investigation and autopsy findings and cause of death.
Results The mean age of the cases found death in hotels and evaluated by the First Specialization Board of the Council of Forensic Medicine was 39.69±4.32 (range between 1 and 78 years). Sixty (78.9%) males and 16 (21.1%) females with a male/female ratio of 3.75 were recorded. Data about age and sex are shown in Table 1. Marital status was recorded as married in seven, single in eight and unknown in 61 (80.3%) cases and eighteen (23.7%) of them were recorded as living alone, 21 (27.6%) not living alone and in 37 (48.7%) cases no information was available. Nationality was Turkish in 58 (76.3%) cases and foreign in 18 (23.7%) cases. Information about occupation was missing in 62 (81.5%) cases; the remaining were four students, three retired, three self-employee, three hotel personnel and one tourist guide. Location of cases were hotel room in 68 (89%), hotel bathroom in three, hotel toilet in two, hotel disco in one, hotel beach in one, hotel pool in one and in front of the hotel building in one. Main findings at scene investigations consisted of medications used in chronically heart diseases, asthma and diabetes, alcoholic beverage, oriental tobacco, cigarettes, numerous sedatives and narcotic drugs and related empty boxes, eight syringes, knifes, bloodstains on the bed sheets, sofa bed, toilet seat edges and carpets, a rope hanging from the ceiling, short barrel guns shells and cartridges, suicide letters, a hammer, damaged and loose electricity conduits, pieces from the corpses in sacks in the rooms or bathrooms and messiness. A dead
Table 1. Distribution of the cases according to age groups and sex
Years 0-10 11-20 21-30 31-40 41-50 51-60 61-70 71Total Sex Male 0 3 10 19 16 8 3 1 60 (78.9) Female 2 2 2 6 0 3 1 0 16 (21.1) Total 2 5 12 25 16 11 4 1 76 (100.0) Percent 2.6 6.6 15.7 32.9 21.1 14.5 5.3 1.3 100.0
2066
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
person with an intravenous serum in the arm and a syringe with dissolved heroin and a piece of lemon in the background can be seen in Figure 1,2.
ce with firearms injuries (Figure 3,4). X-ray evaluation before autopsy of the case deceased after gunshot injury on the neck revealed pellets compatible with hunting gunshot (Figure 3). In cases with findings indicating trauma and electric shock (Figure 5), crater-like lesions collapsed in the center and raised in the margins, superficial skin and subcutaneous lesions, blunt wounds, ecchymosis and hematoma were identified (Figure 6).
Figure 1. A dead person with an intravenous serum in the arm is seen Figure 3. Entrance wound in the neck was detected in a case with findings in accordance with firearms injury. X-ray evaluation on the right side before autopsy of the case deceased after gunshot injury on the neck revealed pellets compatible with hunting gunshot
Figure 2. The same dead person with a syringe with dissolved heroin and a piece of lemon in the background is seen. Wounds in 1-1.5 cm diameter at the chest region of the clothing probably due to firearms and plaster bandage on the leg of one case were observed. Deposits of gunpowder were detected at ballistic investigation of the wounds. Examination of the guns demonstrated that one was handmade and each of them was in running order. Upon autopsy examination performed in 75 (98.7%) cases no signs of external trauma could be detected in 52 cases. In nine cases, decay of the body resulted in insufficient data for differential diagnosis about external trauma. Two cases with foamy fluids in the mouth and nose were recorded. Entrance and exit wounds in the skull and chest were detected in cases with findings in accordanFigure 4. Exit wound in the skull was detected in another case with findings in accordance with firearms injury
Figure 5. In cases with findings indicating trauma and electric shock 2067
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Figure 6. Crater-like lesions collapsed in the center and raised in the margins, superficial skin and subcutaneous lesions, blunt wounds, ecchymosis and hematoma were seen in an old woman In a female case, a woman is found dead, a plastic bag covering her head, face and neck so that it prevents her from breathing. Hands and arms with legs and foot are tied to her back with a rope which is also tied to her neck, which is called swine rope (Figure 7).
In five cases, scar on the arms and abdomen were detected possibly resulting from razor blade wounds. Macroscopic results upon autopsy examination of the internal organs illustrated decay in nine cases while assessment was impossible but signs about trauma to the bony structure were not detected. One case with incised wounds on the chest revealed stab wounds in the lung and heart at autopsy examination. Autopsy examination in one case of death from hanging demonstrated subcutaneous ecchymosis in soft tissue under the posterior region of the neck showing an ascending pattern of ecchymosis and fracture of the hyoid cartilage. In four cases skull bone fractures, subarachnoid hemorrhage, brain tissue damage, cervical bone fracture and spinal cord injury, and neck vesselnerve bundle injury were detected in concordance with gunshot injuries. In one of these cases a hammer was found beside the corps (Figure 6,8,9). In one case, fracture of the rib, lung and heart injury were detected probably due to firearm injuries. In another case with a severe damaged corpse, the head was separated at the 3. and 4. cervical vertebra. In one case, fractures in the skull bones, subarachnoid hemorrhage, and damage of the brain tissue, rib fractures and lung contusion were recorded in accordance with fall from height.
Figure 7. Hands and arms with legs and foot are tied to her back with a rope which is also tied to her neck, called swine rope In a female case lacerations in vulva and vagina and in the posterior fornix and cervix were noticed. In one case, the head and the body were separated reflecting traumatic injury and both arms and legs were rid apart from the trunk with their ends released. In three cases, signs of head injury, in four cases injection marks on the back of the hand and in the antecubital fossa were observed. 2068
Figure 8. A hammer was found beside two corps Macroscopic findings were as follows: Brain examinations revealed edema, congestion, paleness, and hyperemia, elimination of the sulcus, flattening of the gyrus, epidural, subdural and subarachnoid and intracerebral hemorrhage and skull
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
bone fractures in some cases while in some cases macroscopic pathology was absent.
Figure 9. Blunt wounds of superficial skin in the skull, ecchymosis, hematoma and fracture were seen in an old man Macroscopic pathology upon examination of the heart exposed hypertrophy, aneurisms, minimal to severe obstructive atherosclerotic changes in the coronary arteries, minimal to diffuse whitish color changes in the myocardium in some cases while no changes were observed in some. Examination of the lungs showed macroscopic pathological changes like edema, increase in weight, and hyperemia in some cases while no changes were recorded in some. Examination of Table 2. Cause of death and distribution of gender
Cause of death Firearm injury Intoxication Existing heart disease Undetermined Electric shock Generalized trauma due to fall from height Blunt head trauma Pulmonary emboli due to femur fracture Mechanical asphyxia due to hanging Drowning (pool) Sharp injuries Hypovolemic shock due to sexual trauma Drowning (sea) Total (%)
the liver resulted in findings like stasis, macrovesicular fattening and hyperemia. Life-threatening macroscopic pathological changes could not be detected in other internal organs. The following findings were noticed in microscopic evaluation of the organs and tissues of the cases: three cases with putrefaction showed autolysis at histological examination. Thrombosis in the lungs was observed in the case with the plaster bandage on the leg. Histological examination was missing in the files of cases where the cause of death was due to firearms and knifes. Additional findings included hyperemia-hemorrhage and epidural, subdural and subarachnoid hemorrhage in the brain, hypertrophy and fibrosis, chronic hypoxic changes and fibrous tissue bands at the myocardium and myocardial fibers, atherosclerotic changes resulting in 30%-100% obstructive lesions in the coronary arteries, edema, hyperemia and intra-alveolar hemorrhage in the lungs, microvesicular fattening in the liver, chronic pyelonephritic changes in the kidney and thermal changes in the skin. Upon chemical examination of tissue, blood, urine and gastric content of the corpses no toxic, hypnotic and narcotic substances could be detected in 45 (59.%) cases while in 18 (23.7%) cases ethanol, naproxen, diclofenac, amytripti-
Gender Male 3 8 25 16 2 1 2 1 1 1 0 0 0 60 (78.9) Female 2 5 1 4 0 0 1 0 0 0 1 1 1 16 (21.1)
Total 5 13 26 20 2 1 3 1 1 1 1 1 1 76 (100.0)
Percent (%) 6.6 17.1 34.2 26.5 2.6 1.3 3.9 1.3 1.3 1.3 1.3 1.3 1.3 100.0
Journal of Society for development in new net environment in B&H
2069
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
lin, benzodiazepam, barbiturate and carboxyhemoglobin was identified although serum concentration of these substances were below toxic or fatal levels. In 13 cases, serum levels of ethanol, doxilamine, sertaline, codeine, heroin, morphine, amitriptilin were toxic and reported as the cause of death. Heart disease was the cause of death in 26 (34.2%) cases. Cause of death could not be determined in 20 (26.3%) cases and in nine of them a decay of the corpse was reported. In addition, causes of death were reported as intoxication in 13 cases, firearm injury in five cases, electric shock in two cases, fall from height in one case, blunt head trauma in three cases, pulmonary emboli due to femur fracture in one case, mechanical asphyxia resulting from hanging in one case, mechanical asphyxia due to drowning in a pool and in the sea in two cases, separation of the head with a sharp instrument in one case and hypovolemic shock after sexual intercourse in one case. Cause of death and distribution of gender are shown (Table 2). The serum levels of ethanol, doxylamine, sertaline, codeine, heroin, morphine, and amytriptilin were found fatally high in 13 (17.1%) cases after chemical examination. Association of cause of death and chemical examination results showed statistically significance (Table 3).
Discussion Death can occasionally occur in hotels during accommodation [8-17]. Hotel fires have resulted in death for many people. Three major hotel fires have occurred in Turkey. A fire in the Hotel Washington in Istanbul has caused 36 deaths and 59 injured in 1983, a fire in Hotel Tozbey, Istanbul has caused 18 deaths and 41 injured in 1993 and an incendiary fire in the Hotel Madimak in Sivas has caused 37 deaths [8,9]. Our cases are not related with these major fires or raised fires due to our database foundation date behind these events. We are not sure how many of these cases were sent for autopsy to our council. However, a national regulation on fire was instituted in our country after these major fires. This regulation aims to assure preventative or protective measures that are needed as a result of a risk assessment and necessary training, organization and inspection in order to safeguard lives and property in the event of a fire in all kinds of buildings, enterprises and constructions owned by institutional, private and real persons [18]. In 34.2% of our cases the First Specialization Board of the Council of Forensic Medicine reported a condition of “existing disease”. This condition is used in cases where results of scene investigations, witness statements and clinical and autopsy findings are missing or confusing and the cause of death is undeterminable or in cases where
Table 3. Cause of death and chemical examination results
Substance Doxylamine Sertaline Laroxil (Amytriptilin) Barbiturate in the urine Ethyl alcohol Codeine Heroin Morphine Naproxen Diclofenac Carboxy- hemoglobin (COHb) Benzodiazepam derivates Total Cause of death Firearms Intoxication Disease Undetermined Drowning Trauma 1 1 3 1 1 1 4 3 3 1 2 1 1 2 1 1 1 13 2 2 8 6 1 2 Total 1 1 4 1 14 1 1 2 1 1 2 2 31(%40.8)
2070
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
other causes of death were excluded. These cases are considered as natural deaths. For example, in persons with an illness like heart disease with the likelihood of sudden death, a record of previous diseases during check-in could help to give information to the health personnel in case of an emergency or in case of a missing person. Medical point of view requires the distinction of trauma or intoxication while regarding the law the distinction of accident, murder and suicide is important in a case of death. This enables an opportunity for judicial bodies. The cause of death was undetermined in 26.5% of our cases. In these cases, where the cause of death could not be linked to a consequence of trauma, intoxication or existing disease, a termination of “undetermined cause and mechanism of death” is reported by our Council. Decay of the corps or indistinct pathology is the reason for this result in most of these cases. Problems in identifying cause of death in our country are mainly due to a lack of standard procedure and deficiencies in practice. The percentage of deaths, which are due to guns, varies greatly in different parts of the world, mainly due to availability of weapons. There is a substantial and growing literature on the epidemiology of firearm related deaths. Many of these directly address the issue of the impact of gun control on death rates [19-24]. The cause of death in 6.6% of the cases was the result of handgun injury and within these cases; four Turkish and two foreign nationalities were recorded. Stricter firearm legislation and control of guns similar to airport security measures or proper storing of firearms at stopover places are required, which might help to reduce unnecessary deaths and injuries related with firearms. The cause of death was the result of electric shock in two cases emphasizing the importance of control on old electricity wirings and replacements in regular periods. An adult case was found dead in the sea after resting on the beach. Besides, a three years old child with foreign nationality accommodating with his grandmother was drowned in the pool. Mothers, fathers or young attendants energetic enough to keep in step with them should supervise children.
Carbon monoxide (CO) poisoning at hotels, motels, and resorts was described [25,26]. The cause of death in 13 (17.1%) of our cases of intoxications was related to medications but carbon monoxide poisoning was not reported. Extraordinary cases such as body-packing as cause of unexpected sudden death may occur everywhere, the circumstances being uncharacteristic. The cases demonstrate, for example, different localities such as a private home, a motorway service area, a hotel room and a backyard [27]. Intoxication due to cocaine was not detected between our cases but body-packing syndrome in one case was reported as the cause of death in Turkey [28]. On July 25, 2000, around 4.30 pm, a Concorde airplane with 109 people on board, 96 of who were of German nationality, crashed onto a hotel situated near the town of Gonesse. The accident resulted in 113 deaths (100 passengers, 9 crew members, and 4 hotel employees) and six were injured [29]. Mass deaths due to airplane accident or fire were not reported as causes of death in our series. As a result, travel health advisers should include advice concerning personal safety abroad and tourist authorities should endeavor to promote and advocate for tourism safety [11]. Hotel entry records should be detailed and information about existing diseases and medications used should be recorded for every tourist at check-in in order to prevent deaths at stopover places. Security precautions similar to the airports at the entrance at stopover places could be suggested considering firearms. Safety measures like periodic control of infrastructure and technical equipment by independent institutions to ensure renewal of old wiring and restoration of aged buildings, in addition to precautions like barricades and lifeguards at the beaches and pools are important. As a result, we believe that in addition to safety measures in parts of the hotels serving for amusement and relaxation, employing experts in their fields and legislative measures ensuring health care service for employees and customers could result in a decrease in injuries and deaths.
Journal of Society for development in new net environment in B&H
2071
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
References
1. Mackenbach JP, Stirbu I, Roskam AJ, Schaap MM, Menvielle G, Leinsalu M, et al. Socioeconomic inequalities in health in 22 European countries. N Engl JMed 2008;358:2468-81. 2. Office of National Statistics. Deaths related to drug poisoning: England and Wales, 1999-2003. Health Stat Q 2005;Spring:52-9. 3. Hwang SW, Wilkins R, Tjepkema M, O'Campo PJ, Dunn JR. Mortality among residents of shelters, rooming houses, and hotels in Canada: 11 year follow-up study. BMJ. 2009 Oct 26;339:b4036. 4. Tsemberis S, Eisenberg RF. Pathways to housing: supported housing for street-dwelling homeless individuals with psychiatric disabilities. Psychiatr Serv 2000;51:487-93. 5. Gross C, Piper TM, Bucciarelli A, Tardiff K, Vlahov D, Galea S. Suicide tourism in Manhattan, New York City, 1990-2004. J Urban Health. 2007 Nov;84(6):755-65. Epub 2007. 6. Breitmeier D, Mansouri F, Albrecht K, Böhm U, Tröger HD, Kleemann WJ. Accidental autoerotic deaths between 1978 and 1997. Institute of Legal Medicine, Medical School Hannover.Forensic Sci Int. 2003 Oct 14;137(1):41-4. 7. Wikipedia encyclopedia; Otel. http://tr.wikipedia. org/wiki/Hotel [Accessed on 3 May 2009] (in Turkish). 8. The portal of history. http://www.tarihportali.net/tarih/20_yy_turkiye_tarihi_kronolojisi-t6877.0.html [Accessed on 3 May 2009] (in Turkish). 9. Interesting development about fire of Tozbey Hotel. http://www.milliyet.com.tr/t/1996/12/05/siyaset/ otel.html [Accessed on 3 May 2009] ] (in Turkish). 10. Eckert WG. The medicolegal and forensic aspects of fires. Am J Forensic Med Pathol. 1981 Dec;2(4):347-57. 11. Leggat PA, Leggat FW. Reported fatal and nonfatal incidents involving tourists in Thailand, July 1997-June 1999. Travel Med Infect Dis. 2003 May;1(2):107-13.
12. Pollak S, Machata G. [Fire at the Viennese hotel "Am Augarten"--a contribution to the toxicology of combustion gas poisoning] [Article in German] Wien Klin Wochenschr. 1987 Jun 26;99(13):454-9. 13. Sribanditmongkol P, Supasingsiripreecha W, Thampitak S, Junkuy A. Fatal heroin intoxication in body packers in northern Thailand during the last decade: two case reports. J Med Assoc Thai. 2006 Jan;89(1):106-10. 14. Levin BC, Rechani PR, Gurman JL, Landron F, Clark HM, Yoklavich MF, Rodriguez JR, Droz L, Mattos de Cabrera F, Kaye S. Analysis of carboxyhemoglobin and cyanide in blood from victims of the Dupont Plaza Hotel fire in Puerto Rico. J Forensic Sci. 1990 Jan;35(1):151-68. 15. Hanzlick R, Masterson K, Walker B. Suicide by jumping from high-rise hotels. Fulton County, Georgia, 1967-1986. Am J Forensic Med Pathol. 1990 Dec;11(4):294-7. 16. Foam was murderous from the fun. http://www. haber5.com/haber.php?haber_id=324642 [Accessed on 3 May 2009] (in Turkish). 17. Live. Hotel operator is flawed in death. http://arsiv.sabah.com.tr/2008/09/12//haber,14E59164F8 3043819FA9AF996BB4C7B3.html [Accessed on 3 May 2009] (in Turkish). 18. Official Journal. Regulations on fire protection in buildings. http://www.imoistanbul.org.tr/yonetmelik/yanginyonetmelik.htm [Accessed on 3 Mayıs 2009] (in Turkish). 19. Romero MP, Wintemute GJ. The epidemiology of firearm suicide in the United States. J Urban Health 2002; 79(1): 39–48. 20. Thomsen JL, Albrektsen SB. An investigation of the pattern of firearms fatalities before and after the introduction of new legislation in Denmark. Med Sci Law 1991; 31(2): 162–166. 21. Elfawal MA, Awad OA. Firearm fatalities in Eastern Saudi Arabia: impact of culture and legislation. Am J Forensic Med Pathol 1997; 18(4): 391–396. 22. Ohsfeldt RL, Morrisey MA. Firearms, firearms injury, and gun control: a critical survey of the literature. Adv Health Econ Health Serv Res 1992; 13: 65–82.
2072
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
23. Boyd JH. The increasing rate of suicide by firearms. N Engl J Med 1983; 308(15): 872–874. 24. Karlsson T, Isaksson B, Ormstad K. Gunshot fatalities in Stockholm, Sweden with special reference to the use of illegal weapons. J Forensic Sci 1993; 38(6): 1409–1421. 25. Weaver LK, MD, Deru K. Carbon Monoxide Poisoning at Motels, Hotels, and Resorts. Am J Prev Med 2007;33(1):23–7. 26. Wharton M, Bistowish JM, Hutcheson RH, Schaffner W. Fatal carbon monoxide poisoning at a motel. JAMA 1989;261:1177–8. 27. A. Heinemann, S. Miyaishi, S. Iwersen, A. Schmoldt, K. Püschel. Body-packing as cause of unexpected sudden death. Forensic Science International 92 (1998) 1 –10. 28. Ozer E, Sam B, Ozdes T, Dokgoz H. Fatal cocaine overdose due to body packers syndrome: A case report. The Bulletin of Legal Medicine, 2005;10(2):62-65 (in Turkish). 29. Weber E, Prieto N, Lebigot F. Care of the families affected by the traumatic deaths due to the Concorde air disaster. Annales Médico Psychologiques 161 (2003) 432–438. Corresponding author Riza Yilmaz, University of Balıkesir, Medical School, Department of Forensic Medicine, Balıkesir, Turkey, E-mail: dr_riza_yilmaz@yahoo.com
Journal of Society for development in new net environment in B&H
2073
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Digital radiography in root canal working length determination
Tatjana Brkanic¹, Ivana Stojsin¹, Karolina Vukoje¹, Duska Blagojevic¹, Vladan Osatovic² ¹ Medicinski fakultet Novi Sad, Klinika za stomatologiju Vojvodine, Srbija, ² Student stomatologije, Medicinski fakultet Novi Sad, Srbija.
Abstract Introduction: The main methods for root canal working length determination are radiographic and electrometric. The digital radiography obtained through intrabuccal sensors represents technological progress that allows quantitative analysis and measurement of working length. Aim: The aim of this study was to investigate the difference in values of the accurate root canal working length and the working length determined by digital radiography and to test if the digital radiography is a reliable method for working length determination. Materials and methods: Nineteen extracted human teeth without endodontic treatment and with well preserved coronal and radicular structures were selected - 11 lower incisors and 8 lower canines. Teeth length (TL1) was measured by a millimeter ruler. Coronal access to the teeth was obtained with a round bur and high speed handpiece. The actual working length (WL1) was obtained by introducing a #15 K file in the canal until it appeared at the apical foramen. The length was verified on endometer. The digital images were obtained for every tooth sample. The canal working length (WL2) and the length of the tooth (TL2) were measured in the Kodak dental imaging software. Mean value and standard deviation were calculated and statistical analysis was performed by student t-test. Results: Average working length in lower incisors was 21,68 mm, and average working length in lower canines 21,93 mm. Statistical analysis has shown no statistical difference between the accurate root canal working length and the working length obtained by digital radiography. It was 2074
also found that there is no statistical difference between the tooth length and working length measured by digital radiography (p>0,05). Conclusion: There is no significant difference between the accurate root canal working length and the working length measured by digital radiography. Digital radiography is a reliable method for working length determination. Key words: Working length, digital radiography, tooth length Introduction The establishing of accurate root canal working length is one of the most critical steps of endodontic therapy. Cleaning, shaping and obturation of the root canal system cannot be accomplished accurately unless the working length is determined precisely. The generally accepted methods of working length determination are radiographic and electrometric [1,2]. In endodontics, conventional film-based radiography is an important resource for diagnosis, transoperative procedures and treatment control [3]. However, diagnostic X rays are the largest man made source of radiation exposure to the general population [4]. The digital radiography obtained through intrabuccal sensors rather than radiographic films represents technological progress that allows qualitative and quantitative analysis of all stages of endodontic therapy. Regarding radiographic estimation of endodontic working length, direct digital imaging provides measurement tools that facilitate the definition of the apical limit of root canal instrumentation. Moreover, there is substantial reduction in image processing time with the acquisition of digital radiography. Hence, the
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
clinical procedures are performed more quickly, with reduced radiation. Further, in digital radiography, the application of various image enhancement modalities improves the accuracy of endodontic file lengths. The software program provides a sequence of straight lines for evaluation of root canal working length [5]. The aim of this study was to investigate the difference in values of accurate root canal working lengths and working lengths determined by digital radiography. Materials and methods Nineteen extracted single rooted human teeth, without endodontic treatment and with well preserved coronal and radicular structures, were selected - 11 lower incisors and 8 lower canines. The criteria for tooth selection also included the accessibility of the apical foramen with a #0.08 K file (Dentsply-Maillefer, Ballaigues, Switzerland). The teeth have been cleaned after extraction and stored until used in saline solution under the temperature of 4ºC. Tooth length (TL1) was measured by a millimeter ruler. Access openings were made with a high speed handpiece and a round diamond bur (Figure 1). An endodontic K file #0.15 was introduced into the canal until it appeared at the apex (Figure 2).
Figure 2. Establishing the initial patency of the canal Working length was determined (WL1, accurate working length) for each tooth using hand K file # 0.15 and the endometer. The file was introduced into the canal to a depth until the tip of the instrument appeared in the region of the apical foramen and the rubber stopper of the file has been brought into contact with the coronal reference point (incisal edge of the tooth). The length of the file for each canal was checked using an endometer. In this way the accurate working length (WL1) was measured (Figure 3).
Figure 1. Access cavity preparation Figure 3. Accurate working length measurement
Journal of Society for development in new net environment in B&H
2075
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
An endodontic file #15 was introduced in the canal until it appeared at the apex and at this point digital radiography was taken. File was placed in the root canal in the same position as in determining the WL1. Kodak RVG 5100 digital radiography sensor of universal size, Kodak X-ray generator (the generator voltage 70 kVp and 7 mA current strength) and the remote control to activate the software and sensors were used. Dental imaging was performed by placing the tooth with a file in the canal, along the active (radio-sensitive) sensor surface (Figure 4). Generator as a source of X-ray was set at a distance of 20 cm in relation to the object (tooth). Exposure time was set to 0.05 seconds.
Figure 5. Digital image with file in the canal
Figure 4. Digital recording with the file in the canal In this way 19 rendgenographic digital images were obtained (Figure 5). These images were stored and processed in Kodak dental imaging software. In this program radiographic working length (WL2) and the tooth length (TL2) were measured. Radiographic working length was measured using a millimeter ruler (Figure 6). Two points were marked, one on the rubber stopper and the other on the top of the file. Tooth length was also measured with a millimeter ruler from the most coronal point till the most apical point of the tooth (Figure 7). 2076
Figure 6. Radiographic working length measurment Mean value and standard deviation were calculated for WL1, WL2, TL1 and TL2. The difference between WL1 and WL2 and the difference between the WL1 and TL1 were tested with the
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
student t- test. Statistical significance was set at the 5% level of error (p<0.05).
Figure 8. Percentage of morphological groups of teeth
Figure 7. Radiographic tooth length measurement Results The mean values of the accurate tooth length (TL1), Rtg tooth length (TL2), the real working length (WL1) and the working length measured by digital radiography (WL2) are shown on table 1. Percentage of the morphological groups of teeth was: incisors 58% and canines 42% (Figure 8). The mean value of the real working length (WL1) was 21.68 mm and mean radiographic working length (WL2) was 22.33 mm, for the incisors (Figure 9). The mean value of the real working length (WL1) was 21.93 mm and the mean radiographic working length (WL2) was 22.56 mm, for the canines (Figure 10).
Figure 9. Mean working length (WL1) and radiographic working length (WL2) in incisors
Figure 10. Mean working length (WL1) and radiographic working length (WL2) in canines
Table 1. Mean working lengths and tooth lengths for incisors and canines
Tooth type Incisors Canines WL1 21,68 (±0,72) 21.93 (±1,65) WL2 22,33 (±0,60) 22,56 (±1,86) TL1 22,00 (±0,52) 22,25 (±1,73) TL2 (±0,59) (±1,85)
*values are in millimeters
Journal of Society for development in new net environment in B&H
2077
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Mean tooth length (TL1) of the lower incisors was 22 mm and mean tooth length of the lower canines was 22.25 mm (Figure 11 and 12).
Figure 11. Mean working length (WL1) and tooth length (TL1) for incisors
Figure 12. Mean working length (WL1) and tooth length (TL1) for canines Statistical analysis has shown no significant difference between the accurate working length of teeth and the value of working length measured by digital radiography (WL1 and WL2). It was also found that there was no significant difference between the values obtained for the length of teeth and the working length measured by digital radiography (p> 0.05). Discussion Determination of working length represents one of the key stages of endodontic therapy in order to provide high quality preparation and obturation of the canal, creating the preconditions for the successful outcome of the entire therapy. In order 2078
to assess the approximate working length at the beginning of therapy, it is helpful to have information about the average length of the teeth that belongs to the corresponding morphological group. The accurate determination of working length is made by radiographic or electrometric method after canal trepanation. Tests have shown that the length of the tooth does not have to coincide with the length of the canal and the working length for the root canal preparation, for a variety of anatomical variations or root canal curvatures [6]. One of the aims of this investigation was checking the correspondence between the average teeth length measured on the x-ray dental digital photography and working length of teeth. The results confirmed that there was no significant difference between the tested values. These matching values were obtained probably because of the choice of morphological groups and types of teeth used in this study. It is considered that single rooted anterior teeth, such as lower incisors and canines which are used in this study, have less complicated canal anatomy in relation to the posterior multi rooted teeth [7]. Therefore it would be good to extend the research to other morphological groups of teeth, especially molars, where larger deviations of tested values could be expected. The literature states that the average length of lower incisors is 21.7 mm, and the average length of lower canine 25.6 mm [8]. In this survey an average length of the lower incisors was 22 mm and 22.25 mm of lower canines. The difference in the literature data concerning the length of the canines, can be attributed to the limited number of samples used in this study, so it would be desirable to test the results on a larger sample. It is believed that radiography represents a very reliable method for determining the working length, but still during the recording process, an image distortion could happen to some extent, and thus a discrepancy between the values of canal length measured on digital photography, and the real value of the length of the root canal. According to some studies, radiographic method is unreliable for the working length determination due to image distortion, and because of overlapping of anatomical structures, film radio contrast and subjective interpretation of the clinician [9,10,11].
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
In this study, slightly higher values for radiographic working length were obtained, comparing to the accurate working length of root canals. The difference between these values is in the domain of 0 to 1.2 mm, but is not statistically significant. It is possible that such results were obtained because the testing was done in vitro on extracted teeth where it was possible to provide optimal conditions for the x ray recording, in terms of distance between the object from the tube. On the other hand, in vivo conditions, there is a danger of patient's moving at the time of exposure and the possibility of superimposition of other anatomical details that may affect the deviation between measured and real values. Some studies show that the value of working length obtained by conventional and digital radiography is higher than the real working length of root canal [5]. In other studies it is stated that digital radiography is better compared to conventional, in cases where the working length was measured with instruments of a larger diameter [12,13], and when measured in single rooted teeth [14,15]. On the other hand, some studies have shown the superiority of conventional radiography compared to digital, where instruments with smaller diameters have been used [16]. A detailed comparison of these results is very difficult due to the use of various digital systems in each study. Conclusion According to the results of this study, it can be concluded that there is no statistically significant difference (p<0,05) between the accurate working length of root canal and working length measured by digital radiography. Digital x-ray imaging is a reliable method for determining the working length of root canals.
References
1. Torabinejad M, Walton RE. Endodoncija, načela i praksa, Naklada slap za izdanje na hrvatskom jeziku, Zagreb 2009;252-256. 2. Galić N, Katunarić M, Šegovic S, Šutalo J, Stare Z, Anic I. Procjena kliničke pouzdanosti Endometer ES02 uredjaja, Acta Stomatol Croat 2002; 36:489-495. 3. Bakhtiari B, Mortsazavi H, Hajilooi M, Nayari S. Serum Interleukin 6 as a Serologic Marker of Chronic Periapical Lesions. A Case control study, HealthMED, 2010; 4(3): 586-590 4. Dedić S, Pranjić N: Lung cancer risk from exposure to diagnostic x rays, HealthMED, 2009; 3(3): 307-313 5. Brito-Junior M, Santos L, Baleeiro E, Pego M, Eleuterio N, Camilo C. Linear measurementes to determine working length of curved canals with fine filed: conventional versus digital radiography, Journal of oral science 2009; 51:559-564. 6. Brkanić T, Stojšin I, Vukoje K, Živković S: SEM analiza kvaliteta čišćenja zidova kanala korena zuba nakon primene nikl titanijumskih instrumenata, Srpski arhiv za celokupno lekarstvo, 2009; 138 (9-10):551-556 7. Brkanić T, Živković S, Drobac M: Tehnika preparacije kanala korena nikl-titanijumskim rotirajućim instrumentima, Med Preg, 2005; 58: 203-207. 8. Tronstad L, Klinička endodoncija, Data status Beograd 2007; 209-210. 9. Frank AL, Torabinejad M. An in vivo evalation of Endex electronic apex locator. J Endodon 1993; 19:177-9. 10. Becker GJ, Lankelma P, Wesselink PR, Thoden Van Velzen SK. Electronic determination of root canal length. J Endodon 1980; 6:876-80. 11. Griffits BM, Brown JE, Hyatt AT, Linney AD. Comparison of three imaging techniqus for assessing endodontic working length. Int End J 1992; 25:279-87. 12. Vale I, Bramante CM. Assess lengths of endodontic files from Digora digital system and three periapical radiographic images films.Rev FOB 2002; 10:29-23. 13. Lozano A, Forner L, Liena C. In vitro comparison of root-canal measurements with conventional and digital radiology, Int Endod J 2002; 35:542-550.
Journal of Society for development in new net environment in B&H
2079
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
14. Pace SRB, Habitante SM. Comparative analysis of the visualization of small files using digital and convetional radiography. J Appl Oral Sci 2005; 13:20-23. 15. Boskolo FN, de Oliveira AEF, de Almeida SM, Haiter CFS, Haiter Neto F. Clinical comparative study of the quality of three digital radiographic syistems, E-speed film and digitized film. Pesq Odont Bras 2001; 15:327-333. 16. Lamus F, Katz JO, Glaros AG. Evaluation of a digital measurement tool to estimate working length in endodontics, J Contemo Dent Pract 2001; 2:24-30. Corresponding author Tatjana Brkanic, Medicinski fakultet Novi Sad, Klinika za stomatologiju Vojvodine, Srbija E-mail: healthmedjournal@gmail.com
2080
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Quality Of Life Of Patients With Tuberculosis
Mehtap Tan, Hatice Polat Department of Nursing, Faculty of Health Sciences, Atatürk University, Erzurum, Turkey.
Abstract Setting: This study was conducted at the Erzurum Nihat Kitapçı State Hospital and Aziziye Research Hospital of Atatürk University. Objective: This study was conducted to determine the status of life quality of the patients with tuberculosis and the factors influencing it. Design: The data was collected by interviews with tuberculosis patients using an inventory of quality of life and patient information form. Results: It was found that age, gender, educational status, monthly income and occupation of the patients had an impact on the quality of life (p<0.05). It was also found that the status of the disease, familiar, neighborhood and friendship relations after onset of the disease influenced the quality of (p<0.05). Conclusion: To increase the quality of life of the patients with tuberculosis, the patients need to be informed about the disease, the importance of completing the whole therapeutic course, and accepting the disease; and they need to be cared and treated by the health professionals specialized in that area during and after treatment period. Key words: Quality of life, tuberculosis, nursing. Introduction Tuberculosis is still an important health problem worldwide and in our country. According to the World Health Organization (WHO) report on global tuberculosis published in 2008, the number of new tuberculosis cases expected in 2006 is 9,2 million (139/100 000); estimated case prevalence is 14,4 million; estimated number of multi-drugresistant tuberculosis cases is 0,5 million.1 In our country, according to the report published by Di-
rectorate of Struggle Against Tuberculosis in 2007, 20 535 patients were diagnosed with tuberculosis in 2005 and 91.3% of them were new cases. The rate of pulmonary tuberculosis is 73%.2 The tuberculosis incidence was found to be 17,60 per 100 000 population in the Eastern Anatolian region.3 Tuberculosis is a common and social disease. These two situations may direct the tuberculosis disease towards a process that cannot be expressed easily and makes the person be isolated from social relationships when it is recognized.4-6 Treatment requires prolonged therapy (at least 6 months) with potentially toxic drugs that can lead to adverse reactions in a significant number of patients. Also, among foreign-born patients, there is considerable social stigma associated with active TB, leaving the individual feeling shunned and isolated from their friends and families. Diagnosis of TB also leads to depression and anxiety. Finally, among Aboriginal and marginalized inner-city populations, there is a lack of knowledge regarding the disease process and its treatment, which may contribute to feelings of helplessness and anxiety.7 In general, studies of TB have focused on outcomes such as mortality and biologic markers of cure. However, there has been increasing interest in the patient’s perspective of disease, health, and medical care; and quality of life (QOL) is recognized as a key outcome.8 Clinically, the burden of TB extends beyond its acute presentation. However, there has been little attention given to the burden of the illness and treatment or to quality of life (QOL) of people with TB.8 According to the definition established by the World Health Organization, the “quality of life” is the individual’s perception of where he/she stands in the life with the cultural and moral system under which he/she lives relating to the individual’s purposes, prospects, standards and interests. According 2081
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
to the new philosophy of health care, to increase the quality of life of the patients, nurses should consider the quality of life under holistic (wholeness) approach basing on the mutual respect and collaboration. The studies performed by nurses using the quality of life scales intend to obtain information about the health status of large groups and to implement the results to establish healthcare policies. In the literature, as a result of the studies with different scales and methodological implementations, it was proved that the quality of life of the patients with tuberculosis decreased to various degrees, namely, tuberculosis negatively affected the quality of life.7,9-13 In our country, there were few studies about the quality of life of the patients with tuberculosis.3,9,14 One of the goals of healthcare professionals is to help the individual until he or she will be able again to take care of himself/herself as soon as possible, to make the individual meet his/her own needs and to maximize the quality of life of the individual throughout these processes. This study was performed to determine the status of the quality of life of TB patients and the factors having an impact on which. Materials and methods This descriptive study was performed to determine the quality of life and related factors of patients with TB patients. This study was conducted at the Erzurum Nihat Kitapçı State Hospital and Aziziye Research Hospital of Atatürk University in the period between 5th of May and July 2009. These hospitals are the largest hospitals located in the Eastern Anatolian region. Patients hospitalized for at least 1 month were included in the study to be able to evaluate negative effects of the illness process. Patients who had known respiratory co-morbidity other than TB or any known and diagnosed chronic illness, which may affect QOL were excluded from the study. The study was completed with 79 TB patients who were older than 18 years old, were able to comprehend the questions and agreed to participate in the study. Data were obtained by interviewing with the patients face to face, by researchers. Each interview lasted 10–15 minutes, on the average. 2082
Data were collected using two instruments: a QOL instrument and patient identifiers form. QOL instrument: QOL, developed by Greenley and Greenberg15 in 1994. The validity and reliability of this inventory for Turkish populations were studied by Şimşek16. This is a Likert type self-administered scale with 24 items including ‘living situation’, ‘finances’, ‘leisure’, ‘family relations’, ‘social life’, ‘health’ and ‘access to health care’. Respondents are asked to indicate which item describes how they have been thinking for the past 6 months. Responses are scored 1–5, with 5 the most optimistic response. Scores can range from 24 to 120, where higher scores indicate higher QOL levels. It has good internal consistency and test–retest reliability, and concurrent validity has been established. Cronbach alpha coefficient was found to be .75 for this study. Patient Identifiers Form: 1) social and demographic characteristics such as age sex, marital status, educational level, family income; 2) changes in social milieu after the illness, such as relations with neighbors, relations with friends, spirituality and working conditions; and 3) the illness (the status of relapsed or new onset). Before the start of the study, approval was obtained from the hospital’s institutional review board. All study participants gave informed consent. Data Analysis: The data were analyzed using the SPSS statistical package, version 11.5. Descriptive statistics included percentages, standard deviations and means. To assess descriptive features of the patients, percentage distributions and medians were used; medians were used to determine the scale points; to assess the status of being influenced of the scale points by certain variables, parametric (t test) and nonparametric (Kruskall Wallis and Mann Whitney U) tests were used; to evaluate the correlation, Pearson’s correlation test was used; and to determine the internal consistency of the scale items, Cronbach alpha coefficient was calculated.17 Results Table 1 shows the means of the quality of life points by descriptive features of the patients. The mean age of the patients was 35.29±15.81 years.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
It was found that of the patients, 53% were women, 53% were graduated from primary school, 55% were married, 67% had poor monthly income, 83% had health insurance. Table 1. Characteristics of Patients
Variables Age 18- 27 28- 37 38- 47 > 48 Sex Female Male Education Primary school High school University Marital status Single Married Satisfaction from income Yes No Occupation Freelance Retired Homemaker Working Health insurance Yes No Place of residence Village City Duration of disease New case Relepsa case Sample (% ) 35 (44) 9 (11) 10 (13) 25 (32) 42 (53.2) 37 (46.8) 42 (53) 31 (39) 6 (8) 35 (44.3) 44 (55.7) 26 (32.9) 53 (67.1) 22 (27.8) 12 (15.2) 29 (36.7) 16 (20.3) 66 (83.5) 13 (16.5) 42 (53.2) 37 (46.8) 83.5 (66) 16.5 (13)
in neighborhood-friendship relations (75.9% of the patients), in religious beliefs (79.7% of the patients), in relations with the spouse (82.3% of the patients), in workplace relations (75.9% of the patients). The difference between the quality of life and familiar relations, neighborhood-friendship relations after the disease onset was found to be statistically significant (p<0.05 and p<0.05, respectively). The difference between the quality of life and the status of religious beliefs, relations with the spouse, changes in working life seen after the disease onset was found to be statistically insignificant (p>0.05). Discussion As a result of the study, the mean quality of life point was found to be 85.58±13.53. As a consequence, we can say that the quality of life of the patients ranked at moderate level. As a result of the studies in the literature which were performed using different scales and methodological implementations, it was proved that the quality of life of the patients with tuberculosis decreased to various levels and the disease of tuberculosis negatively influenced the quality of life of the individuals in physical, emotional and social aspects.7,10,19 In many other studies, it was reported that tuberculosis had an impact on general wellbeing, body perception, mental health, physical and social role functions, all other quality of life aspects, and moreover, led to further problems such as social labeling, solitude, troubles resulted from drug use, prolonged therapy, sexual malfunctions, loss of income, and fears.7,10 It was found a highly significant relationship between the ages of the patients and the quality of life. In this study, it was found that the mean scores of the quality of life of the patients increased as the age became advanced. This result correlates with Taşkın,3 Campbell et al.18 but not with Duyan.13 We can recommend further studies with larger patient populations to elicit this matter. Comparison of the means of QOL points by gender revealed that the mean QOL points of female patients were higher than that of men. The results of the study performed by Taşkın et al.3 correlate with the present study, however, Ünalan 2083
Given the association between the quality of life and age, gender, educational status, marital status, occupation and monthly income of the patients, it was found that the difference between them was statistically significant (p<0.01). When the relationship between the quality of life and the living area, social insurance was evaluated, the difference was found to be statistically insignificant (p>0.05). It was found that 83.5% of the patients were new cases and after the disease onset, there were no changes in familiar relations (74.7% of the patients),
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 2. Relationship between socio-demographic characteristics and quality of life
Age 18- 27 28- 37 38- 47 > 48 Sex Female Male Education Primary school High school University Marital status Single Married Satisfaction from income Yes No Occupation Freelance Retired Homemaker Working Health insurance Yes No Place of residence Village City Variables Mean ± SD 81.89± 13.28 80.78±9.98 86.80±14.73 92.0±12.57 89.31±13.24 81.35±12.74 85.02±12.11 82.32±13.22 106.33±4.23 82.43±14.25 88.09±12.52 92.81±15.71 82.04±10.81 81.18±13.30 97.42±10.80 86.86±11.17 80.44±14.63 86.83±16.24 79.23±16.08 84.24±11.68 87.11±15.38 Statistics KW: 9.177 p< 0.01
t: -2.714
p<0.01
KW: 13.852
p<0.01
t: -1.878
p<0.01
MWU: 335.500 p<0.01
KW: 14.214
p<0.01
MWU: 286.500 t: -.940
p>0.05 p>0.05
Table 3. Changes that occurred within the family environment and social environment after the illness and effects on quality of life
Variables Family relations Weakened No change Strengthened Relations with neighbours and friends Weakened No change Strengthened Belief system No change Strengthened Sexual relations Weakened No change Strengthened Relations within the work environment Weakened No change n (%) Mean ± SD 77.33±4.03 84.17±13.05 95.07±13.96 73.71±8.56 85.50±11.62 92.92±19.61 86.02±12.40 83.40±18.18 81.33±12.55 86.17±12.91 79.40±13.84 85.53±17.62 85.60±12.13 Statistics KW: 8.950 p<0.05
6 (7.6) 60 (74.7) 14 (17.7) 7 (8.9) 60 (75.9) 12 (15.2) 64 (81) 15 (19) 9 (11.4) 65 (82.3) 5 (6.3) 24.1 (19) 75.9 (60)
KW: 8.526
p<0.05
MWU: 414.0
p>0.05
KW: 3.390
p>0.05
MWU: 562.0
p>0.05
2084
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
et al.20 found lower scores of quality of life in women. Duyan et al.13 in a study, did not found any relationship between gender and the quality of life. Women and men have different roles in family and society. Loss of role resulted from the disease and affection process differ by gender. That is an important factor influencing the quality of life. It was thought that high quality of life of female patients in this study was resulted from the fact that most of women included in the study were housewives and assumed less social roles than men did. Furthermore, we can recommend performing studies about the clarification of the relationship between gender and quality of life. The mean quality of life points of the patients graduated from academy was found to be high. This result is in accordance with the results of the studies performed by Duyan et al.,13 Taşkın et al.3 and Ünalan et al.20 The individual becomes less affected by external factors as the level of education gets higher, and consequently his/her quality of life becomes higher.3,21 It can be argued that this result may be related to the fact that the patients with higher education level use proper methods of coping. Although the mean point of quality of life of married patients was higher than that of single patients, the difference was found to be statistically insignificant. Duyan et al.13 found the mean point of quality of life of single patients to be higher. It can be thought that the result obtained from this study may be related to better social support provided for married patients. The mean point of quality of life of the patients having proper monthly income was found to be higher than that of other group and the difference was found to be statistically significant. This result is consistent with the results of the studies performed by Duyan et al.13, Taşkın et al., 3 Zautra et al. 22 and Lehman et al.23 It is thought that the facts that the patients feel good, cope better with the problems resulted from the disease and are able to maximize their life standards with the increased income influence the results in that manner. As a result of the study, the mean point of quality of life of unemployed patients was lower than that of other groups, the difference between the groups was found to be statistically significant. Working in a job remarkably contributes to overcome the financial loss resulted from the disease and treatment,
to establish again self-esteem of the individual, to make the life more satisfying and meaningful providing social support.24 Poverty is very important for the widespread occurrence of tuberculosis. It has been reported that as long as poverty remains, the widespread dissemination of tuberculosis cannot be prevented, and therefore life standard and quality of life are entirely influenced.25 The relationship between social insurance and quality of life of the patients was found to be statistically insignificant. The results of this study were found to be consistent with the results of the study performed by Taşkın et al.3 The fact that healthcare institutions cover the cost of the treatment of tuberculosis patients might have impressed the results in that manner. Although the patients living in urban areas had higher average points of QOL, the difference between the groups was found to be statistically insignificant. The result achieved by this study was found to be consistent with the results of the previous study.3 It can be thought that the fact that the patients living in urban centers reach easily to healthcare institutions may have an impact on the results. The average points of quality of life of new cases were found to be higher than that of relapsed patients. This result was consistent with the study conducted by Duyan et al.13 It can be thought that disease recurrences lead to despair in the patients, and consequently influence the results in this way. The average points of quality of life of the patients whose family relations were disrupted after the onset of the disease were lower than that of the patients defining that their relations were not changed or became stronger; the difference was found to be statistically significant. The result of this study was consistent with the results of previously performed studies.3,13 We can say that there is a favorable correlation between the support of family members and quality of life. The average points of quality of life of the patients indicating a decrease in neighborhood and friendship relations were found to be lower. Chronic diseases like tuberculosis negatively influence the status of physical health of the patients as well as social, psychological and economic well-being.12 The result of the study was found to be similar to the previously performed study.13 2085
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Of the patients, 15% defined that their religious beliefs became stronger after the disease. Taşkın et al.3, in a study previously performed, reported that religious beliefs became stronger in 23.3% of the patients. Hansel et al.10 reported that religion and spiritualism played an important role for the approach of tuberculosis patients to the disease and having tuberculosis disease remarkably increased their level of spiritualism. Although the difference between the average points of quality of life of the patients by the changes seen in sexual relations with the spouse after the disease onset was found to be statistically insignificant, average point of quality of life of the patients having troubles in their sexual lives was found to be lower. Taşkın et al.,3 Duyan et al.13 found that the patients experienced a decrease in the frequency of sexual relationship after the disease had lower points of quality of life as well. The average points of QOL of the patients defining that their working life relations became stronger were found to be higher. Taşkın et al.,3 Duyan et al.13 reported that the patients having a decrease in the working relations after the disease onset had lower points of quality of life. Conclusions In the light of the results obtained from the study, to increase the quality of life of the patients with pulmonary tuberculosis, we think that it is necessary to provide information to the patients about the disease, the importance of completing the whole course of the treatment and complying with the disease; to ensure the patients to be cared and treated by healthcare professionals specialized in this area; to offer proper information and support to the patients and their families; to make all healthcare professionals be aware of the factors influencing the quality of life.
References
1. Global tuberculosis control: surveillance, planning, financing. WHO report 2008. Geneva. World Health Organization (WHO/HTM/TB/2008.393). 2. Gümüşlü F, Özkara S, Özkan S, et al. Türkiye’de Verem Savaşı, 2007 Raporu. T.C. Sağlık Bakanlığı Verem Savaşı Daire Başkanlığı, Ankara, 2007. 3. Taşkın F, Olgun N. Akciğer Tüberkülozlu Hastalarda Yaşam Kalitesi. Türk Toraks Dergisi 2010; 11: 19-25. 4. Arıkan Z, Kuruoğlu A, Beler N, et al. Tüberküloz olgularında hastalığın algılanması ve kişilik özellikleri. Kriz Dergisi 2000; 8: 39-45. 5. Ünalan D, Baştürk M, Soyuer F, Ceyhan O, Öztürk A. Determining of the Effects of Depression on Quality of Life in Patients with Tuberculosis in Active, Inactive and Control Groups. Klinik Psikiyatri 2007; 10: 113-124. 6. Marra CA, Marra F, Colley L, Moadebi S, Elwood RK, Fitzgerald JM. Health-Related Quality of Life Trajectories Among Adults With Tuberculosis. Chest 2008; 133: 396-403. 7. Marra CA, Marra F, Cox VC, et al. Factors influencing quality of life in patients with active tuberculosis. Health Qual Life Outcomes 2004; 2: 58-10. 8. Betty C, Wu AW, Hansel NN, Diette GB. Quality of life in tuberculosis: A review of the English language literature. Qual Life Res 2004; 13: 1633–1642. 9. Ünalan D, Baştürk M, Soyuer F, Ceyhan O, Öztürk A. Tüberkülozlu hastalarda depresyonun yaşam kalitesi üzerine etkisinin aktif, inaktif ve kontrol gruplarında belirlenmesi. Klinik Psikiyatri 2007; 10: 113-124. 10. Hansel NN, Wu AW, Chang B, Diette GB. Quality of life in tuberculosis: Patient and provider perspectives. Qual Life Res 2004; 13: 639–652. 11. Tocque K, Bellis MA, Beeching NJ, et al. A case-control study of lifestyle risk factors associated with tuberculosis in Liverpool, North- West England. Eur Respir J 2001; 18: 959-964. 12. Rajeswari R, Muniyandi M, Balasubramanian R, et al. Perceptions of tuberculosis patients about their physical, mental and social well-being: a field report from south India. Soc Sci Med 2005; 60: 1845-1853.
2086
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
13. Chang B, Wu A, Hansel HN, Diette GB. Quality of life in tuberculosis: A review of the English Language Literature. Qual Life Res. 2004; 13: 1633-42. 14. Duyan V, Kurt B, Aktaş Z, Duyan GC, Kulkul DO. Relationship between quality of life and characteristics of patients hospitalised with tuberculosis. Int J Tuberc Lung Dis 2005; 9: 1361–1366. 15. Greenley J R, Greenberg J S, Brown R. Measuring quality of life: a new and practical survey instrument. Social Work 1997; 42: 244–254. 16. Simsek Z. Yaşam kalitesi ölçeğinin psikometrik değerlendirmesi Toplum ve Sosyal Hizmet 2001; 12: 3–30. 17. Sümbüloğlu K, Sümbüloğlu V. Biyoistatistik Kitabı. 7. Baskı. Ankara: Şahin Matbaası, 1997. 18. Campbell A, Converse P E, Rogers, W L. The quality of American life. New York, NY: Russell Sage Foundation, 1976. 19. Muniyandi M, Rajeswari R, Balasubramanian R, et al. Evaluation of post-treatment health-related quality of life (HRQoL) among tuberculosis patients. Int J Tuberc Lung Dıs 2007; 11:887–892. 20. Ünalan D, Baştürk M, Soyuer F, Ceyhan O, Öztürk A. Aktif ve inaktif tüberküloz olgularında yaşam kalitesi ve durumluluk kaygı düzeyleri ile ilişkisi. Anadolu Psikiyatri Dergisi 2008; 9: 22-30. 21. Meeks S, Murrel SA. Contribution of Education to Health and Life Satisfaction in Older Adults Mediated by Negative Affect. J Aging Health, 2001; 13: 92-119. 22. Zautra A, Beier E, Cappel L. The dimensions of life quality in a community. Am J Community Psychol 1977; 5: 85-97. 23. Lehman A F, Possidente S, Hawker F. The quality of life of chronic patients in a state hospital and community residences. Hosp Community Psychiatry 1986; 37: 901-907. 24. Özbay B, Gencer M, Gülsün A, et al. Tüberkülozlu olgularda sosyokültürel yapı. Tüberküloz ve Toraks 2001; 49: 246-51. 25. Waaler HT. Tuberculosis and poverty. Int J Tuberc Lung Dis 2002; 6: 745-6.
Corresponding author Mehtap Tan, Department of Nursing, Faculty of Health Sciences, Atatürk University, Erzurum, Turkey, E-mail: mtan@atauni.edu.tr
Journal of Society for development in new net environment in B&H
2087
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Association between bacterial Vaginosis and precancerous changes of the Cervix
Milena Misic1, Gordana Ranđelovic2, Branislava Kocic2, Ljiljana Suvajdzic3, Sadeta Hamzic4, Sukrija Zvizdic4, Marko Tomic5
1 2 3 4
5
Center for Microbiology, Department of Public Health Vranje, Vranje, Serbia, Institute of Public Health Nis, Center for Microbiology, University of Nis, Medical Faculty, Nis, Serbia, Department of Farmacy, Medical faculty University of Novi Sad, Novi Sad, Serbia, Department of Microbiology and Parasitology, Medical Faculty University of Sarajevo, Sarajevo, Bosnia and Herzegovina, Medical faculty University of Novi Sad, Novi Sad, Serbia.
Abstract Introduction: The majority of studies published so far on bacterial vaginosis (BV) have not been consistent in associating BV and cervical dysplasia. The aim of this study was to determine the correlation between BV and cervical intraepithelial neoplasia (CIN), and between BV and degree of severity of these changes on the uterine cervix. Materials and Methods: The study included sexually active women who were referred by gynecologists to colposcopic examination. Based on histopathological results, the examinees were divided into three groups: 41 women with confirmed CIN changes; 30 women without precancerous and cancerous changes in the cervix and 29 women with histopathologically confirmed invasive cervical cancer. Microbiological testing of samples from the genital tract included direct microscopic smears, wet and stained, and inoculation of culture medium, testing for Chlamydia trachomatis and genital mycoplasmas. Results: BV was present among 18 (43.9%) women with cervical intraepithelial neoplasia and 13 (44.8%) women with invasive cancer, which in both cases meant statistically significantly higher frequency compared to women without precancerous and cancerous cervical changes, who had confirmed bacterial vaginosis in 3 (10.0%) cases (p = 0.003). The risk of finding the precancerous changes on the cervix was 8.36 (1.89 to 37.04) 2088
times higher in patients with BV than in women without that infection. Conclusion: BV was significantly more common in women with the finding of precancerous changes in the cervix, and was not associated with severity of histopathological changes in the cervix. Key words: Bacterial vaginosis; Precancerous changes; Cervical intraepithelial neoplasia Introduction Bacterial vaginosis (BV) is a non-inflammatory, infectious syndrome described in the vaginal pathology. Clinically, it is polymicrobial, primarily anaerobic infection with subacute course, which is followed by homogenous secretions adherent to vagina, odor and poor leukorrhea. Dysuria may be present and external vaginal itching or redness may be seen. Many women with bacterial vaginosis do not have any signs or symptoms [1]. Microbiologically, BV is defined as a disruption in the balance of bacterial morphotypes, overgrowth of a large number of anaerobic and microaerophilic bacteria, Gram-positive cocci, Mycoplasma spp. and reduction in the number of Lactobacillus spp. In women with BV, lactobacilli are absent or severely reduced, while concentrations of other bacteria are generally increased 100to 10000-fold over normal levels [2-6].
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The human papillomavirus (HPV) is the major etiologic agent in the development of cervical cancer, while BV and other genital infections are considered to increase the risk of cervical cancer [7-9]. The majority of infected women are found to heal spontaneously with no ill effects, probably due to a competent immune response. However, if woman develops persistent infection, the cervix is prone to the transformation of cells and development of precancerous changes [10]. The majority of studies published so far on bacterial vaginosis (BV) have not been consistent in associating BV and cervical dysplasia. Marrazzo et al., as well as many other researchers, found that BV causes inflammatory changes of the cervix and that chronic inflammation of the cervix with BV may be considered as one of the mechanisms for the development of malignant changes in the cervix [11-14]. Co-factors that are also associated with an increased risk of cervical intraepithelial neoplasia (CIN) and cervical cancer are smoking, poor nutritional status, hormonal factors (age of women at first childbirth), use of hormonal contraception, having sex at an early age (less than 16 years) and a large number of sexual partners, race, multiple births, low socioeconomic status. Older women have increased risk of CIN and cervical cancer, as well as women with sexually transmitted infection (STI), such as infection with bacteria Chlamydia trachomatis (C.trachomatis) and protozoa Trichomonas vaginalis (T.vaginalis) [7, 15, 16]. The aim of this study was to determine the correlation between BV and CIN, and between BV and degree of severity of these changes on the uterine cervix. Materials and Methods: The study enrolled sexually active women who were primarily examined by gynecologists and then referred to colposcopic examination from May 2005 to January 2007 for a biopsy and further histopathological examination. Ethical approval was obtained from the local ethics committee. Written, informed consent was taken from the patients for participation in the study. Based on histopathological results (results of biopsy), the participants were divided into three groups:
- The target group: 41 women with histologically confirmed CIN 1, CIN 2 and CIN 3. - The negative control group: 30 women without precancerous and cancerous cervical changes. - The positive control group: 29 women with histologically confirmed invasive cervical cancer. Samples were taken from women examined by speculum for microbiological examination: - Two high vaginal swabs were taken from each woman for bacteriological examination; - Vaginal swab from the posterior vaginal fornix which was immediately after taking suspended in 1 ml of normal saline solution and incubated at 37°C in order to identify the protozoa T. vaginalis by using the wet mount technique; - Two cervical swabs for bacteriological examination; - Endocervical swab for detection of genital mycoplasmas was collected using a Dacron endocervical swab; - Endocervical swab for detection of C.trachomatis was collected using a Dacron endocervical swab [17]. Microbiological testing of samples from the genital tract included direct swabs for wet and stained smears for microscopy, and inoculation of culture medium, testing for C. trachomatis and genital mycoplasmas. The wet preparation method was used for the diagnosis of trichomoniasis, bacterial vaginosis, and candidiasis in women. BV diagnosis was based on the presence of the "clue cells", which are vaginal epithelial cells covered with numerous tiny rods and coccobacilli. If the swabs from women with bacterial vaginosis are positive for Mobiluncus spp., the abundance of highly motile bacteria can be observed on the microscopic preparation. Gram-stained vaginal smears were used for the direct cytobacteriological examination. Gramstained vaginal smear enables observing the epithelial cells, and at the same time provides the insight into the number and presence of leukocytes and 2089
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
microbial flora. "Clue cells" in the Gram-stained vaginal smear are covered by masses of Gram-labile and Gram-negative bacilli and coccobacilli. BV was diagnosed also by using the Nugent score, a semi quantitative scoring system to evaluate bacterial morphotypes on the direct Gram stain of vaginal fluid [17]. The increased number of polymorphonuclear leukocytes (PMN) in the DMP indicates the presence of inflammatory reaction. Different microbiological culture media were used for the inoculation of vaginal and cervical swabs. For the isolation of aerobic Gram-positive bacteria (Columbia agar), differential medium for isolation of Enterobacteriacae (Mac Conkey), a selective medium for the isolation of Gardnerella vaginalis (Blood agar: a selective medium with 5% Human Blood), enriched medium for the selective isolation of Neisseria gonorrhoeae (Thayer Martin Medium with selective supplements) and medium for the isolation of yeasts of the genus Candida (Sabouraud's Dextrose Agar). Medium (Mac Conkey agar ) for Enterobacteriaceae was incubated at 37°C and examined after 24 hours. Other culture media were incubated in an atmosphere of high relative humidity and a CO2–enriched atmosphere for 48 hours. Microorganisms cultivated from positive culture media were identified by using standard microbiological methods [17]. Confirmation of BV diagnosis was done by the growth of G.vaginalis in pure culture or by its presence in relatively large numbers compared to the other bacteria on the selective medium with 5% Human Blood. Colonies of G.vaginalis are easy to isolate on the solid medium. They are round, transparent, smaller than 0.5 mm in diameter, surrounded by discrete weak β-hemolysis. On the Gram-stained smear using a plate culture of G.vaginalis, we observed Gram-negative or Gram-labile short rods [17]. Diagnosis of genital mycoplasmas was performed with the commercially available Mycoplasma IST 2 Kit (bioMérieux, France), by means of which the genital Mycoplasma were identified and quantified; simultaneously antibiotic susceptibility tests were performed. C. trachomatis infection was diagnosed by direct immunofluorescence using commercial Fluorotect Chlamydia test (Omega Diagnostics Ltd, Scotland. United Kingdom). In women with histopathologically verified invasive cancer, testing for 2090
C.trachomatis was not performed, due to inability to get adequate samples for testing (presence of blood on the swab). Biopsy samples were taken from colposcopically suspect changes of the cervix (white-colored after the application of acetic acid, mosaic, irregular vascularization) with a Q-tip or hook; the depth of biopsy specimens was about 3mm. The cervical biopsy results were reported as without precancerous and cancerous changes in the cervix, as CIN 1= mild dysplasia; CIN 2 = moderate dysplasia; CIN 3= severe dysplasia or ICC = invasive cervical cancer [18]. The participants completed a questionnaire prepared for the research purposes. A questionnaire was a series of questions posed to women to obtain statistically useful information about sexual behavior and socio-demographic data (date of birth, age of first sexual intercourse, number of sexual partners, frequency of sexual activity, presence of sexually transmitted diseases, number of childbirths, age of first childbirth, use of hormonal contraceptives and hormonal drugs, data on vaginal washing practices, kinds of lower genital tract symptoms, education level, nationality, smoking status). Quantitative statistical analysis was performed using SPSS version 10.0 and the StatCalc function of Epi Info software package version 6th. The Student t-test was used to compare the mean values of numerical symbols; comparison of the frequency of the descriptive characteristics among groups was performed using Mantel-Haenszel Chi square test, and in cases where expected frequencies were less than five - Fisher's exact probability test for testing the zero hypothesis. The assessment of correlation between each individual risk factor and the finding of precancerous changes in the cervix was carried out using a logistic regression analysis. As the threshold value for declaring statistical significance was estimated error of less than 5% (p <0.05) in all analyses. The results of statistical analysis are shown in tables. Results On average, women in the group with invasive cervical cancer were 50.28 ± 9.17 years old, and they were significantly older than women in the test group with precancerous changes in the cer-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
vix (43.95 ± 9.27 years old and p-value = 0.019), and they also were older than women without precancerous and cancerous changes on the cervix (41.97 ± 10.89 years old and p value = 0.007) (Table 1). The difference in age between women with precancerous changes in the cervix and women without precancerous and cancerous changes in the cervix was not statistically significant. Bacterial vaginosis was found in 18 (43.9%) women with precancerous changes in the cervix and 13 (44.8%) women with invasive cervical cancer, which in both cases meant that the frequencies of women with BV was significantly higher in both groups compared to the group of women without Table 1. Age of patients by groups
Variables A SD Min Max Examinees with CIN (I) 43.95 9.27 26.00 63.00 with Ca (II) 50.28 9.17 31.00 63.00
precancerous and cancerous changes in the cervix, where BV was confirmed only in 3 (10.0%) cases (p = 0.003) (Table 2). It is very important that BV in our research was not proven as a co-infection with other tested infectious agents in combination. C. trachomatis was confirmed in 24 (58.5%) cases in the test group, while the percentages of females with this infection was significantly lower in women without precancerous and cancerous changes in the cervix (30.0% and p = 0.029). The frequencies of infection with other bacteria did not differ significantly among the groups (p >0.05) (Table 3). In women with precancerous changes of the cervix, yeasts of the genus Candida were not found.
A: arithmetic mean; SD: standard deviation; Min: minimal value; Max: maximal value; CIN: cervical intraepithelial neoplasia; Ca: invasive cervical cancer
without CIN and Ca (III) 41.97 10.89 23.00 63.00
Comparison between groups I vs II: p-value = 0.019 II vs III: p-value = 0.007
Table 2. Association between bacterial vaginosis and CIN
BV BV present no. (%) BV absent no. (%) Examinees with CIN (I) with Ca (II) without CIN and Ca (III) 18 (43.9%) 23 (56.1%) 13 (44.8%) 16 (55.2%) 3 (10.0%) 27 (90.0%) Comparison between groups I vs III: p-value = 0.003 II vs III: p-value = 0.003
CIN: cervical intraepithelial neoplasia; Ca: invasive cervical cancer; BV: bacterial vaginosis
Table 3. Association between other bacteria and CIN
Findings Chlamydia trachomatis Mycoplasma hominis Ureaplasma urealyticum Streptococus agalactiae Escherichia coli Examinees with CIN (I) with Ca (II) 24 (58.5%) 6 (14.6%) 1 (2.4%) 6 (14.6%) 5 (12.2%) ... 4 (13.8%) 1 (3.4%) 6 (20.7%) 3 (10.3%) without CIN and Ca (III) 9 (30.0%) 3 (10.0%) 2 (6.7%) 5 (16.7%) 3 (10.0%) Comparison between groups I vs III: p-value = 0.029 n.s. n.s. n.s. n.s.
CIN: cervical intraepithelial neoplasia; Ca: invasive cervical cancer; n.s.: statistically not significant difference
Journal of Society for development in new net environment in B&H
2091
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 4. Association between Candida spp. and Trichomonas vaginalis and CIN
Finding Candida spp. Trichomonas vaginalis Examinees with CIN 2 (4.9%) with Ca 1 (3.4%) 2 (6.9%) without CIN and Ca 3 (10.0%) Comparison between groups n.s. n.s.
CIN: cervical intraepithelial neoplasia; Ca: invasive cervical cancer; n.s.: statistically not significant difference
The frequencies of infection caused by the protozoa Trichomonas vaginalis did not differ significantly between the groups (p >0.05) (Table 4). Eight (53.3%) women had bacterial vaginosis among 15 women with CIN 1; seven (50.0%) had bacterial vaginosis among 14 women with CIN 2; and three (25.0%) had bacterial vaginosis among 12 women with CIN 3. The incidence of bacterial vaginosis did not differ significantly between the groups with various severity of cervical dysplasia (p >0.05) (Table 5). Table 5. Association between bacterial vaginosis and severity of CIN
BV CIN low-grade moderate-grade high-grade Comparison between CIN 1, CIN 2 and CIN 3 BV present no. (%) 8 (53.3%) 7 (50.0%) 3 (25.0%) n.s. BV absent no. (%) 7 (46.7%) 7 (50.0%) 9 (75.0%)
Table 6. Assessment of association between bacterial vaginosis and CIN
Limits of 95% CI Microbiological p OR results The upper The lower value BV present 7.040 1.838 26.955 0.004 BV absent 0.142 0.037 0.544 0.004
CIN: cervical intraepithelial neoplasia; OR: odds ratio; CI: confidence interval; BV: bacterial vaginosis
CIN: cervical intraepithelial neoplasia; BV: bacterial vaginosis; n.s.: statistically not significant difference; CIN 1: low grade CIN; CIN 2: moderate grade CIN; CIN 3: high grade CIN
The assessment of association between bacterial vaginosis and other risk factors for the development of precancerous changes in the cervix was carried out by logistic regression analysis. It was found that the risk of the development of precancerous changes in the cervix was 7.04 (1.84 to 26.95) times higher in women with bacterial vaginosis than in women without BV (p=0.004). Univariate logistic regression analysis confirmed that BV is statistically significant predictor of precancerous changes of the cervix (Table 6).
Univariate logistic regression analysis revealed also a significant relationship between the development of precancerous changes in the cervix and other possible factors such as the following: the presence of Chlamydia trachomatis, a positive family history of cancer, irregular visits to gynecologist, having six or more than six sexual partners in patient’s lifetimes, having sex seven and more times per week, being 26 or older at the first childbirth, the use of contraceptive pills, having a low educational level, and smoking 11–20 cigarettes per day. Multivariate analysis identified the four risk factors which significantly influence the development of precancerous changes in the cervix: bacterial vaginosis, irregular visits to gynecologist, use of contraceptive pills and having low education level (Table 7). The final multivariate logistic regression model showed that, if the other risk factors that contribute to development of CIN can be controlled, BV increases the risk for development of precancerous changes in the cervix about 8.36 times (1.89 to 37.04). The model that includes as independent variables the listed risk factors and the regression constant explains the change of risk for development of CIN in our sample by 49.2% (The model was assessed by coefficient of determination, R2 = 0.492). The frequencies of irregular visists to gynecologist, use of contraceptive pills and having low education level did not differ significantly among
2092
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 7. Assessment of impact of BV and other risk factors on CIN development
Risk factors BV Irregular visits to gynecologist Using oral contraceptives Low level of education The regression constant OR 8.360 3.380 19.476 11.089 0.205 Limits of 95% CI The upper 1.887 1.032 2.048 1.181 The lower 37.042 12.256 185.242 104.100 Test and p-value 0.005 0.048 0.010 0.035 0.004
CIN: cervical intraepithelial neoplasia; OR: odds ratio; CI: confidence interval; BV: bacterial vaginosis
the groups in women with BV (p >0.05). The compared frequencies of the listed factors among women with bacterial vaginosis and without it did not significantly differ in study groups. This result showed that irregular visists to gynecologist, use of contraceptive pills and low education level influence the development of precancerous changes in the cervix apart from bacterial vaginosis. Discussion In 1863, the great pathologist Rudolf Virchow formulated the hypothesis that transformation of cells occures areas affected with chronic infection. He explained this as a consequence of tissue injury, inflammation and increased cell proliferation during chronic infection [19, 20]. Schwebke et al. in their study by univariate analysis pointed out a significant linkage between BV and cervicitis and between the use of metronidazole gel and resolution of cervicitis [21]. Plasma cell endometritis in women with symptomatic bacterial vaginosis is very common, and it is not associated with vaginal and cervical infections by other bacteria. These results suggest a possible link between BV and non-chlamydial and non-gonococcal infection of the upper genital tract in women [22]. BV causes cervical inflammatory epithelial changes, and cervical chronic inflammation in women with BV could be considered as a possible mechanism that causes potentially malignant cellular changes anywhere on the cervix [11, 12, 14]. By univariate analysis, Lehtovirt et al. revealed that BV was significantly associated with increased risk of developing CIN [9]. In our study, bacterial vaginosis was found in 18 (43.9%) women with CIN and in 13 (44.8%)
with invasive cervical cancer, which in both cases was statistically significantly higher compared to the group of examinees without precancerous and cancerous changes of cervical biopsy specimen, in which bacterial vaginosis was confirmed only in 3 (10.0%) cases (p = 0.003). The risk for development of CIN was 7.04 (1.84 to 26.95) times higher in women with bacterial vaginosis than in women without BV (p = 0.004). Univariate logistic regression analysis showed that BV is a statistically significant predictor for the precancerous changes in the cervix. The model for a multivariate regression separated BV as cofactor that increases the risk for development of precancerous changes in the cervix about 8.36 times (1.89 to 37.04) and three other factors as factors that significantly influence the development of CIN. Our results are quite compatible with the results of Clomp et al. who found a correlation between cytologically diagnosed G.vaginalis infection and CIN [23]. They collected data from 800,498 Dutch asymptomatic women, participating in the Dutch national screening program. Clomp et al. showed that the prevalence of (pre) cancerous changes of cytologically diagnosed G.vaginalis infection was 0.6 per thousand women. The risk of (pre)cancerous changes was significantly higher in women with cytologically diagnosed G.vaginalis infection than in women with normal vaginal flora (Odds ratio (OR), 10.3, 95% confidence interval, 6.6 to 16.1). Uthayakumar et al. found in their retrospective study performed in England that women with BV were at increased risk of CIN [24]. Diagnosis of bacterial vaginosis was based on the presence of the “clue cells” in the direct Gram stain preparation of vaginal fluid taken from the upper part of the vagina, positive amine test, pH over 4.5, presence of characteristics vaginal discharge. Our results 2093
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
are also consistent with the findings of Nam et al. who found that the incidence of CIN was significantly higher in the BV-present group (p = 0.043), however, no statistically significant relationship between BV and CIN was demonstrated by multivariate analysis (p=0.081) [25]. A retrospective, longitudinal, cohort study was performed as a part of the Dutch Cervical Screening Program, involving the population of 100,605 women, each of whom had 2 smears taken over a period of 12 years [26]. The dysbacteriotic cohort was significantly more likely to have low-grade squamous intraepithelial lesions (LSIL) and highgrade squamous intraepithelial lesions (HSIL) in their follow-up smear (OR, 1.85; 95% confidence interval [95% CI], 1.28-2.67 and OR, 2.00; 95% CI, 1.31-3.05, respectively) compared to women in the control group. The results obtained in this study are consistent with our results. In addition, Schiff et al. found similar results to ours: an association between the presence of the "clue cells" in vaginal wet mount and precancerous changes of the cervix [27]. We found the negative correlation between bacterial vaginosis and degree of cervical dysplasia in our study. Of 15 women with 8 (53.3%) had bacterial vaginosis and CIN 1, of 14 women 7 (50.0%) had BV and CIN 2, and of 12 women 3 (25, 0%) had BV and CIN 3. Nam et al. [25]. in their study found no correlation between BV and severity of precancerous changes of the cervix; this result is consistent with our results. Peters et al. also found in their work that BV has no effect on the severity of CIN, or on the mitotic index in cervical intraepithelial neoplasia [28]. Neuer et al. also did not find statistically significant difference between bacterial vaginosis and the grade of cervical dysplasia in their study [29]. Zbroch et al. found in their study that CIN 1 is more common in women with BV and in women with Chlamydia trachomatis infection than in women without these infections [30]. Discacciati et al. found that BV was similarly present among women of both their study groups: in 18% of women with SIL and in 12% of women without SIL. Their results were also similar when the grade of SIL was taken into consideration. BV was detected in 16% of women with low-grade SIL, and in 33% women with high-grade SIL when compared to the controls (12%) [8]. 2094
Platz-Christensen et al. investigated the relationship between the presence of clue cells in Papanicolaou-stained vaginal smears and CIN. They examined a total of 6.150 specimens and discovered that any grade CIN was more common among women with BV (p <0.001). The relative risk of having CIN 3/carcinoma in situ was 5.0 for the confidence interval in 95% of women with BV. Their conclusion was that BV can be associated with the development of CIN, ie. BV infection may be an independent factor or cofactor for HPV in the development of cervical precancerous changes [31]. However, not all scientists accept this correlation as statistically significant. Peters et al. did not reveal a significantly higher prevalence of bacterial vaginosis in women with dysplasia in the cervix [28]. Boyle et al. showed that women with BV were not found to have CIN more frequently than women with normal vaginal flora, and the quantities of nitrosamines produced by women with BV did not differ significantly from women without BV [32]. Frege et al. found the opposite conclusion to ours in their study. In their investigation diagnosis of BV is based on four criteria: presence of clue cells, pH 4.5, positive amine test and increased vaginal discharge. The results of their study demonstrated that there is no significant correlation between CIN and BV (P <0.00005) [33]. Numerous studies were conducted to evaluate the correlation between bacterial vaginosis and CIN, however, their results were not consistent because the methods of investigation varied from study to study. Sensitivities and specificities vary for different diagnostic tests for bacterial vaginosis depending on several different diagnostic criteria which must be taken into account when comparing the results of various studies. Taking into consideration that there are many risk factors, it is necessary to examine all of them, especially the infection with HPV. Our study has potential limitations that must be considered in interpretation of results: lack of validation of interview data; our study did not involve the entire female population but only the patients referred to colposcopic examination for sampling material for pathohistological examination; a limitation of this study is also the small sample size. We reminded the study subjects at several points in the interview about the confidential nature of all data collected so as to
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
increase the likelihood of accurate responses about sexual behavior. We must bear in mind that the diagnosis of HPV infection has not been made. However, all mentioned limitations of this study leave room for further study, by using a larger sample and tests with high sensitivity and specificity. In conclusion, based on the obtained results, we found that bacterial vaginosis was significantly more frequent in women with CIN and in women with invasive cervical cancer. We did not confirm neither correlation between BV and the severity of precancerous changes in the cervix, nor significant effect of BV on development of precancerous changes in the cervix apart from other confirmed risk factors. Acknowledgment This work was supported by the Ministry of Science and Technological Development of the Republic of Serbia, Grant Number 46012. References
1. Koumans EH, Kendrick JS. Preventing Adverse Sequelae of Bacterial Vaginosis. Sex Transm Dis 2001; 28(5): 292-297. 2. Burton JP, Reid G. Evaluation of the bacterial vaginal flora of 20 postmenopausal women by direct (Nugent score) and molecular (polymerase chain reaction and denaturing gradient gel electrophoresis) techniques. J Infect Dis 2002; 186: 1770–1780. 3. Coolen MJ, Post LE, Davis CC, Forney LJ. Characterization of microbial communities found in the human vagina by analysis of terminal restriction fragment length polymorphisms of 16S rRNA genes. Appl Environ Microbiol 2005; 71: 8729–8737. 4. Devillard E, Burton JP, Reid G. Complexity of vaginal micro-flora as analyzed by PCR denaturing gradient gel electrophoresis in a patient with recurrent bacterial vaginosis. Infect Dis Obstet Gynecol 2005; 13: 25–31. 5. Verstraelen H, Verhelst R, Claeys G, Temmerman M, Vaneechoutte M. Culture-independent analysis of vaginal microflora: the unrecognized association of Atopobium vaginae with bacterial vaginosis. Am J Obstet Gynecol 2004; 191: 1130–1132.
6. Zariffard MR, Saifuddin M, Sha BE, Spear GT. Detection of bacterial vaginosis-related organisms by real-time PCR for lactobacilli, Gardnerella vaginalis and Mycoplasma hominis. FEMS Immunol Med Microbiol 2002; 34: 277–281. 7. Boyle DCM, Smith JR. Infection and cervical intraepithelial neoplasia. Int J Gynecol Cancer 1999; 9: 177–186. 8. Discacciati MG, Simoes JA, Lopes ES, Silva SM, Montemor EBL, Rabelo-Santos SH, Westin MCA. Is bacterial vaginosis associated with squamous intraepithelial lesion of the uterine cervix? Diagn. Cytopathol 2006; 34:323-325. 9. Lehtovirta P, Paavonen J, Heikinheimo O. Risk factors, diagnosis and prognosis of cervical intraepithelial neoplasia among HIV-infected women. Int J STD AIDS 2008; 19 Suppl 1: 37-41. 10. Sharma A, Rajappa M, Saxena A, Sharma M. Cytokine profile in Indian women with cervical intraepithelial neoplasia and cancer cervix. Int J Gynecol Cancer 2006; 17 Suppl 4: 879-885. 11. Marrazzo JM, Wiesenfeld HC, Murray PJ, Busse B, Meyn L, Krohn M, Hillier SL. Risk Factors for Cervicitis among Women with Bacterial Vaginosis. J Infect Dis 2006; 193 Suppl 5: 617-624. 12. Berhane T, Halliday GM, Cooke B, Barnetson RS. Inflammation is associated with progression of actinic keratoses to squamous cell carcinomas in humans. Br J Dermatol 2002; 146: 810–815. 13. Jaiswal M, LaRusso NF, Gores GJ. Nitric oxide in gastrointestinal epithelial cell carcinogenesis: linking inflammation to oncogenesis. Am J Physiol Gastrointest Liver Physiol 2001; 281: G626–634. 14. Behbakht K, Friedman J, Heimler I, Aroutcheva A, Simoes J, Faro S. Role of the vaginal microbiological ecosystem and cytokine profile in the promotion of cervical dysplasia: a case-control study. Infect Dis Obstet Gynecol 2002; 10 Suppl 4: 181-186. 15. Program for Appropriate Technology in Health. Planning Appropriate Cervical Cancer Control Programs. Seattle: PATH. 1997. 16. Bourne PA. Sociodemographic correlates of age at sexual debut among women of the reproductive years in a middle-income developing nation. HelthMED 2011; 5(1): 3-16. 17. Ranđelovic G. Mikrobioloska dijagnoza infekcija genitalnih puteva zena, 1st edition. Nis: Studentski kulturni centar 2001; 26-73p.
Journal of Society for development in new net environment in B&H
2095
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
18. Solomon D, Kurman R, Davey D, Moriarty A, O'Connor D, Prey M, Raab S, Sherman M, Wilbur D, Wright T Jr, Young N. The 2001 Bethesda System: terminology for reporting results of cervical cytology. Jama 2002; 287 Suppl 16: 2114-2119. 19. Balkwill F, Mantovani A. Inflammation and cancer: back to Virchow? Lancet 2001; 357: 539–545. 20. Coussens LM, Werb Z. Inflammation and cancer. Nature 2002; 420: 860–867. 21. Schwebke JR, Weiss HL. Interrelationships of bacterial vaginosis and cervical inflammation. Sex Transm Dis 2002; 29 Suppl 1: 59-64. 22. Korn AP, Bolan G, Padian N, Ohm-Smith M, Schachter J, Landers DV. Plasma cell endometritis in women with symptomatic bacterial vaginosis. Obstet Gynecol 1995; 85 Suppl 3: 387-390. 23. Klomp JM, Boon ME, Van Haaften M, Heintz AP. Cytologically diagnosed Gardnerella vaginalis infection and cervical (pre)neoplasia as established in population-based cervical screening. Am J Obstet Gynecol 2008; 199: 480. 24. Uthayakumar S, Boyle DC, Barton SE, Nayagam AT, Smith JR. Bacterial vaginosis and cervical intraepithelial neoplasia: cause or coincidence? J Obstet Gynaecol 1998; 18: 572-574. 25. Nam KH, Kim YT, Kim SR, Kim SW, Kim JW, Lee MK, Nam EJ, Jung YW. Association between bacterial vaginosis and cervical intraepithelial neoplasia. J Gynecol Oncol 2009; 20 Suppl 1: 39-43. 26. Engberts MK, Verbruggen BS, Boon ME, van Haaften M, Heintz AP. Candida and dysbacteriosis: a cytologic, population-based study of 100,605 asymptomatic women concerning cervical carcinogenesis. Cancer 2007; 111 Suppl 5: 269-274. 27. Schiff M, Becker TM, Masuk M, van Asselt-King L, Wheeler CM, Altobelli KK, North CQ, Nahmias AJ. Risk Factors for Cervical Intraepithelial Neoplasia in Southwestern American Indian Women. Am J Epidemiol 2000; 152: 716–726. 28. Peters N, Van Leeuwen AM, Pieters WJ, Hollema H, Quint WGV, Burger MPM. Bacterial vaginosis is not important in the etiology of cervical neoplasia: a survey on women with dyskaryotic smears. Sex Transm Dis1995; 22: 296–302. 29. Neuer A, Menton M. [Bacteriological findings in patients with cervical intra-epithelial neoplasia]. Zentralbl Gynakol 1995; 117 Suppl 8: 435-438.
30. Zbroch T, Knapp P, Błońska E, Kobylec M, Knapp P. [Life style, Chlamydia trachomatis infection, bacterial vaginosis and their impact on the frequency of cervical lesions]. Ginekol Pol 2004; 75 Suppl 7: 538-544. 31. Platz-Christensen JJ, Sundstrom E, Larsson PG. Bacterial vaginosis and cervical intraepithelial neoplasia. Acta Obstet Gynecol Scand 1994; 73: 586–588. 32. Boyle DC, Barton SE, Uthayakumar S, Hay PE, Pollock JW, Steer PJ, Smith JR. Is bacterial vaginosis associated with cervical intraepithelial neoplasia? Int J Gynecol Cancer 2003; 13 Suppl 2: 159-163. 33. Frega A, Stentella P, Spera G, Pace S, Cipriano L, Di Ruzza D, Villani C, Pachì A. Cervical intraepithelial neoplasia and bacterial vaginosis: correlation or risk factor? Eur J Gynaecol Oncol 1997; 18 Suppl 1: 76-77. Corresponding author Milena Misic, Department of Public Health Vranje, Center for Microbiology, Serbia, E-mail: milena.s.misic@gmail.com
2096
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Relationship between emotional intelligence and leadership behavior of turkish male nursing students
Serap Altuntas1, Rahsan Akyıl2
1 2
Ataturk University, Faculty of Health Sciences, Nursing Management Department, Turkey Ataturk University, Faculty of Health Sciences, Internal Nursing Department, Turkey.
Abstract Background: It is important to promote emotional intelligence and leadership behavior of male nursing students to train nurses who have leadership skill to meet emotional requirements of their patients. Aim: The study was planned in descriptive, correlative and relational style to determine the relationship between emotional intelligence and leadership behaviors of male nursing students. Methods: Data was collected from male nursing students (n=87) who receive undergraduate education in a faculty of medical sciences. In data collection, a questionnaire form including 4 questions investigating the personal information of students, “Emotional Intelligence Scale” and “Leadership Behavior Description Scale” was used. Questionnaire forms were distributed to male nursing students in classroom in January 2010, and then collected back when they were completed. 87 out of total 130 students agreed to participate in the study. Participation rate was 67%.Collected data was analyzed in SPSS 11.5 by frequency, percentage distribution and Pearson correlation analyses. Findings: As a result of the study, emotional intelligence level of male nursing students was found moderate in all sub-dimensions and they needed to improve their emotional intelligence level. On the other hand, students were determined to exhibit leadership behavior higher than moderate level. Furthermore, a positive relation was detected between the emotional intelligence level and leadership behavior of male nursing students. Key Words: Male nursing students, nursing, leadership, emotional intelligence, Turkey.
Introduction Emotions have important roles in understanding human nature, and interpreting thoughts, and behaviors. Emotions have been neglected in science world for long period of time, and wisdom have been given importance and identified with intelligence. Emotions were accepted human weaknesses and the expression of emotions was not found suitable for people like leaders who should have strong will (1,2). At present, modern psychology studies have reported that emotions are motivating and effective on behaviors, and give meaning and purpose; in addition, people have emotional intelligence (3,4,5). The term of emotional intelligence was first used by Peter Salovey and John Mayer in 1990 (4). Salovey & Mayer defined emotional intelligence as an ability to understand and question through emotions, absorb emotions in opinions, and arrange emotions of others (4) Afterwards, Daniel Goleman defined emotional intelligence as self-motivation, progressing despite problems, postponing satisfaction by controlling impulses, arranging state of mind, disallowing problems to hinder reasoning and empathy, and also expressed that emotional intelligence was more important than cognitive intelligence (3). With its increasing importance for both social life and working life of individuals, emotional intelligence directly affects the interpersonal relations in private and working lives, and thus affects the work performance (1,6,7). Previous studies reported that emotional intelligence increases the ability to solve problems (8,9), decreases desensitization the beginning of exhaustion and increases 2097
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
personal sense of achievement (10). I and facilitates coping with stress by reducing perceived stress (9,11). In addition, emotional intelligence is stated to positively affect the leadership behavior and accepted as one of the properties that strengthen leadership (12, 13,14,15). Leaders should know and control their emotions, understand the emotions of their followers, cope with negative emotions, empathize with followers, motivate them and be open in social relations in order to affect their followers and make changes (1, 7, 12, 16, 17,18). Furthermore, leaders should be good listeners of their followers, respect their opinions, transform negative emotions to positive ones, be supportive, objective, trustable, inspirer, and should have emotional intelligence to effectively present leadership behaviors like good communication skill (7,19,20). In many different studies investigating the relation between emotional intelligence and leadership behavior of managers (1, 14,19,21 ), university personnel (15), female nursing students (22), graduate students in faculty of management (23), bank staff (1) and soldiers (2,24), a positive relation was detected between emotional intelligence and leadership behavior, and emotional intelligence was found to positively affect the leadership behaviors. Emotional intelligence is especially important for health staff to correctly understand the emotional requirements of patients and demonstrate convenient behaviors (25,26, 27). Nurses are expected to have emotional intelligence to effectively meet the health requirements of individuals who are ill and have complex emotions and to assume the leadership to provide a positive working environment (16, 17, 28, 29, 30). Leadership behaviors slowly develop in nursing profession made, to a great extent, by females. It is reported that leadership ability of females cannot be adequately developed due to the perception of females weaker than male, females not improving their skills and abilities and the traditional roles and belief resulting from social identity of females. Certain behaviors like respect and obedience of females to males in patriarchal family-based Turkish society are also expected from nurses, which negatively affects the leadership in nursing (31). Leadership and success are generally ascribed to males, and males are inclined towards 2098
professions that could provide more strength and success, which all positively affect the leadership behavior of males (31,32). Almost all of the nurses are females in Turkey as in the rest of the world. 14 male nurses were trained between 1963 and 1967 in Turkey; however, they could not find a job opportunity because men were not employed as a nurse according to the nursing law at the time. With the changes in Nursing Law in 2007, sex discrimination was outlawed and the obstacles for men to become nurse were removed. This development has aroused men’s interest for nursing and the number of male students in nursing schools has been increased (33). Positive approach of society for male nurses in the recent years (,33,34,35,36,37,38,39), and increasing interest of men for nursing profession indicate that male nurses will take a greater part in working life, and perhaps more effective leaders will appear. It has not known yet whether male nursing students have certain skills desired in nursing profession like emotional intelligence and leadership behaviors. Evaluation of emotional intelligence and leadership behavior in male students and determination of missing points that should be developed later (24,28,40) will provide important data for male students to acquire these skills during their education, and to graduate as nurses with leadership ability to meet the emotional requirements of patients. Methods Aim and design: The study was planned in descriptive, correlative and relational style to determine the relationship between emotional intelligence and leadership behaviors of male nursing students. Sample: The study population was composed of male students receiving education in a faculty of medical sciences, while all male nursing students were included in the scope of study without any sample selection. Research questions: - What is the emotional intelligence level of make nursing students? - What are the leadership behaviors of male nursing students?
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
-
Is there a significant relationship between emotional intelligence and leadership behaviors of male nursing students?
Instruments: In data collection, a questionnaire form including 4 questions investigating the personal information of students, “Emotional Intelligence Scale” and “Leadership Behavior Description Scale” was used. Emotional Intelligence Scale was developed by Hall (1999) and its Turkish adaptation and reliability of the scale for university students was made by Ergin (41). The scale was a 6-point Likert type scale (1:definitely disagree, 2: disagree, 3:partly disagree, 4:partly agree, 5:agree, 6:definitely agree) and composed of 30 items and 5 sub-dimensions (6 items on awareness of emotions, 6 items on administration of self emotions, 6 items on self motivation, 6 items on empathy and social skills). There is no reversible statement in the evaluation of scale. The sub-dimension score was calculated by summing the scores of answers given to items constituting the sub-dimension. Evaluation of scale according to scores obtained from sub-dimensions is given in Table 1 (41). Cronbach’s alpha coefficient of scale was found 0.84 by Ergin, while it was 0.92 in the present study (41) Leadership Behavior Description Scale was developed by the researchers of OHIO State University and its Turkish adaptation and reliability was made by Ergun (42). This scale was developed to measure the leadership behaviors and general leadership skills of individuals. The scale was composed of 40 items and 10 sub-dimensions (possession, stimulating the mass, protecting membership, representation of organization, integrating purposes, organizing, top to bottom co-
mmunication, recognition and production) and it was a 5-point Likert scale (4:always, 3:usually, 2:sometimes, 1:rarely, 0:never). There are 4 items in each sub-dimension of scale, and the scoring was reverse for 12th, 20th and 39th statements. Maximum 16 point can be obtained from sub-dimensions. Higher scores indicate that individual demonstrates leadership behaviors in the sub-dimension. Cronbach’s alpha coefficient of the scale was found 0.70 by Ergun (42), while it was 0.86 in the present study. Ethical consideration: Necessary approvals were obtained from ethical committee and the institution in the study. Before data collection, all male nursing students were informed about the study, and data was collected from students who agreed/volunteered to participate in the study based on willingness. Data collection: Questionnaire forms were distributed to male nursing students in classroom in January 2010, and then collected back when they were completed. 87 out of total 130 students agreed to participate in the study. Participation rate was 67%. Data analysis: Collected data was analyzed in SPSS 11.5 by frequency, percentage distribution and Pearson correlation analyses. Results Considering the personal characteristics of male nursing students participating in the study, 40.2% are second year students, 37.9% are first year students, 66.7% are standard high school graduates, 57.5% live in east Turkey, and 54% live in metropolitan cities.
Table 1. Evaluation of sub-dimension scores of Emotional Intelligence Scale
Sub-dimensions of Scale Awareness of emotions Management of self emotions Self motivation Empathy Social skills (management of other’s emotions) Quite strong (high) ≥31 ≥32 ≥31 ≥31 ≥30 A little bit improvement Improvement is certainly is needed (Normal) needed (low) 26-30 ≤25 27-31 ≤26 27-30 ≤26 26-30 ≤25 25-29 ≤24
Journal of Society for development in new net environment in B&H
2099
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 2. The mean scores of male nursing students on sub-dimensions of Emotional Intelligence Scale (N=87)
Sub-dimensions of Emotional Intelligence Scale Awareness of emotions Management of self emotions Self motivation Empathy Social skills (management of other’s emotions) Min. 18 11 8 17 18 Max. 36 36 35 36 36 Mean 29.17 26.60 27.70 28.41 28.13 SD 3.41 4.87 4.42 3.75 3.82 Comment (Conclusion) A little bit improvement is needed Improvement is certainly needed A little bit improvement is needed A little bit improvement is needed A little bit improvement is needed
Table 3. The mean scores of male nursing students on sub-dimensions of leadership behavior description scale (N=87)
Sub-dimensions of Leadership Behavior Description Scale Possession Stimulating the mass Protecting membership Representing the organization Integrating purposes Organizing Top to bottom communication Bottom to top communication Recognition Production Min. 4 4 7 5 5 5 6 6 5 3 Max. 16 16 16 15 16 16 15 16 15 16 Mean 11.77 10.86 11.91 10.90 10.88 10.96 10.78 12.25 11.19 11.36 SD 2.40 2.20 1.99 2.27 1.92 2.27 1.84 2.11 2.23 2.35
Table 4. Relations between the sub-dimensions of Emotional Intelligence Scale and the sub-dimensions of Leadership Behaviors Description Scale of male nursing students
Awareness of Management of emotions self emotions r p Possession .39 0.000* Stimulating the mass .40 0.000* Protecting membership .44 0.000* Representing the organization .34 0.001** Integrating purposes .32 0.003** Organizing .37 0.000* Top to bottom communication .30 0.004** Bottom to top communication .43 0.000* Recognition .44 0.000* Production .37 0.000*
* p < 0,001 ** p < 0,05
Self motivation r .35 .42 .33 .37 .31 .28 .35 .47 .51 .38 p 0.001** 0.000* 0.002** 0.000* 0.003** 0.007** 0.001** 0.000* 0.000* 0.000*
Empathy r .29 .44 .44 .27 .30 .42 .24 .47 .39 .29 p 0.006** 0.000* 0.000* 0.009** 0.005** 0.000* 0.024** 0.000* 0.000* 0.005**
Social skills r p .41 0.000* .35 0.001** .45 0.000* .36 0.000* .38 0.000* .38 0.000* .38 0.000* .41 0.000* .47 0.000* .54 0.000*
r .31 .42 .44 .32 .34 .39 .28 .44 .44 .39
p 0.003** 0.000* 0.000* 0.002** 0.001** 0.000* 0.007** 0.000* 0.000* 0.000*
Investigation of the mean scores of male nursing students on sub-dimensions of emotional intelligence scale (Table 2) demonstrated that the mean score of students was 29.17 ±3.41 in awareness of emotions, 26.60± 4.87 in managing self emotions, 27.70± 4.42 in self-motivation, 28.41± 3.75 in empathy, and 2100
28.13±3.82 in social skills (administrating emotions of others). Emotional intelligence levels of students were found moderate in all sub-dimensions and their emotional intelligence should be improved. Considering students’ sub-dimension scores of the leadership behavior description scale (Table
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
3), the mean score was found 11.77±2.40 in possession sub-dimension, 10.86 ±2.20 in stimulating the mass, 11.91 ± 1.99 in protecting membership, 10.90 ± 2.27 in integrating purposes, 10.88 ± 1.92 in organizing, 10.78 ± 1.84 in top to bottom communication, 11.19 ± 2.23 in recognizing and 11.36 ± 2.35 in production sub-dimension. These results demonstrated that leadership behaviors of students were above the moderate level and positive. The examination of the relationship between emotional intelligence scale sub-dimensions and leadership behavior description scale sub-dimensions indicates that (Table 4): - there was a positive, weak, but significant relation between awareness of emotions, managing self emotions sub-dimensions and possession, stimulating the mass, protecting membership, representing the organization, integrating the purposes, top to bottom communication, recognition and production sub- dimensions ( 0.26 < r < 0.49, p < 0.05), - there was a positive, weak but significant relation between self motivation, possession, stimulating the mass, protecting the membership, representing the organization, integrating the purposes, organizing, top to bottom communication and production subdimensions (0.26 < r < 0.49, p < 0.05), while there was a positive, moderate and significant relation with recognition sub-dimension ( r= .51 , p < 0.001), - there was a positive, weak but significant relation between empathy and bottom to top communication sub dimensions ( r= .24, p=0.024), while there was a positive, weak but significant relation between possession, stimulating the mass, protecting membership, representing the organization, integrating purposes, organizing, bottom to top communication, recognition, and production sub-dimension (0.26 < r < 0.49, p < 0.05), - there was a positive, weak but significant relation between social skills (administrating other’s emotions) and possession, stimulating the mass, protecting the membership, representing the organization, integrating purposes, organizing, bottom to top communication, and recognizing subdimensions (0.26 < r < 0.49, p < 0.05), while
there was a positive, moderate and significant relation with production sub-dimension ( r= .54 , p < 0.001). Discussion Emotional intelligence and leadership are among the most important factors effective on behaviors, and they have been the objects of interest in health field and many studies have been implemented to determine the emotional intelligence and leadership behaviors of students in different fields of health. Studies on nursing students yielded results on female students. This study is especially important because this is the first study in both international and national fields concerning the emotional intelligence levels and leadership behaviors of especially the male nursing students. Study results demonstrated that male nursing students had moderate level of emotional intelligence, and needed improvement. Although students were aware of their emotions, they were not adequate to control their emotions and motivate themselves, but they could manage other’s emotions better than their emotions. This situation indicates that students were aware of their own emotions but they could not manage their emotions, but they could better manage other’s emotions. The finding that students had moderate level of emotional intelligence is compatible with literature. Emotional intelligence increases with age (18), but the students were in the beginning of twenties; therefore, their emotional intelligence levels were not sufficiently developed. Similar to the findings of studies made on female nursing students in Turkey, students were determined to have moderate level of emotional intelligence and they needed to improve their emotional intelligence levels (26,43,44,45), and students were aware of their emotions and less successful in managing their emotions (26, 44,45). In another study made on female students in the same school, female students obtained their maximum scores in “ability to control self emotions” and “self motivation” sub- dimensions, while they obtained their minimum scores in “awareness of self emotions” and “empathy” sub-dimensions (43), which was different from the findings of the 2101
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
present study. This situation suggests that sex factor affects on sub-dimensions of emotional intelligence and male and female students differ in subdimensions of emotional intelligence. Different results were reported by studies in literature investigating the relationship between emotional intelligence and sex of different students. Some studies determined the general level of emotional intelligence higher in female students than male students (8,26), while some other studies reported that male student had higher emotional intelligence than female students (46,47). On the other hand, some other studies reported no significant difference between male and female students (6,9). In a study carried out on undergraduate and postgraduate students in different departments, it was determined that female students had higher scores in sub-dimensions of understanding their own emotions and other’s emotions and controlling their own emotions compared to male students. Social roles and expectations in Turkish society could be said to be effective on good leadership characteristics of male nursing students. Social expectations from individuals are also expected in working life (31,48 ). Traditional role theory suggests that females and males are affected by their social roles while they perform leadership behaviors (48). In traditional Turkish society, administration and leadership roles are generally ascribed to men and male children are raised to have leadership properties like active, strong, decisive etc. (48). Due to this raising style, men assume these roles, and therefore, they demonstrate certain behaviors like possession, representing, independence, enforcing obedience, acquiring recognition, entrepreneurial spirit, and self-reliance and their leadership behaviors are better. In studies investigating the leadership behaviors of female students, they were found to have moderate level of leadership tendency (22) and they needed to improve their leadership skills (49), which supported the previous opinion. According to the study findings, emotional intelligence level of male nursing students positively affects the leadership behaviors. These findings demonstrate that students will have better leadership behaviors if they improve their emotional intelligence levels. Male nursing students who are aware of other’s emotions, could emphasize, con2102
trol both their and other’s emotions are expected to be better leaders. Similarly, studies in literature determined positive and significant relations between emotional intelligence and leadership (2, 17) and emotional intelligence positively affects the leadership behaviors especially towards people (1) and transforming leadership behaviors (2). In the study of Duygulu et al. (22) investigating the relation between emotional intelligence and leadership behaviors, a significant relation was determined between job-oriented leadership behaviors and emotional intelligence. Conclusion Study results demonstrate that male nursing students have moderate level of emotional intelligence and need to improve them, but they show better leadership behaviors and their emotional intelligence levels positively affect the leadership behaviors. Accordingly, training curriculum of nursing programs should be arranged to promote emotional intelligence of students, and leadership behaviors. Study limitations and implications for future research This is the first study on male nursing students and implemented only on male students of one faculty of medical sciences. For this reason, future studies should be made on larger sample groups, which will provide more detailed information. In addition, findings especially related to leadership are based on self evaluations of male students; therefore, it is suggested to evaluate these characteristics of students from different viewpoints. Acknowledgement We would like thank the Dean of The Faculty of Medical Sciences who gave permission to study and all male nursing students who agreed to participate in the study.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
References
1. Acar, F., 2002. Duygusal zeka ve liderlik. Sosyal Bilimler Enstitüsü Dergisi 12, 53-68. 2. Şahin, A., 2006. Duygusal zekânın etkili liderlik davranışları ile ilişkisi: Kayseri Askerlik Dairesi Başkanlığı’nda çalışan subay ve astsubaylar üzerine bir araştırma. Niğde Üniversitesi Sosyal Bilimler Enstitüsü Yüksek Lisans Tezi, Niğde. 3. Goleman, D., 1995. Emotional Intelligence: Why it can matter more than IQ? New York. NY: Bantam Books. 4. Salovey, P., Mayer, J.D., 1990. Emotional intelligence. Imagination, Cognition and Personality 9 (3), 185-211. 5. Mayer, J.D., Salovey, P., Caruso, D., 2002. The Mayer-Salovey-Caruso Emotional Intelligence Test (MSCEIT). Toronto, Ontario: Multi-Health Systems. 6. Birks, Y., McKendree, J., Watt, I., 2009. Emotional intelligence and perceived stress in healthcare students: a multi-institutional, multi-professional survey. BMC Medical Education 9(61) 1-8. 7. Cengiz, E., Acuner, T., Baki, B., 2006. Liderlerin sahip oldukları duygusal zekanın örgütsel yaratıcılık üzerine etkileri: bir model önerisi. Atatürk Üniversitesi Sosyal Bilimler Enstitüsü Dergisi 7 (1), 421-433. 8. İşmen, E., 2001. Duygusal zeka ve problem çözme. Marmara Üniversitesi Atatürk Eğitim Fakültesi Eğitim Bilimleri Dergisi 13, 111-124. 9. Por, J., Barriball, L., Fitzpatrick, J., Roberts, J., 2011. Emotional intelligence: Its relationship to stress, coping, well-being and professional performance in nursing students. Nurse Education Today doi:10.1016/j.nedt.2010.12.023 (in print). 10. Aslan, Ş., Özata, M., 2008. Duygusal zeka ve tükenmişlik arasındaki ilişkilerin araştırılması: sağlık çalışanları örneği. Erciyes Üniversitesi İktisadi ve İdari Bilimler Fakültesi Dergisi 30, 77-97. 11. Pau, A. K., Croucher, R., Sohanpal, R., Muirhead, V., Seymour, K., 2004. Emotional intelligence and stress coping in dental undergraduates — a qualitative study . British Dental Journal 197 ( 4), 205-209. 12. Akerjordet, K., Severinsson, E., 2010. The state of the science of emotional intelligence related to nursing leadership: an integrative review. Journal of Nursing Management 18 (4), 363–382. 13. George, J. M., 2000. Emotions and leadership: The role of emotional intelligence. Human Relations 53, 1027-1055. 14. Palmer, B., Walls, M., Burgress, Z., Stough, C., 2001. Emotional intelligence and effective leadership. Leadership & Organization Development Journal 22(1),5-10.
15. Sivanathan, N., Fekken, G. C., 2002. Emotional ıntelligence, moral reasoning and transformational leadership. Leadership & Organizational Development Journal 23(4), 198-204. 16. Cadman, C., Brewer, J., 2001. Emotional intelligence: a vital prerequisite for recruitment in nursing. Journal of Nursing Management 9(6), 321324. 17. Kuşaklı, Y.B., 2008. Yönetici hemşirelerin duygusal zekâ yetenekleri ve liderlik davranışları. Marmara Üniversitesi Sağlık Bilimleri Enstitüsü Yüksek lisans tezi, İstanbul. 18. Şahinkaya, B., 2006. Yöneticilikte ve liderlikte duygusal zeka. Balıkesir Üniversitesi Fen Bilimleri Enstitüsü Yüksek Lisans Tezi, Balıkesir. 19. Çakar, U., Arbak, Y., 2003. Dönüşümcü liderlik duygusal zekâ gerektirir mi? yöneticiler üzerinde örnek bir çalışma. Dokuz Eylül Üniversitesi İktisadi ve İdari Bilimler Fakültesi Dergisi 18(2), 83- 98. 20. Yiğit, R., 2002. İyi bir lider olmanın yolları, Cumhuriyet Üniversitesi Hemşirelik Yüksekokulu Dergisi 6(1), 17-21. 21. Gardner, L., Stough, C., 2002. Examining the relationship between leadership and emotional ıntelligence ın senior level managers. Leadership & Organization Development Journal 23(2), 6878. 22. Duygulu, S., Hiçdurmaz, D., Akyar, I., 2011. Nursing students’ leadership and emotional intelligence in Turkey. Journal of Nursing Education 50 (5), 281-285. 23. Morand, D. A., 2001. The Emotional intelligence of managers: assessing the construct validity of a nonverbal measure of people skills. Journal of Business and Psychology 16(1), 21-33. 24. Gürsoy, A., 2005. Liderlikte duygusal zeka (Liderlik özellikleri ile duygusal zekalı liderlere ulaşılması) Türk Silahlı Kuvvetlerinde örnek bir uygulama. Celal Bayar Üniversitesi Sosyal Bilimler Enstitüsü Yüksek Lisans Tezi, Manisa. 25. Ay, A.F., 2011. Mesleki Temel Kavramlar. Sağlık Uygulamalarında Temel Kavramlar ve Beceriler. Nobel Tıp Kitapevi, İstanbul. 26. Kuzu, A., 2008. Hemşirelik öğrencilerin duygusal zeka ve iletişim becerilerin eş değer olarak öğrenim gören öğrencilerle karşılaştırılmalı olarak değerlendirilmesi. Düzce Üniversitesi Sağlık Bilimleri Enstitüsü Yüksek Lisans Tezi, Düzce. 27. Milutinovic, D., Brestovacki, B., Martinov-Cvejin, M.,2009. Patients` satisfaction with nursing care as an indicator of quality of hospital service. HealthMED 3 ( 4), 412-419.
Journal of Society for development in new net environment in B&H
2103
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
28. Akerjordet, K., Severinsson, E., 2007. Emotional intelligence: a review of the literature with specific focus on empirical and epistemological perspectives. Journal of Clinical Nursing 16 (8), 1405–1416. 29. McQueen, A. C. H., 2004. Emotional intelligence in nursing work. Journal of Advanced Nursing 47(1),101–108. 30. Smith, K. B., Profetto-McGrath, J., Cummings, G. G., 2009. Emotional intelligence and nursing: An integrative literature review. International Journal of Nursing Studies 46 (12), 1624–1636. 31. Terzioğlu, F., Taşkın, L., 2008. Kadının toplumsal cinsiyet rolünün liderlik davranışlarına ve hemşirelik mesleğine yansımaları. Cumhuriyet Üniversitesi Hemşirelik Yüksekokulu Dergisi 12(2), 62-67. 32. Durukan, İ., Yüksel, D., Basmacı, Ö., 2007. Üniversite öğrencilerinin toplumsal cinsiyet rolleri ile ilgili bilgi ve görüşleri. 6. Ulusal (Uluslar arası Katılımlı) Hemşirelik Öğrencileri Kongresi Bildiri Özet Kitabı. p: 170. 33. Ünsal, A., Akalın, İ., Yılmaz, V., 2010. Farklı meslek çalışanlarının erkek hemşirelere ilişkin görüşleri. Uluslararası İnsan Bilimleri Dergisi 7(1), 420-431. 34. Arıkan, D., Karaman, Z., Yağcı, G., 2000. Hemşirelik yüksekokulu öğrencilerinin eğitimde ve mesleki alanda erkek hemşire adaylara bakış açısı. Atatürk Üniversitesi Hemşirelik Yüksekokulu Dergisi 3(1), 36-43. 35. Gözcü, E., Taşkın, M., Bulurel, C., Öğünç, A. E., Karabulutlu, Ö., 2011. Öğrenciler, hastalar, hemşireler ve hekimler erkek hemşireler hakkında ne düşünüyor? 10. Ulusal (Uluslar arası Katılımlı) Hemşirelik Öğrencileri Kongresi Bildiri Kitabı, p:105. 36. Kocaer, Ü., Öztop, T., Usta, N., Gökçek, D., Bahçecik, N., Öztürk, H., Paslı, E., 2004. Hemşirelik mesleğinde erkek üyelerin yeri. Atatürk Üniversitesi Hemşirelik Yüksekokulu Dergisi 7 (2), 23-29. 37. Koç, Z., Bal, C., Sağlam, Z., 2010. Kız hemşirelik öğrencilerinin erkek hemşirelik öğrencilerine bakışı. Maltepe Üniversitesi Hemşirelik Bilim ve Sanatı Dergisi Sempozyum Özel Sayısı, 330- 334. 38. Sohbet, R., Pilatin, D., Karasu, H., Özcan, M., 2011. Hastanede çalışan bayan hemşirelerin erkek hemşirelere bakışı. 10. Ulusal (Uluslar arası Katılımlı) Hemşirelik Öğrencileri Kongresi Bildiri Kitabı, p:432. 39. Toparlak, E., Kaçan, F., Yüce, A., Okan, F., 2011. Kız öğrencilerin erkek hemşirelerle ilgili görüşlerinin incelenmesi. 10. Ulusal (Uluslar arası Katılımlı) Hemşirelik Öğrencileri Kongresi Bildiri Kitabı, p:271.
40. Pullen, M.L., 2003. Developing clinical leadership skill in student nurses, Nurse Education Today 23 (1), 34-39. 41. Ergin, E.F., 2000. Üniversite öğrencilerinin sahip oldukları duygusal zeka düzeyi ile 16 kişilik özelliği arasındaki ilişki üzerine bir araştırma. Selçuk Üniversitesi Sosyal Bilimler Enstitüsü Yüksek Lisans Tezi, Konya. 42. Ergun, T., 1981. Türk Kamu Yönetiminde Önderlik Davranışları. T.O.D.A.İ.E. Yayınları (191). Ankara. 43. Avşar, G., Kaşıkçı, M., 2010. Hemşirelik yüksekokulu öğrencilerinde duygusal zeka düzeyi. Anadolu Hemşirelik ve Sağlık Bilimleri Dergisi 13( 1),1-6. 44. Kaya, H., Keçeci, A., 2004. Bir hemşirelik yüksekokulu öğrencilerinin duygusal zeka düzeyleri. Hemşirelik Dergisi 13(52), 38-47. 45. Ünsar, S., Fındık, Ü. Y., Sadırlı, S. K., Erol, Ö., Ünsar, S., 2009. Edirne Sağlık Yüksekokulu öğrencilerinin duygusal zeka düzeyleri. Üniversite ve Toplum 9, 1-9. 46. Tsaousis, I., Nikolaou, I., 2005. Exploring the relationship of emotional intelligence with physical and pschological health functioning. Stres and Health 21, 77-86. 47. Fatt, J.P.T., Howe, I.C.K., 2003. Emotioanl intelligence of foreign and local university students in Singapore: Implacations for managers. Journal of Business and Psychology 17(3), 345-367. 48. Durmuş, A., E., 2001. Kadın ve erkek yöneticilerin liderlik davranışları arasındaki farklılıklar: Türkiye’de seçilmiş bir grup yönetici üzerine bir araştırma. Akdeniz Üniversitesi Sosyal Bilimler Enstitüsü Yüksek Lisans Tezi Antalya. 49. Bahçecik, N., Ergün, Y., Kelez, A., Uludoğan. S., Kuşaklı, S.Y., 2006. Determining the leadership tendency of the student at Marmara University School of Nursing and the factors which affect this. III. International Nursing Management Conference Abstract Book. p:68. Corresponding author Serap Altuntas, Nursing Management Department, Faculty of Health Sciences, Ataturk University, Turkey, E-mail: serap342002@yahoo.com
2104
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Semiquantitative radiological and clinical assessment of the restoration of alveolar bone defects treated with biphasic calcium phosphate/poly-dllactide-co glycolide composite
Dragan Petrovic1, Zorica Ajdukovic2, Sladjana Petrovic3, Nenad Ignjatovic4, Stevo Najman5, Ivica Vuckovic6
1 2 3 4
5 6
University of Niš, Faculty of Medicine, Clinic of Stomatology, Department of Maxillofacial Surgery, Serbia, University of Niš, Faculty of Medicine, Clinic of Stomatology, Department of Prosthodontics, Serbia, University of Niš, Faculty of Medicine, Institute of Radiology, Serbia, Institute of Technical Sciences and Arts, Centre for Fine Particles Processing and Nanotechnologies, Belgrade, Serbia, University of Nis, Faculty of Medicine, Serbia, Clinic of Stomatology, Department of Maxillofacial Surgery, Serbia.
Abstract Purpose: In order to prevent resorption and collapse of the inner walls of the alveolar bone after the removal of cystic processes and to accelerate regeneration, rehabilitation, and creation of new bone tissue at the site of the enucleated process, biphasic calcium phosphate/poly-DL-lactide-coglycolide composite was utilized. Material and methods. The granules of calcium phosphate/DLPLG sterilized with x-rays and mixed with physiologic solution were implanted into the alveolar bone defects created by cystectomy. Enucleation of 60 cystic alveolar bone defects was performed in 60 patients aged 42-66 years. After enucleation of cystic defects of alveolar bone, in 30 patients BCP/PLGA composite was implanted into the defects, while in the remaining 30 cases, alveolar bone defects after cystectomy were left to heal spontaneously, without any implantation (biocomposite vs control group). Radiological methods were used to assess regeneration and reparation of the restored defects, while clinical assessment of healing was done based on the condition of the regenerated tissue. Results. The results of clinical assessment indicated good flap closure and well formed regenerated tissue without central soft tissue depressi-
on after the removal of cystic processes and BCP/ PLGA implantation into the osseous defects. While the results of radiological assessment indicated the presence of complete trabecular composition and increased alveolar bone density after BCP/PLGA implantation compared to poor trabecular composition and lower alveolar bone density in controls. Conclusion. The study indicated that the above composite accelerated regeneration and rehabilitation of the alveolar bone, and creation of new bone tissue at the site of enucleated cystic process, and, thanks to its osteocunductive effect, can completely replace and renew lost alveolar bone. Synthetic BCP/PLGA composite belongs to the group of biomaterials able to facilitate and accelerate healing of the soft tissue without central depression. Key words: BCP/PLGA composite, bony restoration, alveolar bone defects Introduction Alveolar bone can be viewed as the collection of all its anatomical, structural, and functional properties – the necessary elements for its proper functioning. The removal of any cystic and periapical processes involves not only the diturbance of functional properties of the jaw segment, but it 2105
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
also initiates the mechanism of reorganization of all the supporting structures (connective elements and alveolar bone) (1, 2) After the removal of the above pathologic processes, bone tissue regeneration mechanisms are activated, starting from the bottom of the alveolar defect, continuing to the top of the alveolar ridge. The presence of connective tissue in the portion closest to the bone defect can introduce a competition in regeneration dynamics, which facilitates the withdrawal of connective tissue towards the inner portion of the defect. The phenomenon is more pronounced in thew presence of cystic processes. Several studies have confirmed bone resorption of 4.0-4.5 mm after tooth extraction and removal of cystic and periapical processes, which presents a huge problem for implant placement, especially in the frontal region where alveolar bone morphology and size are very limited (3). Numerous materials and techniques have been used to prevent resorption and collapse of the inner alveolar bone walls. Autologous bone has been considered as an ideal material due to its osteogenetic ability and minimal immune reaction. Before the process of resorption and bone implant revascularization, osteoprogenitor cells differentiate into osteogenetic ones (4). Heterogenous is the second utilized bone implant type. It can be found in different forms as a cortical bone, demineralized, or heterogenous non-demineralized bone. Limitations related to the use of heterogenous bone lie in the potential of transferring viral infections (although the material is sterile), as well as in a difficult implant resorption, so that they can serve as membranes for osteoconductivity (5). Various experimental and clinical experiences have confirmed the potential of calcium sulphate as a bone implant which is non-toxic, completely resorbable, biocompatible, non-infectious (6, 7). Recently, tricalcium phosphate has been increasingly used to restore bone tissue defects after the removal of osseous pathologic processes (8, 9). Polymers have an important place in the resolution of problems of alveolar bone resorption (10). In some clinical studies replacement of alveolar bone during distraction osteogenesis has been observed using morphofunctional analyses (11). In advanced alveolar bone resorption within systemic osteoporosis, excellent results have been achieved using biostimulative biocomposites (12). 2106
The most important property of biphasic calcium phosphate is its chemical similarity to mineralized phase of the bone. Polymers are very important substrates for distribution of bioactive molecules. Synthetic BCP/PLGA composite belongs to the group of biomaterials which facilitate new bone formation (12, 13), and, thanks to its osteoconductive effect, is able to successfully replace bone tissue (13). Since BCP/PLGA has been shown to be an excellent osteoconductive biomaterial in the processes of osteoreconstruction, the composite has been evaluated in clinical studies. The aim of these researches was radiological and clinical assessment of the outcomes of treatment for alveolar defects created after enucleation of cystic processes resored with BCP/PLGA composite. We assessed the impact of use of BCP/ PLGA composite in the healing of soft tissues and replacement of lost bone tissue after the removal of cystic alveolar bone processes in our patients. The success of intervention was assessed analyzing the clinical and radiological criteria. Clinical criteria involved the observation of presence or absence of central depression and soft tissue in the defect center, as well as the presence of complete flap closure with formed strengthened tissue. Radiological assessment involved the analysis of orthopantomograms, spotting the presence or absence of radiotransparency in the treated region, as well as the measurement of density of bone structures with multidetector CT and creation of the new bone. Material and methods The clinical study of use of biocomposite materials in dentistry patients was approved by the Ethics Committee of the Dentistry Clinic in Niš on 21.10.2005. A calcium phosphate gel was produced by the precipitation of calcium nitrate and ammonium phosphate in an alkaline medium (14, 15). Gels or granules of calcium phosphate were added into completely dissolved polymer. After solvent evaporation, the particles were dried at the room temperature for 24 hours (12, 13). Addition of non-dissolvent (methanol) into the 3-component system of solvent-polymer-calciumphosphate ca-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
uses its thermodynamic destabilisation. This induces sedimentation of polymer onto the calcium phosphate granules and their covering by polymer. The granules of calcium phosphate/DLPLG composite biomaterial of sizes 150-250 μm, were sterilized by x- rays (25kGy) before use. The study enrolled patients aged 42 to 66 years. Enucleation of 60 cystic defects of the alveolar bone was done in 60 cases. In 30 cases, BCP/ PLGA composite was implanted into the defect resulting from the enucleation of cystic defects (experimental group – I). In the other 30 patients the defects were left to heal spontaneously without biocomposite implants (control group – II). Out of 30 cystic defects in group I, 15 were situated in the upper jaw and 15 in the lower jaw alveolar bone. In controls, 15 defects were similarly situated in the upper jaw and 15 in the lower jaw alveolar bone. Diagnosis and classification of cysts was done based on orthopantomograms taken on the Rotograph Plus machine (Villa Sistemi Medicali, MR 05, CEI-Bologna, Italy). Over each of the tomograms, a transparent termostable foil for graphoscope was placed, with a printed 2 x 2 mm grid. Cyst borders were marked on the foil, and then measured. Bone structure densities (measured in HU) after cystectomy were obtained by native scanning of the mandibles, with density measurement with multidetector CT machine Aqullion 64 CFX Toshiba. Scanning was done at 120 kV and 300 mA scan-gantry-rotation time 0.5, and helical pitch 53, with slide thickness of 3 mm. The analysis of scans was done in MPR reconstructions on a 512 x 512 matrix. After clinical, radiological examination, diagnosis, and preoperative preparation of patients for local anesthesia (2% cystocain, ICN Galenika, Belgrade), surgical cyst enucleation was performed. The access incision remained on the bone support and not on the implant, at a distance from the bone defect. A high fornical incision through the movable mucosa was most commonly employed. After detection, the cystic saccus was enucleated in its entirety. Hemostasis was effectuated as usual: diathermy, striking the bone with the blunt part of the chisel. Sharp bone edges were flattened. Smooth walls of the cystic defect were perforated in several spots with a sterile drill.
BCP/PLGA composite granules were mixed with physiologic solution and introduced with an appropriate instrument, and then compressed to the defect walls to fill up the defect completely (without „dead spots“). After the implant introduction, the flap was returned and the wound closed using individual dense sutures. Cystic processes sized on the average 5-10 cm2 were monitored. Depending on the sites of cystic processes, three regions were analyzed: frontal (F), premolar region (P), and molar (M) region. Five positions were observed in the study (one in the defect center, two on the left and two on the right defect side) and analyzed based on clinical and radiological criteria (8, 16). Clinical assessment criteria: - Presence of central opening, - Flap closure and soft tissue presence in the center, - Flap closure with central depression and irregular edges, - Complete soft tissue restoration, without any invagination, with total flap closure, and presence of well formed, augmented tissue. Radiological assessment criteria: - Radiotransparency in the treated zone, - Absence of radiotransparency and restoration of the trabecular structure, - Complete trabecular bone structure, - Evaluation of density of bone structures. Results Figure 1a presents a cyst in the molar region of the alveolar mandibular bone in group (I). Figure 1b illustrates the defect after the removal of a cystic process of the alveolar mandibular bone in group (I) filled with BCP/PLGA composite. Figure 1c depicts intense osteogenesis of the molar region of the alveolar mandibular bone in group (I) 12 weeks after cyst enucleation and BCP/PLGA composite implantation – new trabecular bone is formed, very similar to the tissue of the untreated, healthy bone.
Journal of Society for development in new net environment in B&H
2107
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Figure 1a. A cyst in the molar mandibular region
Figure 2a. A cyst in the frontal mandibular region
Figure 1b. Cyst enucleation and BCP/PLGA implantation into the defect
Figure 2b. Cyst enucleation without BCP/PLGA implantation
Figure 1c. Presence of the trabecular structure 12 weeks after BCP/PLGA implantation Figure 2a presents a cyst in the frontal portion of the mandibular alveolar bone in group (II). Figure 2b presents a defect of the mandibular alveolar bone in group (II) as the result of enucleation of a cystic process, left to heal spontaneously, without BCP/PLGA implantation. Figures 2c1 (the image with a measurement grid and measurement fields, described in the Material and Methods) and 2c2 (same as the previous one, but without measurement details), 12 weeks after cystectomy, present a scarce and hardly conspicuous trabecular structure of the alveolar bone of the mandible (II). Osteogenesis is weak, with still visible defect contours in the alveolar bone of the mandible in the control group.
Figure 2c1. Spontaneous healing of the cystic defect with scarce trabecular structure (image with a measurement grid and measurement fields)
Figure 2c2. Spontaneous healing of the cystic defect with scarce trabecular structure (image without any measurement grid and without measurement fields) Figure 3a presents control, native MSCT scan (axial section) of the defect resulting after the re-
2108
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
moval of a cystic process of the molar region of mandibular alveolar bone in group (I), 6 weeks after cyst enucleation and BCP/PGLA composite implantation. Trabecular structure of the alveolar bone was present, with the focus of intense osteogenesis. Figure 3b depicts control, native MSCT scan of the mandible (axial section), with intense osteogenesis of the molar region of alveolar bone in group (I) 12 weeks after BCP/PLGA composite implantation, where new trabecular bone similar to the tissue of untreated, healthy bone was present, with partly more intense structure similar to the mandibular cortex. Figure 3c is a VR 3D reconstruction of the mandible 12 weeks after BCP/PLGA composite implantation, where the contour of the mandible did not reveal the presence of defect.
Figure 3c. 3D volume rendering – reconstruction of the facial bone structure and mandible 12 weeks after biocomposite implantation Clinical healing criteria 12 weeks after BCP/ PLGA composite implantation are shown in Tables 1 and 2. The criteria from Table 1 indicated complete soft tissue restoration (4 sites in the frontal, 3 sites in premolar, and 3 sites in molar maxillary region), without invagination and with total flap closure and presence of well formed augmented tissue in 10 treated cystic defects of the maxilla (66.7%) out of 15 treated overall. Only in 5 treated cystic defects (33.3%) out of 15 treated (1 site in the frontal, 2 sites in premolar, and 2 sites in molar maxillary region) there was flap closure with central depression and irregular edges in group (I). In controls – group (II) – in 9 out of 15 treated cystic defects of the maxilla (60%) there was flap closure with soft tissue in the center (3 sites in the frontal, 3 in premolar, and 3 in molar region of the maxilla). In 6 cystic defects of the maxilla (40%) out of 15 treated (2 sites in the frontal, 2 sites in premolar, and 2 sites in molar maxillary region) there was central soft tissue depression with irregular edges during flap closure. Clinical healing criteria in Table 2 indicated complete soft tissue restoration (3 sites in the frontal, 4 sites in premolar, and 4 sites in molar region) without invagination and with total flap closure and presence of well formed augmented tissue in 11 treated cystic defects of the mandible (73.4%) out of 15 treated in total. In only 4 treated cystic defects (26.6%) out of 15 (2 sites in the frontal, 1 site in premolar, and 1 site in molar mandibular region) there was flap closure with central depression and irregular edges in group (I). In controls – group (II) 2109
Figure 3a. Axial native mandibular scan 6 weeks after biocomposite implantation
Figure 3b. Axial native mandibular scan 12 weeks after biocomposite implantation
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
– in 9 out of 15 treated cystic defects (60.0%) of the mandible, there was flap closure with soft tissue presence in the center (3 sites in the frontal, 3 sites in premolar, and 3 sites in molar mandibular region). In 6 cystic defects of the mandible (40%) out of 15 treated in total (2 sites in the frontal, 2 sites in premolar, and 2 sites in molar mandibular region) there was central soft tissue depression with irregular edges during flap closure. The results of clinical assessment indicated that BCP/PLGA composite 12 weeks after intervention led to more rapid consolidation and complete regeneration of soft tissues, effective wound healing,
and total flap closure, with the presence of well formed, augmented tissue. Insufficient tissue tropism was almost nonexistent in the defects treated with BCP/PLGA composite in experimental group (I). The results of clinical assessment in controls (II), where the alveolar defects of the maxilla and mandible were left to heal spontaneously, indicated slower flap closure, with central depression and soft tissue in the center with irregular edges. Tables 3 and 4 present radiological assessment criteria for alveolar defect healing after enucleation of cystic processes in experimental (I) and control group (II). Radiological assessment criteria
Table 1. Results of the clinical assessment criteria for the alveolar defects of the maxilla 12 weeks after cyst enucleation.
Experimental group (I) Maxilla 15 4d 1c 3d 2c 3d 2c 66.7 33.3 Control group (II) Maxilla 15 3b 2c 3b 2c 3b 2c 60.0 40.0
Note. a – Presence of central opening; b – Flap closure and presence of central soft tissue; c – Flap closure with central depression and irregular edges; d – Complete soft tissue restoration without invagination, with total flap closure and presence of well formed augmented tissue.
Number of defects Frontal region (F) Premolar region (P) Molar region (M) Clinical criteria in %
Table 2. Results of the clinical assessment criteria for the alveolar defects of the mandible 12 weeks after cyst enucleation.
Experimental group (I) Mandible 15 3d 2c 4d 1c 4d 1c 73.4 26.6 Control group (II) Mandible 15 3b 2c 3b 2c 3b 2c 60.0 40.0
Note. a – Presence of central opening; b – Flap closure and presence of central soft tissue; c – Flap closure with central depression and irregular edges; d – Complete soft tissue restoration without invagination, with total flap closure and presence of well formed augmented tissue.
Number of defects Frontal region (F) Premolar region (P) Molar region (M) Clinical criteria in %
Table 3. Results of radiologic criteria for the assessment of healing of alveolar defects of the maxilla
Experimental group (I) Mandible 15 4C 1B 4C 1B 4C 1B 80.0 20.0 Control group (II) Mandible 15 3A 2B 4A 1B 2A 3B 60.0 40.0
Note. A – Presence of radiotransparency; B – Absence of radiotransparency and restoration of trabecular structure; C – Complete trabecular structure of the bone.
Number of defects Frontal region (F) Premolar region (P) Molar region (M) Radiologic criteria in %
2110
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
for healing 12 weeks after BCP/PLGA composite implantation (Table 3) indicated that 12 bone defects of the maxilla (80.0%) out of 15 treated in total in group (I) showed complete restoration of trabecular bone structure (4 sites in the frontal, 4 sites in premolar, and 4 sites in molar region of the maxilla). In only 3 defects of the maxilla (20.0%) out of 15 treated with BCP/PLGA showed the absence of radiotransparency, with slow restoration of trabecular structure (1 site in the frontal, 1 in premolar, and 1 in molar region of the maxilla). In 9 bone defects in group (II) (60.0%) out of 15 treated in total, radiotransparency in the treated zone could be seen 12 weeks after cystectomy (3 sites in the frontal, 4 sites in premolar, and 2 sites in molar region of the maxilla). In 6 bone defects of the maxilla (2 sites in the frontal, 1 site in premolar, and 3 sites in molar region of the maxilla) in control group (II) (40.0%) out of 15 treated in total, there was no radiotransparency, with conspicuous scarce restoration of trabecular structure. Radiological criteria for the assessment of healing 12 weeks after BCP/PLGA composite implantation (Table 4) indicated that 14 bone defects of the mandible (93.4%) out of 15 treated with BCP/PLGA in group (I) showed complete restoration of trabecular bone structure (5 sites in the frontal, 5 sites in premolar, and 4 sites in molar region of the mandible). In only 1 defect (6.6%) out of 15 treated with BCP/PLGA composite, radiotransparency was absent, with slow restoration of trabecular structure (1 site in the molar region of the mandible). In 8 bone defects in group (II) (53.4%) out of 15 treated in total, 12 weeks after cystectomy there was radiotransparency with scarce signs of bone trabeculae (3 sites in the frontal, 3 sites in premolar, and 2 sites in molar region
of the mandible). Only 7 bone defects (2 sites in the frontal, 2 sites in premolar, and 3 sites in molar region of the mandible) in control group (II) (46.6%) out of 15 treated in total, did not show radiotransparency, with slow and scarce restoration of trabecular structure. Radiological assessment, compared to clinical, showed that the sites after cystectomy and BCP/ PLGA implantation showed optimal clinical results, as confirmed by the x-rays showing complete trabecular structure of the bone in 93.4% of group (I) patients, in contrast to the sites left untreated with BCP/PLGA composite – group (II) – where in some spots radiotransparency was still conspicuous, and in other spots the presence of bone trabeculae was scarce and poorly visible, with marked absence of radiotransparency. Twelve weeks after cyst enucleation and BCP/PLGA implantation, trabecular bone was more mature and present in higher percentage, indicating intense osteogenesis and creation of new bone tissue, very similar to the tissue of untreated, healthy bone. Radiological assessment of density of bone tissue of defects in the maxilla and mandible 12 weeks after cyst enucleation is presented in Tables 5 and 6, indicating better bone density results for those treated with BCP/PLGA composite implantation for both maxilla and mandibula. Discussion After enucleation of cystic processes, bone resorption poses a huge problem (1), especially in the frontal region, where morphology and size of the alveolar bone are especially limited, and in the regions of premolars and molars, where the hi-
Table 4. Results of radiologic criteria for the assessment of healing of alveolar defects of the mandible 12 weeks after cyst enucleation
Experimental group (I) Mandible 15 5C 0 5C 0 4C 1B 93.4 6.6 Control group (II) Mandible 15 3A 2B 3A 2B 2A 3B 53.4 46.6
Note. A – Presence of radiotransparency in the treated zone; B – Absence of radiotransparency and restoration of trabecular structure; C – Complete trabecular structure of the bone
Journal of Society for development in new net environment in B&H
Number of defects Frontal region (F) Premolar region (P) Molar region (M) Radiologic criteria in %
2111
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 5. Results of radiologic criteria for the assessment of density of bone structure of maxillary defects 12 weeks after cyst enucleation
Experimental group (I) Maxilla 15 973 a 1314 b 1593 c Control group (II) Maxilla 15 880 a 1094 b 1307 c
Note. a – Density of frontal region of the maxilla increased by 10.57% in experimental group (I) compared to controls (II); b – Density of premolar region of the maxilla increased by 20.11% in experimental group (I) compared to controls (II); c – Density of molar region of the maxilla increased by 21.88% in experimental group (I) compared to controls (II);
Number of defects Frontal region (F) Premolar region (P) Molar region (M) Density assessment in %
Table 6. Results of radiologic criteria for the assessment of density of bone structure of mandibular defects 12 weeks after cyst enucleation
Experimental group (I) Maxilla 15 984 a 1324 b 1714 c Control group (II) Maxilla 15 886 a 1029 b 1329 c
Note. a – Density of frontal region of the mandible increased by 11.06% in experimental group (I) compared to controls (II); b – Density of premolar region of the mandible increased by 28.67% in experimental group (I) compared to controls (II); c – Density of molar region of the mandible increased by 28.97% in experimental group (I) compared to controls (II);
Number of defects Frontal region (F) Premolar region (P) Molar region (M) Density assessment in %
ghest burden to the alveolar bone is created during mastication. Therefore, cystic defects of the above regions were selected and analyzed. Restoration of normal trabecular bone structure 12 weeks after cystectomy and BCP/PLGA implantation is a significant result, indicating re-establishment of normal morphologic profile of the ridge in a relatively short period of time. Thus implanted, BCP/ PLGA composite prevented bone resorption and invagination of the soft tissues into the defect, in addition to the replacement of bone tissue. Positive results of this study are comparable with other positive results describing the efficacy of BCP/PLGA composite in the treatment of defects in an osteoporosis-weakened alveolar bone (12). The results justify the use of BCP/PLGA composite for successful regeneration of defects of the alveolar bone after cystectomy. Except in the regeneration of alveolar bone defects after cystectomy, some of the positive results have been stressed in other research papers, where BCP/PLGA 2112
has been used to replace alveolar bone damaged by osteoporosis, trauma, periapical processes, and after extraction of impacted teeth (12, 13). After the implantation of a biomaterial into the alveolar defect, the first bone to be formed is trabecular bone, serving as a framework to support subsequent deposition of collagen and lamelar bone. The period of 6 weeks is too short for us to be able to spot these regeneration processes – the most optimal time is around 12 weeks (that was why we chose that period to monitor osteoregenerative processes) (17). In the treatment of enucleated cystic defects, some authors have used autologous platelet-rich gel concentrate combined with the granules of bovine derivative of hydroxyapatite xenograft, enabling bone regeneration at the cellular level and recuperation of soft tissues in the period of 4 months (16 weeks) (18), while the results of this study indicated that the period of 12 weeks was optimal for the healing of alveolar defects. From the clinical point of view, this period of time was
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
also sufficient to allow for soft tissue healing with the characteristics of an optimal trophism. The cited results corroborated other authors’ results, who, using hydroxyapapite gel and calcium sulphate in the treatment of bone defects in orthopedics, have confirmed biocompatibility of the composite and its capacity to occupy space, preventing defect fillingup with non-osteogenetic cells (19). A significant contribution of BCP/PLGA composite is to induce the creation of new bone and improve healing of bone defects after the enucleation alveolar bone cysts, since it revascularize very quickly, and osteoprogenitor cells differentiate into osteogenetic ones more rapidly than with other biomaterials, reducing thus the number of additional interventions, providing for the creation of new trabecular bone similar to the natural bone tissue, and accelerating osteogenesis and preventing resorption. BCP/PLGA composite implantation into the defects resulting from cystectomy reduces alveolar bone resorption and facilitates re-establishment of normal morphologic profile of the alveolar ridge, in contrast to other materials, which is very important in subsequent prosthesizing of the patient. Conclusion We may draw the conclusion from the presented clinical research that 12 weeks after implantation, BCP/PLGA composite produced complete soft tissue restoration, without invagination, in 21 treated cystic defects of the maxilla and mandible, out of 30 treated patients in total. This showed that BCP/PLGA composite induced complete wound closure, with well formed augmented tissue. Radiological studies after cystectomy and implantation of BCP/PLGA composite confirmed optimal clinical results, pointing out a visible presence of complete trabecular bone structure 12 weeks after implantation. Clinical and radiological results of the study demonstrated the capacity of BCP/ PLGA composite implanted into the defects to support restitutio ad integrum of both the soft tissue and alveolar bone after cystectomy. The study demonstrated that this composite accelerates the rehabilitation of alveolar bone and creation of new bone tissue at the site of enucle-
ated cystic process, and that its osteoconductive effects enable the composite to replace and renew completely the lost alveolar bone. Acknowledgements This study was supported by the Ministry of Science and Technological Development of the Republic of Serbia, Projects No: III45004 and 41018. References
1. Klemetti E. A review of residual ridge resorption and bone density. J Prosthet Dent, 1996; 75:512. 2. McIntyre PJ, Shackelford FJ, Chapman WM, Pool RR. Characterization of a bioceramic composite for repair of large bone defects. Ceramic Bulletin, 1991; 70:1499 3. Lekovic V, Camargo PM, Weinlaender M,Vasilic N, Kenney EB. Comparison of platelet-rich plasma, bovine porous bone mineral and guided tissue regeneration versus platelet-rich plasma and bovine porous bone mineral in the treatment of intrabony defects: A reentry study. J Periodontol, 2002; 73:198 4. Cornell CN, Lane JM, Chapman M, Merkow R, Seligson D, Henry S, Gustilo R, Vincent K. Multicenter trial of Collagraft as bone graft substitute. J Orthop Trauma 1991; 5:1 5. Camper Y. Bone grafts and bone substitute. Orthop Net News 1995; 6(4):7 6. De Leonardis D, Pecora GE. Prospective study on the augmentation of the maxillary sinus with calcium sulfate. Histological results. J Periodontol 2000; 71:940 7. Guarnieri R, Bovi M. Maxillary sinus augmentation using pre-hardened calcium sulfate. A case report. Int J Periodont Rest 2002; 22:503 8. Mankani HM, Kuznetsov AS, Avila AN, Kingman A, Robey GP. Bone formation in transplants of human bone marrow stromal cells and hydroxyapatite-tricalcium phosphate: Prediction with quantitative CT in mice. Radiology 2004; 230(2):369
Journal of Society for development in new net environment in B&H
2113
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
9. Zerbo IR, Bronckers AL, de Lange GL, Burger EH, van Beek GJ. Histology of human alveolar bone regeneration with a porous tricalcium phosphate: A report of two cases. Clin Oral Impl Res 2001; 12:379. 10. Heidemann W, Jeschkeit S, Ruffieux K, Fischer JH, Wagner M, Krüger G, Wintermantel E, Gerlach KL. Degradation of poly(D,L)lactide implants with or without addition of calciumphosphates in vivo. Biomaterials 2001; 22:2371. 11. Zaffe D, Bertoldi C, Palumbo C, Consolo U. Morphofunctional and clinical study on mandibular alveolar distraction osteogenesis. Clin Oral Impl Res 2002; 13:550. 12. Ignjatovic N, Ajdukovic Z, Uskokovic D. New biocomposite calciumphosphate/poly-DL-lactide-coglycolide/biostimulatite agens filler. J of Materials Science: Materials in Medicine 2005; 16:621. 13. Ignjatovic N, Ninkov P, Ajdukovic Z, Konstantinovic V, Uskokovic D. Biphasic calcium phosphate/poly-(DL-lactide-co-glycolide) biocomposite as filler and blocks for reparation of bone tissue. Materials Science Forum 2005; 494:519. 14. Ignjatovic N, Tomic S, Dakic M, Miljkovic M, Plavšic M, Uskokovic D. Synthesis and properties of hydroxyapatite/poly-L-lactide composite biomaterials. Biomaterials 1999; 20:809. 15. Ignjatovic N, Plavšic M, Miljkovic M, Živkovic Lj, Uskokovic D. Microstructural characteristic of Ca-hydroxyapatite/poly-L-lactide based composites. J Microsc 1999; 196:243. 16. Boutry N, Cortet B, Dubois P, Marchandise X, Cotten A. Trabecular bone structure of hte calcaneus: preliminary in vivo MR imaging assessment in men with osteoporosis. Radiology 2003; 227(3):708. 17. Watzek G. Implants in Qualitatively Compromised Bone. Germany: Quintessence Publishing Co, Ltd, Kathryn O’Malley, 2004; p9. 18. Belli E, Longo B, Balestra FM. Autogenous platelet-rich plasma in combination with bovine-derived hydroxyapatite xenograft for treatment of a cystic lesion of the jaw. J Craniofac Surg 2005; 16(6):978.
19. Parsons JR, Ricci JL, Alexander HW, Bajpai PK. Osteoconductive composite grouts for orthopedic use. Ann NY Acad Sci 1988; 523:190. Corresponding author Dragan M. Petrovic, University of Nis, Faculty of Medicine, Clinic of Stomatology, Department of Maxillofacial Surgery, Serbia, E-mail: dragan-petrovic@hotmail.com
2114
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Exposıng sıtuatıons mobbıng of the nurses ın Turkey
Zümrüt Akgün Şahin1, Funda Kardaş Özdemir2, Sevinç Köse3
1 2 3
Faculty of Health Sciences, Ataturk University, Erzurum, Turkey, Kars School of Health, Kafkas University, Kars, Turkey, School of Health, Erzincan University, Turkey.
Abstract Introduction: Mobbing is an uncomforting and unsettling behavior experienced among the health staff in work place for a while. The hospitals are accepted as an environment where emotional annoyance events are experienced at ineligible rates. The nurses have been exposed to mobbing at advanced level for the reasons such as intense and bad working conditions, impossibilities, bouts, insufficient wages and salaries particularly in state organizations, academic career and injustice about promotion. Methods: This research was carried out as descriptively with the aim of determining the exposing situations to mobbing of the nurses working in Erzincan State Hospital in Turkey. The context of the study consisted of 120 nurses working in the hospital at the dates October-December 2008. The choice of the sampling was not applied and 94 nurses accepting to participate in the study and working at that date were included in the study. The data were collected by means of nurse’s introductory form and mobbing behaviors scale. Parametric and non-parametric tests were used in statistical analysis of the data. Results: It was determined that age averages of the nurses agreeing to participate in the research was 31.04±4.45, and 73.4 % of them in 26-35 age group, %41.5 of the nurses was the associate’s degree, 78.7 % of them was married and 30.4% of have children. It was found that there was statistically significant distinction among education level in the nurses and professional working year, the department worked and mobbing behaviors. Scale scores according to data and type of working (p<0.05).
Conclusion: This situation affecting the nurses should be examined and for administrative support and a better working medium for the nurses, some policies should be put forward and these policies should be taken into effect. Key words: nurse, mobbing, hospital. Introduction Mobbing is an emotional attack. It starts when a person becomes the target of a disrespectful and harmful behavior. It is defined as a ganging up by several voluntary or involuntary individuals against a particular person to force him/her out of the workplace by creating a hostile environment through ill-intended behavior, innuendo, ridicule or discrediting (1). In literature, several definitions have been provided for the concept of mobbing by researchers and labor organizations. Since mobbing is neither a lucid attack nor an apparent violence, the expression of “mobbing in workplace” may occasionally refer to cases without a clear-cut definition. It is essentially difficult to define mobbing, because behaviors of mobbing may range from explicit and disguised attack to cunning and sneaky rumor, and exclusion (2,3). It is observed that cases of mobbing are experienced in health sector to an extent that cannot be ignored. Hospitals are busy and stressful environments and emotion abuse is triggered by several factors, such as demanding working conditions, shifts, impossibilities, as well as insufficient income and inequities in career and promotion especially in public establishments (4). In addition, the number of women employees in hospitals is much higher compared to other professions, and 2115
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
nurses constitute the majority in this group among medical staff. Research findings have demonstrated that nurses are at greater risk in terms of mobbing compared to other health professionals (5). Several studies have been performed on mobbing to which medical staff is exposed. The common point of the findings obtained from studies is that mobbing experiences in health sector is more frequent and less recorded compared to other workplaces. It has been reported that 40% of the medical staff in England are exposed to bullying, and the medical staff in the United States are at greater risk compared to the employees in other service sectors and more than half of these cases of violence occur in the health sector (6). In a study conducted in Australia, it was found that nurses are exposed to mobbing to a greater extent than other medical staff, and the ones who inflict this mobbing are other health personnel, patient relatives, patients, colleagues and head nurses, respectively(7). The results of other researches conducted in the United States (8), Canada (9), Sweden (10), England (11) and Australia (12) show similarities. These results reveal that violence and abuse that nurses are exposed to in workplaces is a common universal problem. When the studies conducted in Turkey are examined, it has been reported in a research performed on nurses working at private and public hospitals in Kayseri that 89.5% of nurses are exposed to some kind of aggressive behavior by patient relatives, managers, doctors and patients (13). In another study carried out in Trabzon, 40% of all nurses were determined to be mobbing victims. 30% and 70% of nurses who are mobbing victims work are university and public hospitals, respectively (14). It has also been determined in a study conducted in Istanbul (15) that 86% of nurses are exposed to one or more mobbing in 12 months, while 21% of nurses are exposed to mobbing as determined in a study carried out in Ankara (16). In our country, researches on this issue have mostly been conducted in western regions. Sufficient data are not available about the rate of exposure to mobbing among nurses in eastern regions. This research was conducted as a descriptive and cross-sectional study for the purpose of determining the exposing situations to mobbing of the nurses who work in healthcare facilities in Eastern Turkey. 2116
Materials and Methods Participants The sample for this research study included a total of 120 registered nurses employed at a state hospital in Erzincan, Turkey. As the whole population was taken as the sample group, no sampling method was applied. The research was completed with 94 nurses, since 9 of the nurses were on leave of absence during the execution of the research and 17 did not volunteer to participate in the study. The ratio of nurses who participated in the study is 78%. Nurses, who worked at various clinics of the hospital and had at least one year professional experience, were included in the research. Data were collected by researchers between October-December 2008. Data Collection Demographic information form and Mobbing Behaviors Scale were used in data collection. Before the application of data collection tools, nurses were informed about the objective of the research and their informed consent was received about their voluntary participation in the research. Nurses who accepted to participate in the research were given the questions and they were asked to complete the form at an agreed time. Approximately 20 minutes were allocated for the completion of each data collection form. Questionnaire The questionnaire was prepared by the researchers in line with the relevant literature and similar studies. The form includes questions about the demographic characteristics of participants (age, marital status, childbearing, education, department employed, position and work condition) (14,15,17,18). Mobbing Behaviors Scale Mobbing Behaviors Scale was developed in 2007 by Dilman (18). The scale includes 38 expressions questioning mobbing behavior. Expressi-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
ons were rated in accordance with Likert scale as (5) always, (4) usually, (3) sometimes, (2) rarely and (1) never. Evaluation of the scale, in which all the items were put in plain expression, was made over total scores. Minimum and maximum scores to be obtained from the scale was 38 and 190, respectively. Inner consistency coefficient and total item correlation of this scale, which consisted of a single factor, were calculated. Accordingly, total item correlation of the scale was observed to range between 0.63 and 0.85. Cronbach alpha reliability coefficient of the scale is 0.97 (18). In this study, Cronbach alpha coefficient of the scale was calculated as 0.89. Statistical Analyses Data obtained from the research were evaluated by the researchers electronically by using Statistical Package for Social Sciences (SPSS) for Windows 11.5 statistics packet program. Data were evaluated by using mean and percentage distribution, Independent sample t-test, Mann-Whitney U test, Kruskal-Wallis variance analysis and Cronbach Alpha coefficient calculation. Ethical Considerations The research aim and method were explained to the hospital where the research was to be conducted and, after approval and permission were obtained from the related facilities, data collection began. When data were collected the nurses received an explanation of the research aim and gave their verbal permission. In addition they were informed that the data would be kept confidential and anonymous. Results Distribution of nurses, who were included in the research, according to their individual characteristics is shown in Table 1. It was determined that the age average of nurses was 31.04±4.45, 78.7% were married, 68.1% had children, and 33.0% were bachelor’s degree.
Table 1. Distribution of Nurses According to Their Individual Characteristics (N:94)
Characteristics Age 25 age and less 26-35 36 age and more Marital status Married Single Child Yes No Educational status High school Associate Bachelor Total Number 12 69 13 74 20 64 30 24 31 39 94 Percentage (%) 12.8 73.4 13.8 78.7 21.3 68.1 31.9 25.5 41.5 33.0 100
Distribution of nurses, who were included in the research, according to their professional characteristics is shown in Table 2. It was determined that average work experience of the nurses was 10.41±5.99 years, 57.4% had 10 years or less work experience, 57.4% worked at medical units, 83.0% were service nurses, 47.9% worked only at night shifts. Table 2. Distribution of Nurses According to Their Professional Characteristics (N:94)
Characteristics Professional experience year 10 years and less 11 years and more Department Surgical units Medical units Position Head nurse Service nurse Manner of work Working only at night shift Working only during daytime Working in shifts Total Number Percentage (%)
54 40 40 54 16 78 45 11 38 94
57.4 42.6 42.6 57.4 17.0 83.0 47.9 11.7 40.4 100
Journal of Society for development in new net environment in B&H
2117
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Discussion When Table 3 is examined, no statistically significant difference is observed between the mobbing behaviors scale scores of nurses according to their age, marital status, and number of children (p>0.05). There is statistically significant difference between the education level and mobbing behaviors scale scores (p<0.05). Table 3. Score Average Distribution of Mobbing Behaviors Scale of Nurses According to Their Individual Characteristics
Variables X±SD P Age 25 age and less 66.66±32.49 KW:5.857 26-35 69.56±40.59 df:2 36 age and more 67.92±5.90 p>0.05 Martial status Married 64.05±16.86 MWU:658.500 Single 67.59±41.07 p>0.05 Child Yes 61.03±17.53 t:1.203 No 68.62±43.48 p>0.05 Educational status 70.46±35.86 KW:4.691 High school Associate 62.25±36.15 df:2 Bachelor 67.45 ±41.56 p<0.05
Table 4. Score Average Distribution of Mobbing Behaviors Scale of Nurses According to Their Professional Characteristics
Variables Professional experience year 10 years and less 11 years and more Department Surgical units Medical units Position Head Nurse Service Nurse Manner of work Working only at night shift Working only during daytime Working in shifts X±SD P
70.55±40.03 60.32±32.75 69.09±42.08 62.30±29.64
t:4.361 p<0.05 t:5.490 p<0.05
65.16±35.31 MWU:116.500 71.98±37.94 p<0.05 63.04±36.11 82.45 ±47.81 65.23±35.10 KW:4.719 df:2 p<0.05
Research findings have demonstrated that the age group between 26-35 years is exposed to mobbing to the greatest extent Çobanoğlu (2005) reports that age factor in mobbing victims differs from country to country, and that employees between 25-30 years of age in our country are exposed to intense pressure of mobbing (4). In a questionnaire study (Kutlu, 2006) conducted through electronic mail about the effects of mobbing in workplace on burnout, 26-32 age group was determined to be exposed to mobbing (17). In the study carried out by Işık (2007) in establishments about mobbing applications and work stress, the individuals in 20-35 age group were determined to have been exposed to mobbing to a greater extent (19). This finding may be associated with the greater number of nurses working in this particular age group. Single nurses without children were found to have been exposed to more mobbing. In various studies conducted to determine the frequency and effects of mobbing behaviors among medical staff, it has been reported that single nurses are exposed to mobbing more frequently (13,14,18,20). It is thought that young, single and childless nurses with little work experience may be exposed to more mobbing by executives in order to increase their abilities, knowledge and skills. Studies have demonstrated that exposure to mobbing decreases with the increase in the level of education (18, 21, 22). Graduating from medical vocational high school at an early age is considered to account for the nurses’ insufficiency to develop professional knowledge and skills. It has been detected that nurses with 10 and less professional experience are exposed to mobbing to a greater extent. This findings show parallelism with the studies of Kutanis & Safran (2003) and Kök (2006) (22,23). Nurses with little professional experience may experience role confusion, being assigned to work at busier units, work stress, lack of self-esteem and sense of uselessness. Nurses working at surgical units were determined to experience more mobbing. Some staffs are confronted with time pressure, intense work load and rush of completing tasks. It is a matter of fact that the pressure of completing tasks in time will create substantial tension in the employees (24, 25). Surgical nurses may be thought to experience more mobbing due to time pressure and heavy work load.
2118
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
It has been determined that service nurses are exposed to more mobbing. Researches reveal that vertical abuse in establishments is experienced to a greater extent compared to horizontal abuse, and imposed mostly by superiors and managers (26,27). It is thought that service nurses are exposed to more mobbing, since they are both responsible for the direct treatment and care of patients and accountable to the head nurse and management. Nurses who work only during daytime were found to experience more mobbing. This finding obtained in our research is also supported by the study conducted by Quine (2001) on mobbing in workplace among nurses working during daytime and the study conducted by Öztunç (2001) on verbal and physical abuse cases experienced by nurses working at hospitals, both of which report that daytime and fulltime nurses are exposed to more mobbing (25,28) The possibility of daytime nurses, who work fulltime at hospitals, to be exposed to mobbing is thought to increase due to the fact that they are in more contact with their colleagues, managers, other health team members, patients and especially patient relatives. Conclusion Nursing is a demanding job with challenging working conditions. Quality of patient care is also put in jeopardy when nurses are affected by mobbing. Mobbing behaviors are not ethical, and especially the managers of nursing services, as well as hospital managers, victim’s family and relatives, all nurses, instructors of nursing schools, nursing organizations and even law makers are responsible for preventing mobbing. More studies should be conducted on this issue affecting nurses, and policies should be developed and action should be taken for improving administrative support and the working environment for nurses. Acknowledgement This research was presented in 1st International Congress on Nursing Education, Research & Practice, 15-17 October 2009, Thessaloniki/GREECE.
References
1. Davenport N, Schwartz RD, Eliot GP. [Mobbing: Workplace Emotional Abuse]. Sistem Yayıncılık, İstanbul, 2003.Turkish 2. Colman J. 22 Attacks NHS Staff Every Day in Wales. Nursing Standard 2005; 3:20. 3. Crawford N. Bullying At Work: A Psychoanalytic Perspective. J Community Appl Soc Psychol 1995;7:219-225. 4. Çobanoğlu S. [Mobbing, Workplace Emotional Attack and Control Methods]. Timas Yayınları, İstanbul, 2005. Turkish 5. Randle J. Bullying in the Nursing Profession. J Adv Nurs 2003; 43;49: 395–401. 6. “New International Guidelines Address Workplace Violence in the Health Sector” Kansas Nurse, Jun/ July 2003. 7. Desley H, Plank A, Parker V. Workplace Violence In Nursing In Queenısland, Australia: A Self Reported Study. Int J Nurs Pract 2003; 9: 261-268 8. Kaye J. Sexual harassment and hostile environments in the perioperative area. AORN Journal, 1996;63(2): 443–449. 9. Rippon T. Aggression and violence in health care professions. J Adv Nurs 2000; 31(2): 452–460. 10. Arnetz J, Arnetz B. Implementation and evaluation of a practical intervention programme for dealing with violence towards health care workers. J Adv Nurs 2000;31 (3): 668–680. 11. McMillan I. Losing control. Nursing Times 1995; 91(15): 40. 12. Sdrinis, J. Countering avaiolence Against Nurses. Aust Nurs J 2005; 13:5. 13. Özdevecioğlu M. [A Study to Determined Effects on Aggressive Behavior in Organizations and Individuals] Uludağ Üniversitesi İktisadi Ve İdari Bilimler Fakültesi Dergisi 2003;22(1):121. Turkish 14. Öztürk H, Yılmaz F, Hindistan S. [Mobbing Scale for Nurses and Mobbing Suffered by Nurses]. Hastane Yönetimi 2007;1(2):11. Turkish
Journal of Society for development in new net environment in B&H
2119
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
15. Yıldırım A, Yıldırım D.Mobbing in the workplace by peers and managers: mobbing experienced by nurses working in healthcare facilities in Turkey and its effect on nurses. J Clin Nurs 2007;16(8):1444-53. 16. Yıldırım D (2009) Bullying among nurses and its effects. Int Nurs rev 2009;56(4):504-11. 17. Kutlu F. [Emotional Workplace Harassment (Mobbing) and The Effect of Burnout]. Dokuz Eylul University, School of Social Sciences, Master Thesis, Izmir, 2006. Turkish 18. Dilman T. [Determining Exposure Emotional Harassment nurses Working At Private Hospitals]. Marmara University Institute of Health Sciences, Department of Nursing Management, Master Thesis, Istanbul, 2007. Turkish 19. Isık E. [A research on Relationship Between Mobbing Applications and Stress in Organizations]. Master Thesis,. Yildiz Technical University, Institute of Social Sciences. Istanbul, 2007. Turkish 20. Aytaç S, Bayram N, Bilgel N. [A new Tool Of Pressure: Mobbing]. XIII. Ulusal Yönetim Ve Organizasyon Kongresi, Bildiri Kitabı. Marmara Üniversitesi, İstanbul, 2003. Turkish 21. Leymann H. The Content And Developement Of Mobbing At Work. EPMA J 1996; 5(2):165-184. 22. Kutanis R, Safran B. [Bullying (mobbing) Applications to Tourism Employee: A Case Study] Olay. XIII. Ulusal Yönetim Ve Organizasyon Kongresi, Bildiri Kitabı. Marmara Üniversitesi, İstanbul, 2003.Turkish 23. Kök B S. [A case of Violence As a Spiral of Psycho-Bullying in Work Life and Causes of Bullying]. Atatürk Üniversitesi, İ.İ.B.F., 14. Ulusal Yönetim ve organizasyon Kongre Kitabı, 2006. Turkish 24. McCormick J.A., Cooper C.L. Executive Stress: Extending the International Comparison. Hum Relat 1988; 41(1): 65-72. 25. Quine L. Workplace Bulluying in Nurses. J Health Psychol 2001;6:73–84. 26. Tutar H.[Workplace Emotional Attack]. (3. Baskı). Ankara: Platin, 2004. Turkish
27. Fox S, Stallworth L.E. Racial/Ethnic Bullying: Exploring Links Between Bullying and Racism in the US Workplace. J Vocat Behav 2005; 66(3):438-456. 28. Öztunç G. [Investigation of Nurses Working at Several Hospitals in Adana Faced Verbal And Physical Harassment in Working Hours. C.Ü. HYO Der 2001;5:1. Turkish Corresponding author Funda KARDAŞ ÖZDEMİR, Kars School of Health, Kafkas University, Kars, Turkey, E-mail: fkardas@gmail.com
2120
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The first case report of serologically confirmed cat scratch disease of a boy in Serbia
Marina Djordjevic-Spasic1, Aleksandar Potkonjak2, Bjanka Lako3, Radoslava Doder4, Grozdana Canak4, Liljana Suvajdzic5, Velimir Kostic1
1 2 3 4 5
Clinical Center, University of Niš, Infectious Diseases Clinic, Serbia, Faculty of Agriculture, University of Novi Sad, Department for Veterinary Medicine, Serbia, Military Medical Center Slavija, Beograd, Serbia, Medical Faculty University of Novi Sad, Clinical Center of Vojvodina, Infectious Diseases Clinic, Serbia, Medical Faculty University of Novi Sad, Department foe Pharmacy, Serbia.
Abstract Introduction: A typical cat scratch disease is characterized by isolated lymphadenopathy with fever without other signs or symptoms of infection. It is caused by the bacteria Bartonella henselae. Since very little has been published about this issue, the aim of this paper is to present the first case of the serologically confirmed infection of a boy with one form of a typical cat scratch disease. Presentation of the patient: After having been scratched by a cat, erythematous papulovesicles occurred with the initial central incrustation, as well as the increased lymph nodes on the head and in the neck. After the indirect immunofluorescence test in the fifth week of disease, a titer of antibodies was confirmed for IgM class and IgG class ≥1:512 to Bartonella henselae antigens. The treatment was started with azithromycin syrup in the dose of 250 mg once a day, during a ten-day period. After the therapy has finished, a clinical remission of the disease has been registered. Conclusion: Establishing a serological diagnosis of this infection is important for a differential diagnostics of lymphadenopathies, and it is also important for the prevention of invasive and expensive diagnostic procedures. We are witnessing changes of the epidemiological pattern in the occurrence and the clinical manifestation of the cat scratch disease, which is why this disease should be considered on everyday basis, especially in infectology practice.
Key words: Bartonella henselae, cat scratch disease, infectious diseases, diagnostics, treatment Introduction Cat scratch disease is caused by Bartonella henselae.The clinical syndrome of CSD was first reported in 1950 by Debré et al, although Parinaud described similar symptoms in the context of oculoglandular syndrome in 1889. The first isolation of causative agent Rochalimaea henselae was made by Russell Regnery in 1992. In 1993, the genera Bartonella and Rochalimaea were united, with Bartonella having nomenclatural precedence over Rochalimaea. Thus, B henselae is currently recognized as the causative agent of CSD (1). Bartonella species are small, fastidious, pleomorphic intracellular Gram-negative coccobacilli or bacilli that are aerobic, size 0, 6 µm x 1,0 µm. The organisms are most easily visualized by using a Warthin-Starry silver impregnation stain or a Brown-Hopps tissue Gram-stain. They may be cultivated in semi-liquid nutritive agar with addition of fresh rabbit (sheep or horse) blood and they incubate on 35° C in the atmosphere with 5% of CO2. Indirect immunofluorescence test is most commonly used for serological diagnosis of Cat scratch disease (2). After evaluation of commercial tests for indirect immunofluoresence, Zbinden pointed out the most convenient tests with culture of Vero cells infected by Bartonella henselae (3). 2121
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The importance of this infection was noted after appearance of acquired immunodeficiency syndrome, in the late 80-s of the last century. Bacillary angiomatosis and peliosis appeared in these patients as difficult generalized forms of infection (4-6). In past few years, this infection is recorded even in immunocompetent people (7-11). Real incidence and prevalence of this infection is not known. Clinical picture of cat scratch disease is polymorphic. There are cases of coinfections with other causes of infectious diseases (Borrelia burgdorferi, Anaplasma phagocytophilum), that make diagnosis difficult (2, 12, 13). Recent outbreaks of zoonotic diseases globally, but also regionally and within the country remind us that human and animal health is intimately connected. The greatest risk factor for the emergence and spread of any zoonotic agent is the existence of inadequately resourced and ill-prepared public and animal health systems, as well as the lack of a well-coordinated and effective global surveillance and response mechanism (34). As a result, cat scratch disease has been marked as an emerged zoonosis and as such, attracts an attention of infectologists. Since there are few articles referring to cat scratch disease, that is, human infection by Bartonella henselae, published in our country, the aim of the work is to indicate the first case of serologically confirmed infection in a boy suffered from typical form of cat scratch disease. Case report A four year old boy, B.N, was examined at Infectious Diseases Clinic, in October 2009, one month after the scratch of domestic cat in the region of right temple. Two days later, parents noted some changes on the skin of right temple, in the form of three pimples that were itching. Several days later, the pimples suppurated, and ten days after that, spontaneously dried and formed a crust. Twenty days after the scratch, they noticed enlarged lymph nodes in front and behind right auricle. During whole period, boy was afebrile and did not complain of any other discomforts. Their first consultation with a doctor was 20 days after the cat scratch. Infectologist from the Health Center in Krusevac made diagnosis Lymphoreticularis 2122
benigna, Status post vulnus morsum animalis. Therapy of Erythromycin syrup, in dose of 250mg three times a day for 5 days started. However, the treatment was stopped initiatively after the first day, since there was no visible improvement, and the enlarged lymph nodes on the right side of neck still existed. The epidemiologist was informed and the cat was put under health supervision. The patient was directed to Infectious Disease Clinic of Clinical Center in Nis, with the purpose of further diagnosis and treatment. Past medical history revealed that up to that point, the boy had been healthy, with no allergies to drugs and food, regularly vaccinated and anti-tetanus protected. Epidemiologic questionnaire showed that he had been living in village household in comfortable conditions. Two days before the changes appeared on his skin, a domestic cat he was playing with had scratched him in his house backyard. Clinical examination demonstrated that four year old male child, was conscious, oriented in time, space and toward persons, subfebrile (37,4°C), eupneic, well-developed for the age, actively movable. The skin was normally colorized, warm and dry, without efflorescences, except three erythematous papulovesicles with initial central incrustration on the place of the scratch in the region of right temple (figure 1). Two enlarged lymph nodes diameter of 2cm, on the right preauricular and retroauricular region were observed. Both of them were movable, elastic and painful, without any skin change above. Other cervical, as well as axillary, epitrochlear and inguinal lymph nodes were not palpable. Both conjunctives were well irrigated, without secretion, scleras were white. Mouth cave was of normal finding, tongue was wet, uncovered, tonsils were eutrophic, without erythema and exudates on tonsils and throat. Thorax was cylindrical, symmetric, both sides equally respiratory movable. Lung: Normal bronchovesicular breathing, without added sounds. Heart: rhythmic heart action, tones clear, without murmurs. Abdomen was in the level of thorax; on the palpation it was soft and nontender. Liver and lien were not palpable. Neurological finding: meningeal signs were negative; there was neither lateralization of the sides nor focal neurological deficits. Physical findings on the other organs and systems were normal.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Figure 1. Erythematous papulovesicles with initial central incrustation Laboratory, microbiologic and other diagnostics Laboratory analyses showed slightly elevated leukocytes 9,8 x 109/L, 30% polymorphonuclears, 64% lymphocytes, 4% monocytes and 2% eosinophils. Results of biochemical analyses were in the limits of referent values: fibrinogen 2,2 g/L, CRP 1,8 mg/L, AST 23 U/I, ALT 25 U/I. There were neither isolated patogenous bacterias nor fungus by cultivation of swab from existed papulas. Differential-diagnostics excluded toxoplasmosis, tularemia by serological tests done in 5th week of the disease. By ELISA test, titer of IgM class of antibody on Toxoplasma gondii was 3,25 IU/mL (positive >35, negative <30) and IgG was 6,62 NTU (positive >11, negative <9). ELISA test on Francisella tularensis antibodies was negative. Indirect immunofluoresence test, serologically confirmed infection with Bartonella henselae.This test was done in 5th week of the disease when the antibody titer for IgM and IgG ≥1:512 on antigens of Bartonella henselae was established. Indirect immunofluoresence test was done in for Veterinary Medicine Department of Agriculture faculty, University of Novi Sad following the producer manual of the test (Focus diagnostic). Culture of causative agents in suspension of egg yolk was used as an antigen for prooving the IgM class of antibody, while culture of Vero cells infected with Bartonella henselae was used for proving of IgG class of antibodies. For performance of indirect immunofluoresence
test, the next dilutions of patient's serum were used: 1:20, 1:40, 1:80, 1:256 and 1:512. Among other diagnostic procedures, color echotomography of the neck confirmed the enlargement of two lymph nodes diameter of 19mm and 17mm, localized in the soft tissues of the neck, in the right submandibular region, next to parotid gland, as well as, two lymph nodes, diameter of 17mm and 11mm, localized on the buccal side in the level of right temporomandibular joint. One lymph node of 15mm was visible in the soft tissue of the right occipital region of the neck. On the left side of the neck, there were neither enlarged lymph nodes nor other pathological changes. Therapy After serologically confirmed disease, the treatment with azithromycin syrup in the dose of 250 mg once a day, has started during a ten-day period. After finishing treatment, there was a clinical remission of the disease, withdrawal of the fever two days after the treatment and a gradual withdrawal of skin lesions and falling down the crusts. Enlarged lymph nodes on the head and neck gradually increased in the next thirty days, until the control examination revealed their normal size. Therapy was proved as effective and successful; there were neither complications nor recidives of the disease, in the following period of 6 months. The patient has been completely cured and recovered from infection caused by Bartonella henselae. Discussion People are most frequently infected by B. hensleae after skin injury caused by cat scratch. Direct transmission of B. hensleae on humans by cat's bugs are not experimentally confirmed, and it is still in a domain of hypothesis (14). It is cited that there is a possibility of transmission of B. hensleae by blood transfusion and by application of blood derivates, since the presence of this cause of the disease was identified in the erythrocytes stored on the temperatures from +4° C (15). In the reported case, the infection of the boy with Bartonella henselae appeared as a consequence of domestic cat scratch. 2123
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Typical cat scratch disease characterized by appearance of isolated lymphadenopathy with fever, without any other signs or symptoms of the infection (16). The most frequent atypical manifestations of this infection are Parinaud's oculoglandular syndrome (17, 18), hepatosplenomegaly (16), encephalopathy (7, 19, 20), neuroretinitis (21-23), osteomyelitis (24, 25), endocarditis (11, 26). Difficult forms of generalized cat scratch disease (bacillary angiomatosis, bacillary peliosis) are described in AIDS patients (4-6). It is cited that B. henselae is one of the possible causes of prolonged fever and fever of unknown origin (27). In our patient, there were three erythematosus papulovesicules observed, with central incrustration in early phase, on the place of scratch, in the region of right temple, as well as, two enlarged lymph nodes of 2cm diameter, on the right preauricular and retroauriular region. This clinical finding responds to typical form of cat scratch disease with localized infection, that is, cutano-glandular form. There was neither ipsilateral conjunctivitis, nor any other pathological change on the eyes, on the base of which, Parinaud's oculoglandular syndrome is excluded. The most frequently used test for diagnosis of cat scratch disease is serological test of indirect immunofluoresence. In most people infected by B.henselae, specific antibodies can be detected 1-2 weeks after the beginning of symptoms. Sometimes, in the beginning of clinical appearance of the disease, antibodies of IgM class could be negative. Some infected persons remain seronegative during the whole infection. For serological confirmation of acute infection with B. henselae, it is necessary to prove one titer ≥ 512, or at least fourfold increasing the antibody titer or seroconversion (28). In this case, cat scratch disease is serologically confirmed by indirect immunofluorescence test. The causative agent of cat scratch disease is sensitive, in vitro conditions, to more antibiotics (macrolides, tetracyclines, trimethoprim-sulfamethoxasole, fluoroquinolones, rifampicin). Drug of choice for typical form of infection is azithromycin (16, 29-32). Eroglu and co-assistants, describe a withdrawn of the lymphadenopathy in patient infected with Bartonella henselae, 5 days after the application of azithromycin (33). In reported case, the applied azithromycin therapy has been proved as effective and successful for treating the infection by Bartonella henselae. 2124
Conclusion The importance and incidence of human infection with B.henselae is increasing in the past few years as a consequence of changing the cause and immunosuppression. The establishment of serological diagnosis of this infection is important for differential diagnosis of lymphadenopathy, as well as, for avoiding invasive and expensive diagnostic procedures. In addition to this, we are the witnesses of changes in epidemiological model of appearance and clinical manifestations of the disease, and because of that, we should think of this disease on everyday basis, particularly in infectological practice and especially in immunocompetent patients with cat scratch, infection and clinical picture of lymphadenopathy. References
1. Jerris RC, Regnery RL. Will the real agent of catscratch disease please stand up? Annu Rev Microbiol. 1996;50:707-25. 2. Boulouis HJ, Chang CC, Henn JB, Kasten RW, Chomel BB. Factors associated with the rapid emergence of zoonotic Bartonella infections. Vet Res. 2005 May-Jun;36(3):383-410. 3. Zbinden R, Michael N, Sekulovski M, von Graevenitz A, Nadal D. Evaluation of commercial slides for detection of immunoglobulin G against Bartonella henselae by indirect immunofluorescence. Eur J Clin Microbiol Infect Dis. 1997 Sep;16(9):648-52. 4. Lange D, Oeder C, Waltermann K, Mueller A, Oehme A, Rohrberg R, et al. Bacillary angiomatosis. J Dtsch Dermatol Ges. 2009 Sep;7(9):767-69. 5. Koehler JE. Bartonella-associated infections in HIV-infected patients. AIDS Clin Care. 1995 Dec;7(12):97-102. 6. Chomel BB. Cat-scratch disease and bacillary angiomatosis. Rev Sci Tech. 1996 Sep;15(3):1061-73. 7. Dyachenko P, Ziv M, Raz R, Chazan B, Lev A, Rozenman D. Cat scratch disease encephalopathy in an immunocompetent patient. Eur J Intern Med. 2005 Dec;16(8):610-1. 8. Marseglia GL, Monafo V, Marone P, Meloni F, Martini A, Burgio GR. Asymptomatic persistent pulmonary infiltrates in an immunocompetent boy with cat-scratch disease. Eur J Pediatr. 2001 Apr;160(4):260-1.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
9. Mastrandrea S, Simonetta Taras M, Capitta P, Tola S, Marras V, Strusi G, et al. Detection of Bartonella henselae--DNA in macronodular hepatic lesions of an immunocompetent woman. Clin Microbiol Infect. 2009 Dec;15 Suppl 2:116-7. 10. Van der Veer-Meerkerk M, van Zaanen HC. Visceral involvement in an immunocompetent male: a rare presentation of cat scratch disease. Neth J Med. 2008 Apr;66(4):160-2. 11. Lejko-Zupanc T, Slemenik-Pusnik C, Kozelj M, Klokocovnik T, Avsic-Zupanc T, Dolenc-Strazar Z, et al. Native valve endocarditis due to Bartonella henselae in an immunocompetent man. Wien Klin Wochenschr. 2008;120(7-8):246-9. 12. Podsiadly E, Chmielewski T, Tylewska-Wierzbanowska S. Bartonella henselae and Borrelia burgdorferi infections of the central nervous system. Ann N Y Acad Sci. 2003 Jun;990:404-6. 13. Eskow E, Rao RV, Mordechai E. Concurrent infection of the central nervous system by Borrelia burgdorferi and Bartonella henselae: evidence for a novel tick-borne disease complex. Arch Neurol. 2001 Sep;58(9):1357-63. 14. Chomel BB, Kasten RW, Henn JB, Molia S. Bartonella infection in domestic cats and wild felids. Ann N Y Acad Sci. 2006 Oct;1078:410-5. 15. Magalhaes RF, Pitassi LH, Salvadego M, de Moraes AM, Barjas-Castro ML, Velho PE. Bartonella henselae survives after the storage period of red blood cell units: is it transmissible by transfusion? Transfus Med. 2008 Oct;18(5):287-91. 16. Florin TA, Zaoutis TE, Zaoutis LB. Beyond cat scratch disease: widening spectrum of Bartonella henselae infection. Pediatrics. 2008 May;121(5):e1413-25. 17. Yamashita CA, Mielle A, Renko NS, Nascimento S, Gilio A, Pahl M, et al. Parinaud syndrome caused by Bartonella henselae: case report. Rev Inst Med Trop Sao Paulo. 1996 Nov-Dec;38(6):437-40. 18. Cunningham ET, Koehler JE. Ocular bartonellosis. Am J Ophthalmol. 2000 Sep;130(3):340-9. 19. Nishio N, Kubota T, Nakao Y, Hidaka H. Cat scratch disease with encephalopathy in a 9-yearold girl. Pediatr Int. 2008 Dec;50(6):823-4. 20. Cherinet Y, Tomlinson R. Cat scratch disease presenting as acute encephalopathy. Emerg Med J. 2008 Oct;25(10):703-4. 21. Kodama T, Masuda H, Ohira A. Neuroretinitis associated with cat-scratch disease in Japanese patients. Acta Ophthalmol Scand. 2003 Dec;81(6):653-7. 22. Donnio A, Buestel C, Ventura E, Merle H. Catscratch disease neuroretinitis. J Fr Ophtalmol. 2004 Mar;27(3):285-90.
23. Veselinovic D. Bartonella henselae as a cause of optical nerve neuritis. Vojnosanit Pregl. 2006 Nov;63(11):971-4. 24. Tasher D, Armarnik E, Mizrahi A, Liat BS, Constantini S, Grisaru-Soen G. Cat scratch disease with cervical vertebral osteomyelitis and spinal epidural abscess. Pediatr Infect Dis J. 2009 Sep;28(9):848-50. 25. Ridder-Schroter R, Marx A, Beer M, Tappe D, Kreth HW, Girschick HJ. Abscess-forming lymphadenopathy and osteomyelitis in children with Bartonella henselae infection. J Med Microbiol. 2008 Apr;57(Pt 4):519-24. 26. Pitchford CW, Creech CB, 2nd, Peters TR, Vnencak-Jones CL. Bartonella henselae endocarditis in a child. Pediatr Cardiol. 2006 NovDec;27(6):769-71. 27. Tsukahara M, Tsuneoka H, Iino H, Murano I, Takahashi H, Uchida M. Bartonella henselae infection as a cause of fever of unknown origin. J Clin Microbiol. 2000 May;38(5):1990-1. 28. Rode ĐO. Dijagnostika toksoplazmoze i bartoneloze. Paediatr Croat. 2005;41(1):212-8. 29. Windsor JJ. Cat-scratch disease: epidemiology, aetiology and treatment. Br J Biomed Sci. 2001;58(2):101-10. 30. Bass JW, Freitas BC, Freitas AD, Sisler CL, Chan DS, Vincent JM, et al. Prospective randomized double blind placebo-controlled evaluation of azithromycin for treatment of cat-scratch disease. Pediatr Infect Dis J. 1998 Jun;17(6):447-52. 31. Tsuneoka H, Yanagihara M, Nojima J, Ichihara K. Antimicrobial susceptibility by Etest of Bartonella henselae isolated from cats and human in Japan. J Infect Chemother. 2010 Jun 22; 16(6):446-8 32. Conrad DA. Treatment of cat-scratch disease. Curr Opin Pediatr. 2001 Feb;13(1):56-9. 33. Eroglu C, Candir N, Dervisoglu A, Kefeli M. A case of cat scratch disease. Mikrobiyol Bul. 2007 Oct;41(4):603-6. 34. Cavaljuga S., Seric-Haracic S., Vasilj I., Scharninghausen J., Faulde M., Fejzic N. Development of communicable diseases surveillance infrastructure for zoonoses in Bosnia and herzegovina - a common approach? HealthMED. 2009; 3 (2):183-89 Corresponding author Aleksandar Potkonjak, Faculty of Agriculture, University of Novi Sad, Department for Veterinary Medicine, Serbia, E-mail: ale@polj.uns.ac.rs
Journal of Society for development in new net environment in B&H
2125
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Giant pulmonary artery aneurysm due to uncorrected atrial septal defect: evaluated by multidetector computed tomography
Enbiya Aksakal1, Mecit Kantarcı2, Hüseyin Şenocak1
1 2
Department of Cardiology, Faculty of Medicine, Atatürk University, Erzurum, Turkey, Department of Radiology, Faculty of Medicine, Atatürk University, Erzurum, Turkey.
Abstract Giant pulmonary artery aneurysm (PAA) is a rare disease. We described a rare case of giant PAA due to uncorrected atrial septal defect with high pulmonary hypertension in a 35-years-oldwoman. Her cardiac disease was first diagnosed at the childhood period, but she has not admitted to any hospital for follow up, till now. She denied dyspnea on exertion, cough and chest pain. Transthoracic echocardiograph revealed giant PAA and atrial septal defect with pulmonary hypertension. Multidetector computed tomography is used for confirmation of size, location and course of PAA. Key words: giant aneurysm, pulmonary artery, multidetector computed tomography Introduction Pulmonary artery aneurysm (PAA) is a rare clinical entity that may be either congenital or acquired. Currently, congenital cardiac anomalies associated with pulmonary hypertension, vasculitis and infections are most of the causes of PAA.(1,2) Identification of enlargement of the main pulmonary artery and its brunches are important because of the high morbidity and mortality rates of rupture.(3) Multidetector computed tomography (MDCT) is now a non-invasive tool for detection and recognition of the pulmonary artery system. We report a very rare case of a giant PAA due to late diagnosed and uncorrected atrial septal defect (ASD) associated with high pulmonary hypertension recognized by MDCT. 2126
Case report A-35-years-old woman admitted to our clinic with complaints of chest pain, palpitation, and cough without hemoptysis, hoarseness and progressive shortness of breath. Her cardiac disease was first diagnosed at the childhood period, but she has not admitted to any hospital for followup. She had a history of exertional dyspnea since childhood and her symptoms began to increase approximately four months ago. On physical examination, her pulse rate was 96/min and blood pressure was 130/70 mmHg. A 2/6 systolic ejection murmur best heard at apex and mild systolic murmur over the pulmonary valve area was present. No ulcer and other abnormal findings were found in her external genitalia and oral cavity due to the growing suspicion of Behçet’s disease. Laboratory studies were within normal limits. Transthoracic echocardiography (TTE) revealed normal left ventricular size and function, right atrial and ventricular dilatation, right ventricular hypertrophy, secundum type ASD (20 mm in size) and left-to-right shunt across the defect, severe dilatation of the main pulmonary artery (65 mm in diameter), a normal aspect of the pulmonary valvular leaflets, moderate pulmonary and tricuspid regurgitation, and a systolic pulmonary artery pressure of 85 mmHg (Fig. 1). These data were also confirmed by transoesophagial echocardiography. However, these methods did not provide a good estimation of the dilatation of the pulmonary artery and its branches. MDCT was performed to determine the origin and course of the pulmonary artery system. Volume-rendered MDCT images revealed a giant
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
aneurysm of the main pulmonary artery measured as 62 mm in diameter. The right and left pulmonary arteries were enlarged to 24 and 45 mm in diameter, respectively (Fig. 2 A, B). Coronary artery system was found to be normal. We have recommended operation for the aneurysm but she refused.
Figure 2B. Superior view 3D volume rendering image shows giant pulmonary artery aneurysm (Ao; aorta, PA; pulmonary artery). Discussion Figure 1. Apical 4-chamber imaging shows right atrial and ventricular dilatation, right ventricular hypertrophy and secundum type atrial septal defect. (LA; left atrium, RA; right atrium, arrow; atrial septal defect). PAA is an uncommon disease. It was detected in only eight cases of 109 571 autopsy subjects by Deterling and Clagett’s.(1) Aneurysms in the left pulmonary artery are more than in the right. (2,4) Several congenital cardiac anomalies are associated with PAA (more than 50%), such as bicuspid pulmonary valve, pulmonary valve stenosis or regurgitation, pulmonary postvalvular or arterial stenosis, mitrale stenosis, tetralogy of Fallot, hypoplastic aortic valve and atrial or ventricular septal defect.(2-7) Patent ductus arteriosis is the most commonly (23%) seen congenital heart defect combined with PAA. Primary and more frequently secondary pulmonary hypertension (66%) is an important factor of the pathogenesis for PAA. Other possible mechanisms of pathogenesis for PAA are increased pulmonary blood flow, infections, connective tissue disease and congenital deficiency of the pulmonary artery wall, rarely fibromuscular dysplasia and amiloidosis.(6,7) ASD is a predisposition factor to the development of PAA by generating sustained high pulmonary blood flow rates and pulmonary artery pressures, such as in the present case. Up to date, we found only one 2127
Figure 2A. Contrast enhanced axial CT angiographic image shows giant pulmonary artery aneurysm (Ao; aorta, PA; pulmonary artery).
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
case report in the literature: It was a giant PAA due to undiagnosed ASD associated with pulmonary hypertension.(8) The optimal management of PAA is not well defined. Two-dimensional echocardiography is considered to be the best –first step- technique for the detection of PAA in routine cardiac management. Bhandari and Nanda have shown the feasibility of diagnosis of PAA using two-dimensional echocardiography.(9) However this technique (transthoracic and/or transoesophagial) is not adequate to show the course of the pulmonary artery brunches, and differentiates from adjacent structure. Therefore multiple imaging techniques are usually required for the diagnosis of PAA. Although invasive pulmonary artery angiography has been the gold standard of diagnosis of PAA till now, magnetic resonance imaging, computed tomography, transthoracic and transoesophagial echocardiography are other choices.(6,9-12) Currently MDCT imaging is now largely superseded previous techniques. Identification of the size, location and course of PAA, and their relationship with other adjacent structures is important, because it may be an important cause of sudden and unexpected death when it dissections or ruptures. MDCT is a new non-invasive, reliable and good alternative imaging method in the evaluation of pulmonary vascular tree. MDCT can determine the location of aneurysm and the diameter of the main and peripheral brunches of pulmonary artery system. The symptoms of the PAA are nonspecific: dyspnea on exertion, chest pain, cough and hemoptysis. Prognosis is related to heart failure due to pulmonary artery hypertension.(4) Most complications of PAA are; extrinsic compression of the adjacent structures (such as, left pulmonary vein, left bronchus, left main coronary artery), thrombosis, acute or chronic dissection and/or rupture. (6) Most of the untreated patients who had heart diseases die due to sudden rupture or dissection. (3,5,7) Surgical treatment consists of aneurysmectomy or aneurysmorrhaphy when it involves the pulmonary conus. The etiology in our case can simply be due to ASD associated high pulmonary hypertension. There was no clinical or laboratory abnormality to indicate Behçet’s disease. PAA diagnosis was 2128
made by multiple image techniques. Initially transthoracic and then transoesophagial echocardiography showed giant PAA. In addition MDCT confirmed this diagnosis and gave additional information about the size, location and course of the PAA. We have recommended surgical therapy but she has not accepted yet. She has been on close follow up for three months and she is monthly monitored for PAA size, pulmonary valve and right ventricular function. In conclusion, giant PAA should be considered in late complication of the uncorrected ASD. Echocardiography may be the first choice of screening method in patients with PAA. However MDCT, which can better demonstrate the pulmonary vascular tree and associated pathologies, must be in consider as well. References
1. Deterling RA, Clagett OT. Aneurysm of the pulmonary artery: review of the literature and report of a case. Am Heart J 1947; 34:471–98. 2. Bartter T, Irwin RS, Nash G. Aneurysms of the pulmonary arteries. Chest 1988; 94:1065–75. 3. Graham JK, Shehata B. Sudden death due to dissecting pulmonary artery aneurysm: a case report and review of the literature. Am J Forensic Med Pathol 2007; 28:342–4. 4. van Rens MT, Westermann CJ, Postmus PE, Schramel FM. Untreated idiopathic aneurysm of the pulmonary artery; long-term follow-up. Respir Med 2000; 94:404–5. 5. Butto F, Lucas RV Jr, Edwards JE. Pulmonary arterial aneurysm. A pathologic study of five cases. Chest 1987; 91:237–41. 6. Makaryus AN, Catanzaro J, Boxt L. Pulmonary artery aneurysm evaluated by 64-detector CT 254 in a patient with repaired tetralogy of Fallot. Tex Heart Inst J 2007; 34:254–5. 7. Song EK, Kolecki P. A case of pulmonary artery dissection diagnosed in the Emergency Department J Emerg Med 2002; 23:155–9.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
8. Tartan Z, Cam N, Ozer N, Kaşikçioğlu H, Uyarel H. Giant pulmonary artery aneurysm due to undiagnosed atrial septal defect associated with pulmonary hypertension. Anadolu Kardiyol Derg 2007; 7:202–4. 9. Bhandari AK, Nanda NC. Pulmonary artery aneurysms: echocardiographic features in 5 patients. Am J Cardiol 1984; 53:1438–41. 10. Ugolini P, Mousseaux E, Sadou Y, et al. Idiopathic dilatation of the pulmonary artery: report of four cases. Magn Reson Imaging 1999; 17:933–7. 11. Ritter CO, Weininger M, Machann M, Beissert M, Hahn D, Kenn W. Non-invasive imaging in a rare case of main pulmonary artery aneurysm. Respir Med 2008; 102:790–2. 12. Güler N, Sakarya ME, Eryonucu B, Demirbao R. Transesophageal echocardiographic detection of a pulmonary artery aneurysm complicated by thrombus. Heart Lung 2003; 32:159–61. Correspond Author Enbiya Aksakal, Atatürk University, Faculty of Medicine, Aziziye Research Hospital, Department of Cardiology, Erzurum, Turkey, E-mail: drenbiya@yahoo.com
Journal of Society for development in new net environment in B&H
2129
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
History of surgical correction of Hypospadias
Biljana Lucic Prostran, Jan Varga, Branka Radojcic, Dragana Zivkovic Clinic of Pediatric Surgery, Institute for Child and Youth Health Care of Vojvodina, Novi Sad, Serbia
Abstract The term hypospadias is first time met in the papers of Galen. The word is derived from the Greek words hypo, meaning under and spadon, meaning fissure. The first description of hypospadias, definition of pathology and suggestions for treatment were gave by Helidorus and Antyllus in the first century.They suggested partial resection of glans in order to correct the position of meatus. In XVI century, Amatus Lucitanius created a canal from the proximal ectopic meatus to the distal end of the penil shaft in penoscrotal hypospadias, using a silver cannula. The base of almost all contemporrary surgical techniques were formed in XVIII century, or even earlier. Pare’s chordectomy, Phisik’s dorsal plication antd Pancoast’s plastics of tunica albuginea, in original form or modified, are the most frequently used methods of orthoplasty today. Bouisson’s (1861.) meatal based flap technique is the base of the large group of „flip-flap“ urethroplasties nowadays. The large group of techniques with preservation od urethral plate was derived from the Thiersch-Duplay principle (1897, 1974.) The use of vascularised island flap was introduced by Van Hook (1896) in this fruitful period. At the end of this century free grafts have came into the use (Nove-Josserand 1897). The twentieth century mostly brings modifications of the principles presented previously. There are more than 250 surgical tehniques and their modifications described by now. Although this leads toward ideal functional and cosmetic result of repair, one must notice the importance of ideas of the great surgeons from the past. Key words: history of medicine, surgery, urology, hypospadias, urethra
Introduction Hypospadias is a complex anomaly which consists of few pathoanatomic states of urethra and penis. Basic characteristic of hypospadias is the position of external meatus of urehra which can be positioned anywhere along the ventral line of penis, from the glans to the perineum. Distal from meatus continues untubularised segment of urethral plate. Proximally from meatus most commonly we notice the bifurcation corpus spongiosum which follows the urethral plate toward the glans. Preputium most commonly has a characteristic split prospect with ventral sphenoid deficit, while it manifests dorsally by sufficiency of preputium and makes hyposphadias “hood”. In a clinical sense even more important characteristic of hyposphadias then position of meatus is the presence or the absence of chordee. It’s exsistence is manifested by more or less ventral curvature of penis. (Figure1)
2130
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
was considered untreatable. Their description of partial resection of the glans, so that meatus could be positioned centrally, is considered one of the first surgical techniques to attempt to treat hypospadias. To stop the bleeding they recommended bandaging and the use of vinegar locally.
Figure 1. Hypospadias Regardless of the surgical technique which will be implemented in the correction of hypospadias, the same goals are set for every surgeon: - To form a good neourethra with starting point at the tip of the glans - To establish an adequate shaft of the penis - To make a cosmeticly satisfactory result, which through the decades has become an imperative. - Reaching these goals has inspired surgeons throughout the history to invent many procedures, some of which are still in use. Hypospadias surgery in ancient time For the first time we meet the term “hypospadias” in scripts by Galen (130-199 AD) (1) (Fig 2) The word comes from the Greek words hypo which means under and spadon which means cleft – tear. Galen wrote about problems caused by the chordaee, and the difficulties in ejaculation toward the uterus. In the first description of hypospadias, the definition of it’s pathology and the suggestions for it’s treatment date from the 1st century AD from Alexandria and were made by Helidorus and Antyllus (2) . They made the first classification of hypospadias by the position of ectopic meatus. The proximal form
Figure 2. Galen Paul of Aegina (625-690 AD) (Figure 3) recommended the treatment of distal formes of hypospadias consisting of the amputation of the penis tissue distal from meatus of urethra.(3)
Figure 3. Paul of Aegina 2131
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Oribasius (325 – 403 AD) the Byzantine physician had the similar opinions. He described “The amputation of the glans a little bit above the sulcus coronarius” with which he treated the distal forms of hypospadias. (4) Hypospadias surgery from the 16th to the 18th centyry The age of renaissance records a significant progress in the surgery of hypospadias compared to the primitive techniques of the ancient times. In 1556. Amatus Lusitanus from Portugal described the treatment of penoscrotal hypospadias in a two year old boy. He used a silver cannula to make a canal from the proximal ectopic meatus to the distal end of the body of penis. (5) Apart from the historically-medical notes from this period there are also notes about the social problems caused by hypospadias. One of the most significant is about Henry II. kong of France from the second half of XVI century. Despite the records of his active sexual life and athletic figure this monarch had a severe case of chordee. Because of this he didn’t have any children for the first 10 years of his marriage. Jean Fernel, a royal surgeon, successfully corrected this problem and Henry became the father of 10 children with his wife, queen Catherine de Medici. According to data from the University of Rome, there is described case of Matia, a Maltese woman who asked for the annulment of her marriage because of her husbant`s hypospadias with hordae. This case was discussed on the church court. Two medical experts examined her husband, his penis was described as incapable and ineffective for penetration and the church court annulled this marriage.(6) Ambrois Pare (Figure 4), a famous French surgeon from the XVI century, made the first detailed description of the chordee and the penile curvature which was until then sidelined by the position of the meatus. He suggested a complete excision of the fibrous tissue in order to reduce the curvature and to achieve the function of the penis. (7) Fabricius of Aquapendente (1533-1619) (Figure 5) recommended “cutting glans” until meatus is set to the normal position. (8) 2132
Figure 4. Ambrois Pare
Figure 5. Fabricius ab Aquapendente Pierre Dionis described in the year 1710. an excision of the chordee, very similar to the one Pare recommended, and he also added an incision of the fibrous tissue until the shaft of the penis is corrected. Lorenz Heister (1683-1758), a German surgeon, suggested, in order to solve the problem of chordee, aplication of the remedy for softening the
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
skin on the ventral side, and of the astringent on the dorsal side. Also, he applied a number of small incisions on skin on the ventral side. He developed a special technique for bandaging after the correction of the chordee. He conducted his research in 1743. and concluded that there is a positive correlation between the rate of fatherhood and the position of the ectopic hyposphadiac meatus. (10) Hypospadias surgery in the XIX century In the XIX a significant improvement in the understanding of the pathophysiology and in the establishment of the principles of hypospadias surgery has been made. Dieffenbach in 1838. tried to treat hypospadias by perforating the glans from the top to the meatus and leaving the canulla until the epithelization ot the tunnel is made. It was the first attempt to create a neourethra after the pioneering attempt of Lustianus almost 300 years earlier. (11) A progress in resolving the chordee is also noted. In 1842. Mettauer tried to release the chordee by incisions on the subcutaneous fibrous tissue. (12) In 1844 Phusisk was the first who described the correction of the curvature by dorsal plication. In the same year Pancoast published a correction of the chordee by the excision of the small segment of the tunica albuginea on the dorsal side of the corpora cavernosa, which represent the base of the Nesbit procedure established almost one century after. (13) In 1861. Bouisson used the skin on the scrotum as a local flap for forming the neourethra. Flap had a base on the ectopic meatus and was bordered by two parallel incisions along the middle of the scrotum. Transponed toward the glans, it represented the front side of the neourethra (Figure 6) This was the first attempt in usage of flap for the creation of neourethra and it represents the base for numerous modern forms of urethroplasty. Buisson also used a transverse incision on the ventral skin in order to correct the chordee. (14) Karl Thiersch in 1869. suggested the use of prepuce after the “button hole” transposition, initially for the correction of the episphadias. Later this technique found a use in the surgery of hypospadias.(15) (Figure 7). That same year he started using a local tubularized skin in order to form a
neourethra. This principle, later modified, represents the basis on many techniques which use the tubularized urethral plate and which are in the widest use nowadays. (Figure 8)
Figure 6. Urethroplasty by Bouisson
Figure 7. Karl Thiersch 2133
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
glans, eather by tubularisation of the glans or by it’s incision when the urethral groove was deeper. (20) In 1897. Nove-Josserand for the first time applied tubularised free skin graft for ureteroplasty .This was the base of usage of free grafts for the forming of neourethra. (21) The most significant moments in development of Hypospadiology in the XX century Ombredan in his books in 1911. and then in 1925 and 1932. describes flap with the base on the meathus and the purse-string suture in ureteroplastics. (22, 23) He used a wide oval flap for the creation of urethra, and the incurred defect of skin on the ventral side covered with the skin from the preputium transponed forward by “button hole” principle. Mathieu 1932. published his technique using the “U” flap with the base of the meatus and two sutured lines.(24) This technique in it’s basic shape or modified is in the wide usage today. (Figure9)
Figure 8. Thiersch-Duplay urethroplasty Tephyle Anger 1873. adopted and modified this technique by making two asymmetric longitudinal incisions. (16) This way the covering of the suture line was provided with the intact skin, meaning that the overlap of the two suture lines was avoided, which was the first attempt in the prevention of the urethrocutaneous fistulas. Duplay in 1874. published his technique in two stages. In the first one he used Bouison’s technique to release the chordee and canullated the glans, leaving this part of neourethra to epitelise spontaneously. In the second phase he uses Thiersch’s technique by making two parallel incisions along the edges of the urethral plate, and then he tubularised the incurred flap. His first successful correction of hypospadias this way had to be done in five stages. Still, Thiersch – Dupley technique, with some modifications, is in wide use nowadays. In the year 1880. Duplay published new technique in which he presented the principle in creating a partially epithelized neourethra in case when an urethral plate was not wide enough, and it’s spontaneous epithelization around the catheter. (17,18) Van Hook in 1896 described for the first time prepuce vascularised island flap which is still in wide use for the correction of the proximal shapes of hypospadias. (19) In 1898. Beck was the first in presenting the technique of urethral mobilization for correcting distal hypospadias. He devided the urethra from the corpora cavernosa so he succeeded in it’s elongation, and then, he brought the meatus on the tip of the 2134
Figure 9. Van Hook’s technique vascularised island incision, Modified by Duckett Humby in the 1941. was the first who used buccal mucosa for ureteroplasty (25) This type of graft has stll the important role, particularly in the reoperations when a possibility of usage of local flaps is reduced. This technique was popularized by Duckett in 1986. (25) Today it is in a widespread use. Memmelaar in the year 1947. for the first time described the use of the bladder mucosa for the neurourethra. (27) This technique was very popular in China during the 1970-ties but showed a high degree of stenosis on the place of the anastomosis and other co,plications like a common protusion of
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
mucosis through neomeatus. Today this technique is used, with large success, in the dealing with urethral stricture on the distal and bulbar urethra. In 1955. Byars described dorsal longitudinal midline incision of the preputium in order to transposition it on the ventral side of the penis. (Figure10)
In the year 1994. Snodgras published the technique of tubularized incised urethral plate (TIP urethroplasty) (36, 37). This modification of Thiersch-Duplay technique is one of the most commonly used nowadays. In 1998. Perović and assosiates published the technique “penil disassembly” as a solution of difficult curvatures, particularly “tilt glans” shape. Particculry in treatment of smaller penis. (38) In 1999. Decter described the correction of the curvature by “split & roll” technique, adding the longitudinal ventral incision between the corpora cavernosa on the previously described technique of corporal rotation. The surgery of hypospadias today In the literature published in recent years there can be found only smaller modifications, mostly in the improvement of the cosmetic result or the solving of the complications in surgically corrected hypospadias. So, there is Yereskov’s suggestion from the year 2000. for joining of the devided segments of corpus spongiosum through the neurourethra, called Y-V spongioplasty(40) , like the way to restore the normal anatomy and in the way of making an additional protective layer in the prevention of the fistula formation. Gundeti in 2005. suggests the use of free skin graft from the inner layer of the prepuce placed in te site of incision of urethral plate, which prevents the formation of meatus stenosis on Snodgrass urethroplasty (so called Snodgraft )(41) In the recent literature there can be also found suggestions on less common complications such as the laser removal of intraurethral hair, as consequence of the usage of the hair bearing skin in urethroplasty. (42) The evolution in hypospadias surgery continues and the new modifications of techniques are being published. Still, further improvement in surgery of hypospadias is mostly based on the improvement in other segments of surgery. The development of pediatric anesthesiology and the pain management, the development of the suture materials, the use of the latest antibiotics, dressing, stents, and other modern equipment, in the first place the surgical instruments and the equipment for optical magnification, 2135
Figure 10. Lateral flaps by Byars Gites and Machlaughlin in 1974. described for the first time an artificial erection by injecting the saline in to the corpora cavernosa. (29) This method enabled the exact correction of the curvature and is in widest use today. Duckett in 1981. described MAGPI (Meatal Advancement and Glanuloplasty Incorporated) procedure. That same year he also introduced a technique of urethroplasty by the tubularized transverse island flap on the inner preputial layer. (30, 31) Monfort and Lucas in 1982. recommended a preoperative testosterone stimulation in order to increase vascularisation of the penis. (32) Koff and Eakins in 1984. described the curvature correction by bringing closer dorsal sides of cavernosed bodies by corporal rotation. (33) Snow in 1986. published the use of tunica vaginalis as a protective layer in the prevention of fistulas.(34) Retik and associates published in 1988. the use of vascular preputiual fascia like another protective layer with the purpose of prevention in the formation of fistulas. (35) This technique found a wide use and significantly reduced the incidence in forming of fistulas.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
is the significant characteristic in the surgery of hypospadias in the twenty first century. Conclusion Review of the development of hypospadias surgery through history leads to the conclusions that the basis of almost all modern surgical methods have been set in the 18th century and even before. Pere’s technique of chordeectomy from the 16th century , Phisik’s dorsal plication and Pancoast’s tunica albuginea plasty from the 19th century, in it’s basic form or modified are some of the most commonly used methods of orthoplasty even today. Bouisson’s flap technique with the base on the meatus is considered as the foundation of all today’s “flip-flap” urethroplasties. Thiersch-Duplay technique is the basis of large group of techniques with urethral plate preservation. The vascularised island incision technique by Van Hook has also emerged during this fruitful period. By the end of 19th century a free skin grafts were also in use (Nove-Josserand). New surgical techniques which are being published daily in literature are in fact modifications of the techniques by the pioneers of hypospadiology from the previous centuries. In favor of this goes the Durham Smith’s claim thet says: “Although the penil repairsration can be grouped in five or six major principles, depending on the tissues used, each has been subject to countless variations, as one surgeon after another adds yet another modification to the already thrice-modified variation of a procedure adapted from the original.” (44) In the literature, until today, about two hundred and fifty surgical techniques and it’s modifications have been published for the correction of hypospadias. Correction of hypospadias represents the professional challenge for surgeons and new techniques are still being discovered and published. This can be explained as the aspiration of surgeons to find one ideal technique which will be freed from all the complications and which will give the perfect cosmetic and functional result. However a goal for personal affirmation of a specific author who brings novelties in original surgical techniques should not underestimate the significance of the visionary ideas great surgeons had through history. 2136
References
1. Galen (c.130-201 A.C.) In: Opera Omnia, vol.10. Kuhn, Leipzig, Cnobloch, p 1001. 2. Bussemaker UC, Daremberg CV: Oeuvres d’Oribase, texte Gre, en grande partie inedit collationnee su les manuscrits (6 vols). Impremierie National, Paris.p.1851-1876 3. Smith ED: The history of hypospadias. Pediatr Surg Int.1997;12:81-85. 4. Lascaratos J, Kostakopoulos A, Louras G: Penile surgical techniques described by Oribasius (4th century CE). BJU Int. 1999; 84:16-19. 5. Rogers BO: History of external genital surgery. In: Horton CE(ed):Plastic and reconstructive surgery of the genital area. Little Brown; 1973; pp3-47. 6. Duckett JW,Baskin LS: Hypospadias. In: Gyllenwater JY, Grayhack JT, Howards SS, Duckett JW (eds): Adult end pediatric urology, vol 3, 3rd edn. Mosby, St Louis, 1996, pp 2549-2589. 7. Johnson T: The works ofthat famous chirurgion Ambrose Pare, translated out of Latine and compared with the French by T. Johnson. Cotes TH, Young R, London, 1634. Reprinted by Milord, Boston, 1968. 8. Fabricii ab Aquapendente H: Opera Chirurgica Venetiis: Apud Robertum Magliettum, 1619. 9. Dionis PA: Course of chirurgical operations demonstrated in Royal Garden at Paris, 2nd edn. J Tonson, London, 1710; pp 137-155. 10. Heister L: General system of surgery in three parts. Winnys, London. 1743; pp 129-138,243-276. 11. Dieffenbach JF: Die operative Chirurgie. Brockhaus, Leipzig, 1845. 12. Merrauer JP: Practical observations on those malformations of the male urethra and penis, termed hypospadias and epispadias, with an anomalous case. Am J Med Sci. 1842; 4:43. 13. Pancoast JA:Treatise on operative surgery. Carrey and Hart, Philadelphia, PP 317-318; 1844. 14. Bouisson MF: De L' hypospadias et de son traitment chirurgical. Trib Chir. 1861; 2:484. 15. Thiersch C: Ueber die Entstehungsweise und operative behandlung der Epispadie. Arch Heilkd. 1869; 10:20.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
16. Anger MT: Hypospadias peno-scrotal, Complique de coudure de la verge: redressement du penis et urethro-plastie par inclusion cutanee: guerison. Bull Soc Chir. Paris. 1875; p 179. 17. Duplay S: De l’hypospadias perineoscrotal et de son traitement chirurgical. Arch Gen Med. 1874. 1:613,657. 18. Duplay S: Sur le traitement chirurgical de l’hypospadias et de l’epispadias. Arch Gen Med. 1880; 5:257. 19. Van Hook W: A new operation for Hypospadias. Ann Surg. 1896; 23:378. 20. Beck C: A new operation for balanic hypospadias. NY Med J. 1898; 67:147. 21. Nove-Josserand G: Traitment de l’hypospadias; nouvelle metode.Lyon Med. 1897; 85:198. 22. Ombredanne L: Hypospadias penien chez l’enfant. Bull Mem Soc Chir Paris.1911; 37:1076. 23. Ombredanne L: Precis clinique et operatoire de chirurgie infantile. Masson, Paris.1932; p 851. 24. Mathieu P: Traitment en un temps de l’hypospadias balanique et juxta-balanique. J Chir.1932; 39:481. 25. Humby G: A one stage operation for hypospadias. Br j Surg.1941; 29:84-92. 26. Duckett JW: Use of bucal mucosa urethroplasty in epispadias. Meeting of Society of Pediatric Urology, Southampton, England, 1986. 27. Memmelaar J:Use of bledder mucosa in a one stage repair of hypospadias. J Urol. 1947; 58: 68-73. 28. Byars LT: A technique for consistently satisfactory repair of hypospadias. Surg Gynecol Obstet. 29. Gittes RF, McLaughlin AP III: Injection technique te induce penile erection. Urology.1974; 4:473-4. 30. Duckett JW: MAGPI (meatal advancement and glanuloplasty): a procedure for subcoronal hypospadias. Urol Clin North Am. 1981b; 8:513-20. 31. Duckett JW: The island flap technique for hypospadias repair. Urol Clin North Am. 1981a; 8:503-11. 32. Monfort G, Lucas C: Dihydrotestosterone penile stimulation in hypospadias surgery. Eur Urol. 1982; 8:201-3. 33. Koff SA, Eatkins M: The treatment of penile chordee using corporal rotation. J. Urol. 1984; 131-931.
34. Snow BW: Use of tunica vaginalis to prevent fistulas in hypospadias surgery. J Urol. 1986; 136:861-3. 35. Retik AB, Keating M, Mandell J: Complications of hypospadias repair. Urol Clin North Am. 1988; 15:223-236. 36. Snodgrass W: Tubularised incised plate urethroplasty for distal hypospadias. J. Urol. 1994; 151:464-5. 37. Snodgrass W, Lorenzo A: Tubularised incised plate urethroplasty for proximal hypospadias. BJU Int. 2002s; 89:90. 38. Perović SV, Vukadinović V, Djordjević MLJ, et al: The penile disassembly technique in hypospadias repair. Br J Urol. 1998; 81:479-487. 39. Decter RM: Chordee correction by corporal rotation, the split and roll technique. J Urol.1991; 146:641 40. Yerkes EB, Adams MC, Miller DA, et al. Y-to-I wrap: use of the distal spongiosum for hypospadias repair. J Urol 2000;163:1536-8 41. Gundeti M, Queteishat A, Desai D, Cuckow P: Use of an inner preputial free graft to extend the indications of Snodgrass hypospadias repair (Snodgraft). J Ped Urol. 2005. vol 1. &:395-396. 42. Crain D. Miller O, Smith J, et al: Transcutaneous Laser Hair Ablation for Management of Intraurethral Hair After Hypospadias Repair: Initial Experience. J. Urol 2003, vol 170 5:1948.1049. 43. Lučić-Prostran B: Derivacija urina i uretralni stent u hirurgiji hipospadija. Rad iz uže specijalizacije. Medicinski fakultet, Novi Sad, 2006; 26-31. 44. Smith D: Foreword. In:Hadidi AT, Azmy AF (eds.): Hypospadias surgery. Springer-Verlag Berlin Heidelberg NewYork 2004; pp 9-10. Corresponding author Biljana Lučić-Prostran, Clinic of Pediatric Surgery, Institute fo Child and Youth Health Care of Vojvodina, Serbia, E-mail: prostranns@open.telekom.rs
Journal of Society for development in new net environment in B&H
2137
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Causes and symptoms of contact sensitivity – a two-decade review of research results of the allergy department of the clinic of dermatovenereology diseases in Novi Sad
Marina Jovanovic1, Neda Mimica-Dukic2, Silvija Brkic3, Pal Boza4, Aleksandra Petrovicl, Djordjije Karadaglic5, Ivan Mikov6, Biljana Bozin7, Goran Anackov4
1 2 3 4
5 6
7
Faculty of Medicine of the University of Novi Sad, Clinic of Dermatovenereology Diseases, Clinical Center of Vojvodina, Novi Sad, Republic of Serbia, Faculty of Natural Sciences of the University of Novi Sad, Department of Chemistry, Novi Sad, Republic of Serbia, Faculty of Medicine of the University of Novi Sad, Novi Sad, Republic of Serbia, Faculty of Natural Sciences of the University of Novi Sad, Department of Biology and Ecology, Novi Sad, Republic of Serbia, Faculty of Medicine, University of Podgorica, Montenegro, Faculty of Medicine of the University of Novi Sad, Institute of Occupational Medicine, Novi Sad, Republic of Serbia, Faculty of Medicine of the University of Novi Sad, Department of Pharmacy, Novi Sad, Republic of Serbia.
Abstract Contact sensitivity is a type of hypersensitivity which results in an immune response after contact of the skin or mucous membranes with various environmental substances. During the past two decades, the Allergy Department of the Clinic of Dermatovenereology Diseases in Novi Sad, has examined patients who were referred with a suspicion of contact sensitivity and one of the following diagnoses: contact dermatitis; atopic dermatitis; chronic urticaria; and chronic non-allergic inflammatory skin disease. Our starting point was that research of contact sensitivity should not be limited only to contact dermatitis, but must also include a whole spectrum of various clinical entities, where eczema and contact urticaria are two extremes. The aim was to determine the roles which the following factors play in the development of conntact sensitivity: type I hypersensitivity; nonpollen antigens of allergenic plants; chronic skin inflammation. After 2-decades, we obtained the following data: early contact reactions accounted for 15% of all chronic urticaria; atopy was not a significant risk factor for 2138
the development of early contact sensitivity; nonpollen antigens of allergenic plants were the most common causes of contact eczematous allergies in patients with atopic dermatitis and in psoriasis patients; the stage of chronic skin inflammation did not significantly affect development of contact eczematous allergies. The obtained results contributed to new knowledge about the etiology and pathogenesis of contact sensitivity, providing better diagnostic and treatment options to the sick and opening new horizons for further research. Key words: Dermatitis, Allergic Contact; Erythema Multiforme; Urticaria; Food Hypersensitivity; Latex Hypersenitivity Introduction “A dermatologist must know more than anyone else not only about the skin and its contents, but also about everything that surrounds the skin”. During the past two decades, these words of a great allergist in dermatology, Robert M. Adams, were the core idea of all investigations conducted in the
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Allergy Department of the Clinic of Dermatovenereology Diseases of the Clinical Center of Vojvodina in Novi Sad. We examined all patients who were referred to our Department with a suspicion of contact sensitization during the last twenty years. Contact sensitivity is a response of the immune system produced by contact of the skin or mucous membranes with certain agents (1). According to the data published by the US National Research Council, an extremely large number of chemicals are able to cause skin sensitization. The list included 65.725 officially registered substances that a person may be exposed to: 3.350 pesticides, 3.410 cosmetic products, 1.815 medications, 8.627 food additives, and 48.523 various commercial chemicals (2). One of the fundamental tasks of dermatotoxicology is to deal with the assessment of potential risks from exposure to some agents causing irritation or allergic hypersensitivity effects in certain population (1). Parallel examinations were carried out in patients suffering from: contact dermatitis, atopic dermatitis, chronic urticaria, chronic nonallergic inflammatory dermatoses and in healthy subjects (control group). This approach provided comparison of contact sensitivity with other chronic inflammatory dermatoses (3). Before the others (4), we tested the hypothesis that searching for contact sensitization can be useful in the management of chronic urticaria (5). The starting point of all our investigations was the fact that distribution of immunologic responses to early, humoral or type I, and late, cellular or type IV, based on the time related course of inflammatory reactions, without aspects of their deep postulated relationships and interactions, is unsustainable today. These inflammatory reactions, whether immunological or nonimmunological, show great agreement of cytokine profile in contact reactions, as well as equal degree of inflammatory reactions, which cannot be distinguished, despite various mechanisms of origin, neither clinically nor pathohistologically. That is why examination of contact sensitivity and pathomechanisms of local and systemic contact reactions, may not be limited only to contact dermatitis and allergic contact dermatitis. Today it includes a wide range of more or less clearly defined clinical entities, where eczema and contact urticaria with anaphylaxis represent two extremes.
During two decades, all investigations conducted in the Allergy Department of the Clinic of Dermatovenereology Diseases in Novi Sad, aimed to determine roles which different factors exhibit in the development of contact sensitivity: type I hypersensitivity, nonpollen antigens of allergenic plants and nonspecific chronic skin inflammations. Given that the clinical manifestations of contact sensitivity consist of manifestations of contact allergic dermatitis, contact erythema multiforme and contact urticaria, they may be analyzed like separate entities. Allergic contact Dermatitis Allergic contact dermatitis is a clinical manifestation of eczematous type contact sensitivity. Eczematous type contact sensitivity represents a delayed cellular immunologic skin response caused by T-lymphocytes, which occurs as a result of exposure of the skin or mucous membranes to certain chemical agents (1). These agents, so-called haptens, bind and modify skin proteins and molecules at the surface of antigen-presenting cells, and become allergens recognized by CD4+ T-lymphocytes (Scheme 1). Allergic contact dermatitis and psoriasis, are the most common chronic inflammatory skin diseases induced by T-lymphocytes in humans.
Scheme 1. Antigen presentation
T - T lymphocyte; LC - Langerhans cell; CD4 - cluster of differentiation 4; MHC II - major histocompatibility complex II; TCR - T-cell receptor; AG – antigen; CD2 - cluster of differentiation 2; LFA 3 - lymphocyte function associated antigen 3; LFA1 - lymphocyte function associated antigen 1; ICAM-1 - Intercellular adhesion molecule 1; ICAM-3 - Intercellular adhesion molecule 3; CD28 - cluster of differentiation 28; B7 - Antigen B7
Journal of Society for development in new net environment in B&H
2139
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The differentiation of T-lymphocytes in the thymus is achieved under the induction effects of enzymes which are programmed and supposedly coded by major histocompatibility genes, HLA system. Although there is still no consensus on which HLA phenotype combinations are associated with a significant risk for the development of allergic contact dermatitis, the Allergy Department of the Clinic of Dermatovenereology Diseases in Novi Sad, in association with the Blood Transfusion Institute of the Faculty of Medicine in Novi Sad, conducted a HLA typization of patients with allergic contact dermatitis, which was among the first of its kind in the world (1,6). A statistically significant frequency of A28 antigen, as well as absence of B13 and BW41 antigens in our patients with allergic contact dermatitis (confirmed by positive patch testing), may be considered as our contribution to solving the genetic component of the etiopathogenesis of this disease (6). The prevalence of contact sensitivity and its clinical manifestation – allergic contact dermatitis in general population is significant and it is constantly increasing (7), ranging from 18.6% to 40% (8). High occurrence of contact sensitivity points to a statistically significant association between anamnestic data on adverse effects on the skin and previous diagnosis of allergic contact dermatitis (8). Comparing skin and laboratory tests, in order to establish the diagnosis of medication contact dermatitis, a low negative statistically insignificant association was found between patch tests and lymphocyte transformation tests, as well as between patch tests and leukocyte migration inhibition tests (9). Thus, in vitro testing was not reliable as an investigation for medicament contact allergy (10). Epicutaneous patch testing is still regarded as the best method for diagnosing contact sensitivity, and the number of tested persons increases every year (7). Lymphocyte transformation tests are routinely used for diagnosing drug allergy by in vitro testing (11). In relation to contact allergens used in patch testing, it is important to point out that in the mideighties, apart from using commercial products, we formed a standard and a number of specific series of epicutaneous allergens, with the aim of assessing the correlation of results gathered by these two types of investigations (12). In this way 2140
we proved the validity of using standard series of patch testing allergens, since, complex commercial products often contain smaller concentrations of allergens (causative agents), compared to those needed for positive tests (13). We created a standard battery of allergens as a basic series adapted to our environment in a certain period of time. We also formed specific series suitable for a great number of occupations, providing testing of occupational allergic contact dermatitis (14, 15). In the period from 1991 to 1996, 2.119 connective persons underwent patch testing to standard epicutaneous allergens in the Allergy Department of the Clinic of Dermatovenereology Diseases in Novi Sad. The gathered results showed that most positive patch test reactions were to nickle-sulphate, fragrance mix, potassium dichromate, Balsam of Peru, formaldehyde and cobalt chloride. These results differed from results gathered in the first period of research conducted till 1991, giving the true picture of tendencies considering the incidence of contact sensitivity to certain allergens during several years of research at this Department, by which we were closer to the greatest extent to the existing tendencies in the leading European countries. A great decrease in frequency of contact sensitivity to potassium dichromate was reported: from 22.04% in 1987 to 5.93% in 1995, which was of utmost importance regarding risks from occupational exposure (14). As soon as the late eighties, apart from the domestic allergens produced by Torlak® (Belgrade, Serbia), we started using allergens produced by Hermal-Trolab®, Reinbek, Germany. Allergens were applied on Finn Chambers on Scanpor tape (Epitest Ltd Oy, Finland) and Curatest® (LohmanRauschen, Neuwied, Germany). Sensitivity rates for each allergen were standardized according to patients’ sex and age. Contact sensitivity was defined as a positive patch test to at least one of 44 ubiquitous contact allergens, whereas our research included also inpatients with chronic plaque psoriasis. We examined the frequency, etiology of contact sensitivity and its association with the severity of psoriasis, that was done using the Psoriasis Area Severity Index score (PASI), which represents the widely accepted assay (16,17). Testing was performed with allergens of the European standard series adapted to our environment, allergens of
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
plant origin, standard allergen from the Compositae family, as well as with originally prepared ether extracts of ubiquitous weeds from the Compositae family found in our environment. In the period from 2003 to 2005, 15.123 patch tests were performed. The total sensitivity rate, standardized according to sex and age, was reported as follows: 18.9% in patients with psoriasis, 28.1% in patients with atopic dermatitis, 61.8% in patients with allergic contact dermatitis, and 21.3% in healthy controls. The sensitivity rate, standardized according to age (27.7%), was significantly higher in women suffering from psoriasis (two-tailed p=0.02) in regard to mail patients with psoriasis (5.8%). Male psoriatic patients showed a lower sensitivity rate than healthy control men (5.8% vs. 24.1%), but this difference was on the border of statistical significance (two-tailed p=0.08; one-tailed p=0.04) (16). There was no relationship between the severity of psoriasis and patch test reactions. The most common allergens found in the group of patients with psoriasis included: yarrow extract and nickel; in patients with atopic dermatitis – arnica extract and nickel, and in patients with allergic contact dermatitis – nickel and potassium dichlorate. These are the first test results of patients with psoriasis reacting to ubiquitous weeds reported in the world literature (Fig. 1) (16). Although patch testing of psoriatic patients is a great challenge, it takes a long time and requires great experience, providing new knowledge about pathophysiology of psoriasis. This research has opened the door to further studies in the aim of detecting other factors, independent of exposure, which may also be responsible for differences in the frequency of contact sensitivity associated with the sex of patients (16). Occupational allergic contact Dermatitis Occupational allergic contact dermatitis is the most common occupational dermatitis. Its incidence is associated with variations that depend on economic factors and geographical features of certain areas, sex and age distribution of the affected patients, expertise of health professionals and the entire national system of legal regulations (18). The results of studies conducted in different parts of the world are often controversial, and it may be
Figure 1. Patch test reactions to Ambrosia artemisiaefolia (ether extract 1%, 3% and 10% in petrolatum) explained by the lack of a standardized diagnostic procedures. This problem has not been resolved yet (19). According to the Provincial Registry of occupational diseases of the Institute of Occupational Health in Novi Sad, in the period 1988 – 1996, occupational dermatoses accounted for 47.75% of all occupational diseases (occupational injuries were excluded), which is in agreement with literature data (14). We have established that occupational allergic contact dermatitis accounted for 38.5% of all (both allergic and irritation) cases of occupational contact dermatitis diagnosed in the Allergy Department of the Clinic of Dermatovenereology Diseases in Novi Sad during the research period (14). According to the Provincial Registry of occupational diseases of the Institute of Occupational Health in Novi Sad, in the period 1997 – 2009, occupational dermatoses accounted for 30% of all occupational diseases. Occupational contact dermatitis accounted for 90% of all 2141
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
occupational dermatoses diagnosed during the research period (unpublished data). Out of the total number of patients who underwent patch-testing in the Allergy Department in Novi Sad, from 1991 to 1996, 49.12% were tested due to suspected allergic contact dermatitis, whereas clinically relevant allergic sensitivity was established in 39.37%. In relation to the total number of patients with allergic contact dermatitis, 55.33% showed allergic sensitivity to occupational allergens. The most frequent etiological factor was potassium dichromate. These findings were in agreement with literature data, according to which allergic contact dermatitis accounted for 50% of all cases of allergic contact dermatitis. Potassium dichromate still presents the most common cause of occupational allergic contact dermatitis in those countries, like ours, without legal regulations regarding addition of ferrous-sulphate to cement (reducing the water soluble chromium VI to less soluble chromium III) (14). The frequency of occupational contact dermatitis has increased in dental care personnel. Dental materials may be hazardous to dental patients as well. Thus, we assessed contact allergy to dental acrylic resins both in dental professionals and in users. The study included all individuals with suspected contact allergy to dental material that were referred for patch testing between 1992 and 2008. This study on contact allergy to dental materials in Vojvodina demonstrated the liquid material containing the methyl methacrylate monomer, used as the acrylic denture-base material, as the main source of sensitization, both in those handling dental products and in patients with orofacial complaints (20). Compositae Dermatitis Compositae dermatitis is an allergic contact dermatitis caused by plant species of the Compositae family (Asteraceae). It was first described in 1919, as a classic, so-called airborne dermatitis, that affects all skin surfaces exposed to the air. Apart from the generalized form, there are localized forms of Compositae dermatitis, for example eczema of hands and/or face (21). It may appear in all parts of the world, sometimes causing dermatitis of epidemic proportions. It is known by 2142
various names: in America it is called ragweed dermatitis caused by wormwood ambrosia (Ambrosia artemisiaefolia), in India parthenium dermatitis (caused by Parthenium hysterophorus). In the last two decades, allergens of Compositae plants are among the ten most common causes of contact sensitivity in the countries of Northern Europe, and this was also confirmed in our patients tested in the Allergy Department in Novi Sad (16, 21). Contact sensitivity caused by Compositae plants is clinically significant, accounting for over 75% of cases with contact dermatitis, which was confirmed by our researches as well (16, 22). In Northern Europe, a cultivated Copmositae plant, Chrysanthemum indicum, is considered to be a major sensitizer; among the edible types it is lettuce (Lactuca sativa, Cichorium endivia), and among weeds they are feverfew (Tanacetum parthenium), tansy (Tanacetum vulgare) and dandelion (Taraxacum officinale) (21). In our region, the most common causes for contact sensitivity are ambrosia extracts – Ambrosia artemisiaefolia; common wormwood – Artemisia vulgaris, and arnica extract (Arnica montana) in patients with atopic dermatitis, and yarrow (Achillea millefolium) in patients with psoriasis (Table 1.) (16). The main nonpollen allergens in Compositae plants are terpenes from the group of sesquiterpene lactones (SL). Most sesquiterpene lactones are lipophylic molecules found mainly in the oleoresin fraction of the stem, leaf and flower of the Compositae plants. Around 1350 different SLs are classified into six basic structure classes. The most important allergenic SLs are those in the first four classes. Cross reaction between SL present in various kinds of Compositae plants is responsible for the fact that a positive epicutaneous test has an immunologic, but not an ecologic significance. Presence of the same SL in different plants induces pseudo-cross sensitivity. The commercial mix of 3 sesquiterpene lactones (alactolactone, dehydrocostus lactone, and costunolide), the so-called SL-mix (sesquiterpene lactone mix) is a screening agent for the diagnosis of Compositae dermatitis, and it is in the extended standard series of contact allergens in many European countries. The prevalence of positive patch testing with routine SL mix ranges between 0.7 and 3.7 that is in agreement with our studies (16, 22, 23). Although rou-
Journal of Society for development in new net environment in B&H
Table 1. Ten highest sensitization rates (%) to Compositae weed extracts in analyzed groups: crude and standardized by age and sex, and rates in women and men both standardized by age
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Group Allergen
Achillea millefolium Yarrow 7.1 4.5 6.0 1.0 4.0 3.0 3.6 4.6 Ambrosia 10% Tansy 5.3 2.2 1.3 2.0 1.6 7.6 Arnica montana Arnica 5.3 2.1 1.3 2.1 1.6 Chamomilla recutita German chamomile 1.7 0.7 0.0 Tanacetum vulgare Tansy 1.7 Ambrosia 3% Ragweed 3% Artemisia vulgaris 3 mugwort 3% Artemisia vulgaris 1% mugwort 1% 1.7 0.7 0.0 1.8 0.7 2.4 1.4 0.0
P (n=56) CR A WA MA AS CR A
A (n=65) WA MA AS CR
2.7 3.0
CD(n=100) A
3.2
C (n=75)
WA MA AS CR
2.7
A
WA MA AS
1.8
2.3
5.3
3.1
4.6
0.0
2.7
4.5
2.6
3.0
3.2
2.2
5.5
3.5
5.3
4.5
2.6
9.2
5.2
13.8 12.1 15.3
3.7
10.6
3.0
2.9
0.9
5.5
2.7
4.0
3.3
3.1
3.7
3.2
9.2
4.7
4.6
4.5
4.6
4.0
3.2
2.6
3.2
2.8
4.0
2.6
3.8
0.0
2.3
1.0
0.4
6.1
5.7
7.8
0.7
4.4
1.0
0.6
0.0
1.8
0.7
1.3
0.5
0.7
0.0
0.4
0.7
0.0
1.0
0.4
0.0
0.0
0.0
0.0
0.0
3.0
3.2
2.2
5.5
3.5
0.0
0.0
0.0
0.0
0.0
1.7
0.7
0.0
1.0
0.4
0.0
0.0
0.0
0.0
0.0
3.0
1.4
0.0
7.1
3.1
0.0
0.0
0.0
0.0
0.0
1.7
0.7
0.0
1.0
0.4
0.0
0.0
0.0
0.0
0.0
2.0
1.0
0.0
5.5
2.2
0.0
0.0
0.0
0.0
0.0
n - number of tested in each group; * - tested 33; P - psoriasis; CD - contact dermatitis; A - atopic dermatitis; C - healthy controls; CR - crude rate; A - rate standardized by age; WA - rate in women standardized by age; MA - rate in men standardized by age; AS - total rate (in women and men) standardized by age and sex
Journal of Society for development in new net environment in B&H
2143
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
tine testing with SL mix has been considered safe (irritation and active sensitization under 0.1%) the prevalence of irritant reactions among our SL mixpositive examinees was 3.4% (22). Moreover, only 1/3 to 2/3 of all Compositae allergic persons can be detected by this allergen screening testing. By simultaneous testing using dandelion flower extract (Taraxacum officinale), which proved to be safe, we have increased the Compositae sensitivity rate from 3.4%, by using SL mix testing, to 4.7% (22, 24). Thus, supplementary testing with dandelion extract has increased the number of Compositaeallergic subjects identified (10). The greatest sensitivity rate to SL mix was found in persons with extrinsic atopic dermatitis, accounting for 50% of all SL mix-positive subjects (16, 22). Investigation of the frequency of contact sensitivity caused by Compositae plants in patients with atopic dermatitis is one of the most important goals in contemporary allergology and dermatology (25, 26). It is due to the following reasons: 1) in recent decades, the prevalence and incidence of atopic dermatitis in developed countries are significantly increasing; 2) in the etiopathology of atopic dermatitis, allergy to ubiquitous inhaled allergens and nutritional allergens raises controversial opinions (27, 28); 3) the importance of direct skin contacts of patients with substances surrounding them is constantly growing (29). To analyze the frequency of contact sensitivity caused by Compositae plants in patients with atopic dermatitis, we used two commercially available screening allergens, sesquiterpene lactone
mix (SL mix) and a compositae mix (C mix) consisting of ether extracts of 5 European Compositae plants: arnica extract (Arnica montana), chamomile extract (Chamomilla recutita), tansy extract (Tanacetum vulgare), feverfew extract (Tanacetum parthenium), and yarrow extract (Achillea millefolium) (Table 2.). The total prevalence of contact sensitivity to plants from the Compositae family, which accounted for 30% among our patients with atopic dermatitis, basically represents the sensitivity rate to SL mix of 10%, which was additionally increased by 20% using safe testing by Compositae plants mix (C mix) (30). According to the literature data, the prevalence of atopic dermatitis among patients with Compositae sensitivity reaches 28% (31). Due to the fact that our research is among the first in the world, it speaks in favor of the fact that atopia is a risk factor for Compositae dermatitis (30). Furthermore, based on the results of the large European investigations and our study, testing with individual ingredients of mixes may be valuable in tracing the offending plants, but this may vary between different geographical regions (30, 32-35). Plant life is exceedingly diverse, with seasonal variation, and consequently the range of reported allergens is huge (36). Although it has not been proven that SL has phototoxic or photoallergic effects (37), about 85% of persons with chronic actinic dermatitis (CAD) show positive patch tests to SL mix and/or Compositae plants extracts. Compositae dermatitis may trigger chronic actinic dermatosis (37), and it was experimentally deter-
Table 2. Positive patch test reactions to Compositae mix reported in different authors (27)
Report Extract Arnica Montana Arnica Chamomilla recutiata German chamomile Tanacetum vulgare Tansy Tanacetum parthenium Feverfew Achillea millefolium Yarrow Jovanovic (30) n=9 Positive (%) 44.4 55.5 22.2 22.2 0.0 Goulden (32) n=26 Positive (%) 3.8 15.3 53.8 46.1 50.0 Paulsen (31) n=23 Positive (%) 0.0 75.0 54.1 90.9 33.3 Paulsen (33) n=129 Positive (%) 23.2 64.3 76.7 81.6 41.1 Hausen (35) n=118 Positive (%) 51.8 56.5 54.8 70.1 51.8
Number in parenthesis - reference numbered in literature; n - number of tested patients
2144
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
mined that constituents of Compositae plants (polyacetylenes and their derivatives) have phototoxic effects through histidine photooxidation, whereas albumin gets properties of a so-called neoantigen. Under the influence of UV exposure, it is continuously rebuilt in small quantities. It is also known that alpha-methylene-gamma-butyrolactone group easily forms covalent bonds (SH-type) with cellular proteins, transforming them to antigens. It has been established that alpha-methylene group on the gamma-lactone ring of SL has photoreactive effects on the DNA basis thymine, together forming a 2+2 photoproduct which acquires the role of cellular neoantigen (38). Presence of photoagents in the skin is associated with a permanent intercellular adhesion molecule-I (ICAM) expression on keratinocytes and, in persons with contact dermatitis, with influx of memory cells, that is specific T-lymphocytes clones which are sensitive to SL from Compositae plants (CD4 + CLA + 45RO+T-ly) (Scheme 2.) (38).
Current position in dermatology assumes that in each patient with a clinical picture of contact dermatitis, a dermatologist must always exclude presence of contact sensitivity caused by plants (40). Contact Erythema Multiforme Erythema multiforme is an acute, in some cases recurrent, or very rarely, persistent dermatitis characterized by target lesions, with or without mucous membrane involvement. Together with StevensJohnson syndrome and toxic epidermal necrolysis, erythema multiforme, with two clinical variants: less severe (erythema multiforme minor), and severe (erythema multiforme major), is a part of the same nosological spectrum. Erythema multiforme is a reaction of the cellular immune system to antigens presented by antigen-presenting cells present in the skin (41). The stage of this reaction depends on: 1) the nature of antigen, which is, in about 75% of classic so-called postherpetic erythema multiforme, represented by herpes simplex virus, whereas in about 85% of patients with StevensJohnson syndrome, and 95% of patients with toxic epidermal necrolysis it is drug induced, mostly by sulfonamides; 2) HLA-molecules in the epidermal layer of the skin, primarily keratinocytes, which present these antigens within the HLA-system. Erythema multiforme, caused by skin contact with various agents, mosly chemicals (1), so-called contact erythema multiforme, is a non-eczematous manifestation of contact sensitivity, where acute type IV sensitivity involves participation of a cytotoxic mechanism. The contact allergen is either a strong sensitizer, or comes into contact with the skin in high concentrations or during prolonged, repeated intervals. In generalized forms of the disease, the quantity of percutaneously absorbed allergen leads to formation and deposition of immune complexes within the blood vessel walls at distant sites (type III or “id”-like reaction (42). Contact erythema multiforme is well known to be induced by contact allergy to tropical woods and plants from the Compositae family (Arthemisia vulgaris, Inula helenium), Primulaceae (primrose), Anacardiaceae (poison ivy), Toxicodendron radicans, Hypericaceae (Hyperum erectum - thunb) and Salinaceae (Capsicum – pepper) 2145
Scheme 2. Compositae dermatitis trigger for chronic actinic dermatitis (21)
CD - Compositae dermatitis; CAD - Chronic actinic dermatitis; SL - sesquiterpene lactone; PA – polyacetylenes; K - keratinocyte ICAM-1 - intercellular adhesion molecule 1; CD4+CLA+45RO+T ly - Memory T-cells reactive with skin associated antigens
With the continuously increasing production and use of preparations which contain various plant extracts, an increase of adverse effects due to their use may be expected. Further investigations were directed to the research of the chemical structure of etheric oils obtained from plants which are ubiquitous in our region, as well as their clinical effects during their local application (39).
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
(1). What is rarely seen is its exacerbation during epicutaneous patch testing. Erythema multiforme was described by Cavendish during patch testing to 9-bromofluorene in 1940 (43), by Friedman and Perry to nickel-sulphate in 1985 (44), and by O’Donnell and Tan to colophonium and fragrance mix in 1992 (42). The diagnosis of contact erythema multiforme is confirmed by patch testing, like in other cases of erythema multiforme, StevensJohnson syndrome and toxic epidermal necrolysis. What is extremely important, and provides academic and medico-legal diagnostic importance, is exacerbation of contact erythema multiforme during patch testing. A case of a recurrent contact erythema multiforme was confirmed in our Allergy Department in a garden worker after contact with weed plants from Compositae family, Taraxacum officinale (dandelions), Sonchus arvensis (field sow thistle), Trifolium repens (white clover), and Caryophyllaceae family, Stellaria media (common chickweed) (10, 45). Contact erythema multiforme symptoms aggravated by occupational exposure and exacerbated during patch and photo patch testing. According to available literature data, this was the fourth case of erythema multiforme associated with epicutaneous testing described in the world (45). Contact urticaria Contact urticaria is an immediate but transient localized swelling (angioedema) and redness of the skin or mucous membranes, commonly caused by contact with certain substances. It usually occurs within the first 30 – 60 minutes after exposure, and disappears within 24 hours. There are no vesicles and necrosis. As a phenomenon of early contact reactions, contact urticaria attracted more attention in the last decade, so that knowledge on its etiology, pathomechanism, pathohistological and immunohistochemical dynamics has widened to the point that the term contact urticaria does not include only occurrence of erythema and edema, but also of other types of early contact reactions (46, 47). Within the concept of contact urticaria, we are more and more encountered with the following terms: a) early contact reaction; b) contact urticaria; c) protein contact dermatitis; d) atopic contact dermatitis; e) 2146
contact urticaria syndrome. The common and major feature of these reactions is appearance of signs and symptoms within 30 – 60 minutes after contact of a healthy or damaged skin with substances that can be easily and quickly absorbed. Bearing in mind all the previous investigations and results we have today, we can rightly assume that a same mechanism is the base for the occurrence of each of the five above-mentioned entities. The list of terms remains relatively long. That is why further multidisciplinary investigations are necessary (47). Contact urticaria (CU) may be classified into one of the following categories: 1) immunologic CU; 2) non-immunologic CU; and 3) CU caused by unknown mechanisms, which involves characteristics of the first two (46). Non immunologic contact urticaria is the most commonly encountered type. To a large extent it is not fully understood yet, the pathomechanism of non immunologic contact urticaria excludes the possibility of direct participation of both humoral and cellular immunologic responses that result in histamine and other inflammatory mediators release. Firstly, agents causing non immunologic contact urticaria, called primary contact urticariogenic agents, exert their urticariogenic properties at the first contact with the skin or mucous membranes, without achieving necessary previous degree of sensitivity. Strength of the reaction depends on the concentrations of urticariogenic agent. What separates the ability of an agent to cause contact urticaria from a simple skin irritation is the fact that the concentration must be well bellow the irritation. The assumption is that the primary contact urticariogen exerts its activity either through direct action on the endothelium of blood vessels, or by non immunologic release of inflammatory mediators by degranulation of the primary effector cells, mast cells and basophils. Certain primary contact urticariogens exert direct toxic effects and activate keratinocytes, which then produce cytokines, or exprimate adhesion molecules on their surface, while some (for example cobalt-chloride) directly activate vascular endothelial cells through expression of adhesion molecules, which through leukocyte adhesion, results with increased vascular permeability. Apart from histamine, other inflammatory mediators, especially prostaglandins, are attributed an important role (46).
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Agents causing contact urticaria include metals (e.g., nickel, rhodium and platinum, which cause immunologic contact urticaria, and cobalt which causes nonimmunologic contact urticaria), foods, fragrances and fragrant substances, medications and rubefacients, germicides and preservatives, plants, animals and their tissues, urine and secretions, various physical factors and medications (48). It is also noteworthy that some contact urticariogens may show ambivalence: primary contact urticariogens cause contact urticaria in most people, but only in a small number of those with earlier sensitization, the reaction is allergic and of early onset (for example: Balsam of Peru, cinnamic and benzoic acids, formaldehyde). Allergy Department of the Clinic of Dermatovenereology Diseases in Novi Sad was among the first in Europe to investigate contact urticaria reactions to certain substances from the originally formed battery of allergens to contact urticaria, consisting of materials known to cause nonimmunologic, immunologic or contact urticaria of unknown pathomechanism (5). We started a series of researches in order to determine the etiological factors and frequency of contact urticaria reactions, not only in contact dermatitis, but also in patients with atopic dermatitis and chronic urticaria (5). These diseases have common manifestations of both types of immunologic responses, whereas contact urticaria contains it in its name, having both immunologic and nonimmunologic ambivalence, even if it refers to one etiological agent. It was logical to assume that determination of clinical significance, etiology and clinical prevalence of contact urticaria, both immunologic and nonimmunologic, in these diseases would confirm these facts as well. However, the results gathered during a 20-year research showed that the prevalence on nonimmunologic contact urticaria was highest in persons with idiopathic chronic urticaria, and that the difference in regard to healthy persons was statistically significant (p<0.05). We also examined the effects of antihistamines and nonsteroidal antiinflammatory drugs on nonimmunologic contact reactions and established that they depended on the type of allergen, type of drug, and duration of medication treatment (5). To survey the effects of various mixed contact allergens, we examined the effect of the quenching agent on non immunologic contact urticaria. The
quenching process is used in the perfume industry with the aim of suppressing contact sensitization of eczematous type caused by cinnamic aldehyde, citral and phenylacetaldehyde, by adding another agent, usually an alcohol or terpene. Based on the studies of the quenching phenomenon in contact urticaria, started by Guin and associates (49), we have established that eugenol as opposed to d-limonene, exerted quenching effect to early contact reactions caused by cinnamic aldehyde (p<0.001) (5). The answer to the question if quenching phenomenon is the future in the prevention and prophylaxis of contact sensitization requires a complex investigation. The obtained results are the contribution to finding the right answers (5). The immune mechanism involved in the development of immunologic contact urticaria is the one which requires presence of specific IgE for signal activation. Immunologic contact urticaria is most often generalized. It may be associated with systemic signs and symptoms, which may vary from mild to severe, life-threatening in case of multisystem contact urticaria syndrome (47). The occurrence of systemic signs and symptoms includes rhinitis, conjunctivitis, asthma, gastrointestinal symptoms, nausea, vomiting, diarrhea, cephalea, pruritus, angioedema, laryngeal spasm, and in most severe cases anaphylactic shock (46). Among the 73 new cases of chronic urticaria during a 5-year period at the Allergy Department of the Clinic of Dermatovenereology Diseases in Novi Sad, there were 17 (23%) cases with idiopathic chronic urticaria, and 11 (15%) cases with contact urticaria syndrome The most common cause of allergy was food (27%), wheat flour was included. Occupational etiology was identified in 63% of cases, but there were no cases with atopic disorders (5). Immunologic contact urticaria is much less frequent than nonimmunologic contact urticaria. The actual prevalence of immunologic contact urticaria in general population is still unknown (46). Data relating to the occupational immunologic contact urticaria demonstrate differences in frequency, not only regarding different occupations, but also regarding geographical distribution. At the Occupational Dermatology Clinic in Melbourne (Australia), in the period 1994 – 2002, occupational contact urticaria was diagnosed in 143 persons, that is 9.9% 2147
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
of all patients with occupational skin diseases. The most common etiological factors causing occupational contact urticaria included natural rubber latex proteins (52%) and foods (35%), whereas the most threatened were cooks and nurses (50). In Great Britain, during a 6-year period, occupational immunologic contact urticaria was registered in 36 persons that is 0.16% of all patients with occupational skin diseases (51). The most common causes of occupational immunologic contact urticaria were chemicals used in rubber production, and foods, including flour (52). Female sex and atopia were significant risk factors for the disease (50, 52). In a 5-year period, there were 73 new cases of chronic urticaria diagnosed at the Allergy Department of the Clinic of Dermatovenereology Diseases in Novi Sad, whereas immunologic contact urticaria caused by latex was diagnosed in one case only. It was a case of occupational latex sensitivity to surgical gloves, with simultaneous development of early type I allergy, with specific IgE to latex class 4, determined by Phadezym RAST® system(Pharmacia AB, Uppsala, Sweden), and late eczematous type IV allergic sensitivity (5). The prevalence of allergic reactions to natural rubber latex proteins has been progressively increasing since the mid-eighties of the twentieth century. Latex sensitivity rate among health professionals has reached 17% due to increasing production and widespread use of non-sterile gloves made of natural rubber, with high content of latex protein, pre-powdered or corn starch powdered. In general, the powders can absorb latex proteins and carry them into the air where they become airborne causing airborne allergies. In 1997, Germany passed legislation that banned occupational use of powdered latex gloves and permitted only powderless gloves. The incidence of contact urticaria in Germany decreased by 70% (from 0.35 per 1.000 exposed persons in 1998 to 0.07 in 2002), and occupational asthma caused by latex decreased by 87.8% (53). Meynadier was among the first who investigated the occurrence of immunologic contact urticaria. He analyzed 225 new cases of chronic urticaria during a three-year period, and found only 2 cases of immunologic contact urticaria (54). The immunologic contact urticaria may cause exacerbation of chronic dermatitis, commonly affecting hands after direct contact with food pro2148
teins. Clinical symptoms include: edema, erythema, vesicles and itching which appear within 30 minutes. This condition is called protein-contact dermatitis. Although protein-contact dermatitis is more common in atopic cases, food proteins may cause immunologic contact urticaria on healthy skin of persons with or without atopia (54). Only 1 case with occupational protein-contact dermatitis was diagnosed by us during a 5-year period. It affected a baker with atopic dermatitis after contact with raw beef (55). Concluding observations Based on survey research conducted in the last two decades at the Allergy Department of the Clinic of Dermatovenereology Diseases in Novi Sad, with the aim of determining the role of certain factors in the development of contact sensitivity, we concluded the following: early contact reactions caused the development of 15% of all cases of chronic urticaria; atopic dermatitis was not a risk factor for the development of early contact reactions; non-pollen antigens of weeds were the most common causes of contact sensitivity of eczematous type in patients with atopic dermatitis, as well as in patients with psoriasis; the degree of chronic skin inflammation failed to significantly affect the development of contact eczematous allergies. The obtained results contributed to new knowledge about the etiology and pathogenesis of contact sensitivity, providing better diagnostic and treatment options to the sick and opening new horizons for further research. Acknowledgement The authors gratefully acknowledge the financial support of the Ministry of Science and Technological Development of the Republic of Serbia. Project number: 172058
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
References
1. Rietschel RL, Fowler JF, eds. Fischer's Contact Dermatitis. 6th ed. Hamilton: BC Decker Inc; 2008. 2. Rietschel RL. Human and economic impact of allergic contact dermatitis and the role of patch testing. J Am Acad Dermatol 1995;33:812-5. 3. Engkilde K, MenneT, Johansen JD. Inverse relationship between allergic contact dermatitis and type 1 diabetes mellitus: a retrospective clinic-based study. Dermatologia 2006;49:644-7. 4. Guerra L, Rogkakou A, Massacane P, Gamalero C, Compalati E, Zanella C, et al. Role of contact sensitization in chronic urticaria. J Am Acad Dermatol 2007;56:88-90. 5. Jovanovic M. Contact urticaria syndrome within contact sensitization [disertation]. Novi Sad: Novi Sad Univ.;1996. 6. Jovanovic M, Poljacki M, Milakov J, Đuran V, Stojanovic S. Phenotypization: our contribution to researching higher suspectibility of HLA phenotype combinations in the bounds of individual contact allergy predisposition [Fenotipizacija: nas doprinos ispitivanju vece prijemcivosti pojedinih kombinacija HLA fenotipova u okviru individualne predispozicije za kontaktnu alergiju]. Med Pregl 1993;46(5-6):221-4. 7. Carslen BC, Menne T, Johansen JD. 20 years of standard patch testing in a eczema population with focus on patients with multiple contact allergies. Contact Dermatitis 2007;57:76-83. 8. Schafer T, Bohler E, Ruhdorfer S, Weigl L, Wessner D, Filipiak B, et al. Epidemiology of contact allergy in adults. Allergy 2001; 56: 1192-6. 9. Jovanovic M, Poljacki M, Milakov J, Đuran V. Skin and laboratory tests: comparison between epicutaneous patch test, TTL test and LIF test in diagnosis of the medicamentous allergic contact dermatitis [Kozni i laboratorijski test; poređenje epikutanog patch testa sa TTL i LIF testom u dijagnostici medikamentoznih alergijskih dermatoza]. Med Pregl 1992;45(9-10):365-8. 10. Beck MH, Wilkinson SM. Contact Dermatitis: Allergic. In: Burns T, Breathnach S, Cox N, Griffiths C, editors. Rook’s Textbook of Dermatology. 6th ed. Oxford: Blackwell Publishing Ltd; 2010. p. 26.1-106.
11. Bozic K, Gebauer-Bukurov K, Jovanovic M, Vujanovic Lj, Slankamenac P. Serious rash ater prolonge use of lamotrigine - report of four cases. HealthMed 2011;5(3):425-8. 12. Jovanovic M, Milakov J. Epicutaneous testing with standard allergens and the forming specific batteries according to professions [Epikutano testiranje na standardne alergene i formiranje specificnih baterija po profesijama]. Med Pregl 1990;43(7-8):323-7. 13. Jovanovic M, Milakov J. The justification of introducing specific patch test series in contact allergy [Opravdanost uvođenja specificnih patch test serija u dijagnostici kontaktne alergije]. Med Pregl 1990; 43(5-6):242-6. 14. Jovanovic M. Occupational dermatoses [Profesionalne dermatoze]. U: Karadaglic Đ, editor. Dermatologija. Beograd: Vojnoizdavacki zavod; 2000. p. 451-73. 15. Jovanovic M, Poljacki M. Antabuse-alcohol reaction and aggravation of allergic contact dermatitis lesions during epicutaneous testing with thiuram [Reakcija antabus-alkohol i egzacerbacija alergijskog kontaktnog dermatitisa u toku epikutanog testiranja na tiuram]. Acta Dermatovenerol Iugosl 1996; 19:33-44. 16. Jovanovic M, Boża P, Karadaglic Đ, Brkic S, Petrovic A, Mimica-Dukic N, et al. Contact sensitivity in patients with psoriasis in Vojvodina. Int Arch Allergy Immunol 2009;148:311-20. 17. Suljagic E, Hadzigrahic N, Kamberovic S, Sijercic N. NbUVB phototherapy for the treatment in psoriasis: the co-relation between the number of conducted illuminations and recovery speed of different body regions. HealthMed 2009;3(4):456-61. 18. Belsito D. Occupational contact dermatitis: etiology, prevalence, and resultant impairment/disability. J Am Acad Dermatol 2005;53:303-13. 19. Keegel T, Moyle M, Dharmage S, Frowen K, Nixon R. The epidemiology of occupational contact dermatitis (1990-2007): a systemic review. Int J Dermatol 2009;48:571-8. 20. Jovanovic M, Brkic S, Turkalj I, Vujanovic Lj, Mikov I. Contact allergy to acrylate-based dental materials in users and in dental professionals. HealthMed 2010;4(4):792-7.
Journal of Society for development in new net environment in B&H
2149
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
21. Jovanovic M, Poljacki M. Compositae dermatitis. Med Pregl 2003;56:43–9. 22. Jovanovic M, Poljacki M, Mimica-Dukic N, Boza P, Vujanovic LJ, Đuran V, et al. Sesquiterpene lactone mix patch testing supplemented with dandelion extract in patients with allergic contact dermatitis, atopic dermatitis and non-allergic chronic inflammatory skin diseases. Contact Dermatitis 2004; 51:101–10. 23. The ESSCA writing group. The European surveillance system of contact allergies (ESSCA): results of patch testing the standard series, 2004. J Eur Acad Dermatol Venereol 2008;22:174-81. 24. Poljacki M, Jovanovic M, Pal B, Mimica-Dukic N, Petrovic A, Novovic Z. Is Vojvodina a risk area for contact weed allergies? [Da li je Vojvodina rizicna zona za pojavu kontaktne preosetljivosti na korovske biljke]? Med. Pregl 2005;58(3-4):123-6. 25. Nettis E, Colanardi MC, Soccio AL, Ferrannini A, Tursi A. Occupational irritant and allergic contact dermatitis among healthcare workers. Contact Dermatitis 2002;46:101-7. 26. Wintzen M, Donker AS, van Zuuren EJ. Recalcitrant atopic dermatitis due to allergy to Compositae. Contact Dermatitis 2003;48:87-8. 27. Wuthrich B, Shmid-Grendelmeier P. The atopic eczema/dermatitis syndrome, epidemiology, natural course and immunology of the IgE-associated (extrinsic) and non allergic (intrisic) AEDS. J Invest Allerg Clin Immunol 2003;13:1-5. 28. Maksimovic N, Tomic-Spiric V, Jankovic S, Jovic-Vranes A, Terzic-Spuric Z, Jankovic J. Risk factors of allergic rhinitis: a case-control study. HealthMed 2010;4(1):63-70. 29. Akhavan A, Cohen SR. The relationship between atopic dermatitis and contact dermatitis. Clin Dermatol 2003;21:158-62. 30. Jovanovic M, Poljacki M, Đuran V, Vujanovic Lj, Sente R, Stojanovic S. Contact allergy to Compositae plants in patients with atopic dermatitis [Kontaktna senzibilizacija izazvana Compositae biljkama kod oboleleih od atopijskog dermatitisa]. Med Pregl 2004;57:209–18. 31. Paulsen E, Andersen KE, Hausen BM. An 8-year experience with routine SL mix patch testing supplemented with Compositae mix in Denmark. Contact Dermatitis 2001;45:29-35.
32. Goulden V, Wilkinson SM. Patch testing for Compositae allergy. Br J Dermatol 1998; 138: 1018-21. 33. Paulsen E, Andersen KE, Hausen BM. Compositae dermatitis in a Danish dermatology department in one year (I). Contact Dermatitis 1993;29:6-10. 34. Paulsen E, Andersen KE, Hausen BM. Sensitization and cross-reaction patterns in Danish Compositae -allergic patients. Contact Dermatitis 2001;45:197-204. 35. Hausen BM. A 6-year experience with Compositae mix. Am J Contact Dermat 1996;7:94-9. 36. Le Coz CJ, Ducombs G. Plants and plant products. In: Frosch PJ, Menné T, Lepoittevin JP, editors. Contact Dermatitis, 4th ed. Berlin: Springer; 2006. p. 751–800. 37. Jovanovic M. Fotodermatoze. U: Poljacki M, Jovanovic M, Đuran V. Novine u dijagnostici i terapiji dermatoloskih oboljenja. Novi Sad: ARTAS; 2006. p. 41-70. 38. Patel BB, Waddell TG, Pagni RM. Explaining photodermatosis: cyclopentenone vs. alfa-methylene-gamma-lactone natural products. Fitoterapia 2001;72:511-5. 39. Duran V, Matic M, Jovanovic M, Mimica N, Gajinov Z, Poljacki M, et al. Results of the clinical examination of an ointment with the marigold (Calendula officinalis) extract in the treatment of venous leg ulcers. Int J Tissue Reactions 2005;27(3):101-6. 40. Corazza M, Borghi. A, Lauriola MM, Virgili A. Use of topical herbal remedies and cosmetics: a questionnaire-based investigation in dermatology out-patients. J Eur Acad Dermatol Venereol 2009; 23:1298-303. 41. Pavlovic MD, Karadaglic Đ. Multiformni eritem i toksicna epidermalna nekroliza. U: Karadaglic Đ, editor. Dermatologija. Beograd: Vojnoizdavacki zavod; 2000.p. 499-517. 42. O'Donnell BFO, Tan CY. Erythema multiforme reaction to patch testing. Contact Dermatitis 1992;27:230-4. 43. Cavendish AA. A "peculiar" reaction to a patch test following exposure to 9 bromofluorene. Br J Dermatol 1940;52:155.
2150
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
44. Friedman SJ, Perry HO. Erythema multiforme associated with contact dermatitis. Contact Dermatitis 1985;12:21-3. 45. Jovanovic M, Mimica - Dukic N, Poljacki M, Boza P. Erythema multiforme due to contact with weeds: a recurrence after patch testing. Contact Dermatitis 2003;48:17-25. 46. Bashir S, Maibach HI. Urticaria, contact syndrome. In: eMedicine Clinical Knowledge Base (database on the Internet). eMedicine.com;c2009 – (updated 2009 February 11 cited). Available from: url:http://www.emedicine.com/article/1050166print 47. Amaro C, Goossens A. Immunological occupational contact urticaria and contact dermatitis from proteins: a review. Contact Dermatitis 2008;58:67-75. 48. Jovanovic M, Karadaglic Đ, Brkic S. Contact urticaria and allergic contact dermatitis to lidocaine in a patient sensitive to benzocaine and propolis. Contact Dermatitis 2006;54:124-6. 49. Guin JD, Meyer BN, Drake RD, Haffley P. The effect of quenching agens on contact urticaria caused by cinnamic aldehyde. J Am Acad Dermatol 1984;10:45-51. 50. Williams JD, Lee AY, Matheson MC, Frowen KE, Noonan AM, Nixon RL. Occupational contact urticaria: Australian data. Br J Dermatol 2008;159:125-31. 51. Cherry N, Meyer JD, Adisesh A, Owen-Smith V, Swales C, Beck MH. Surveillance of occupational skin diseases: EPIDERM and OPRA. Br J Dermatol 2000;142:1128-34. 52. McDonald, Beck MH, Chen Y, Cherry NM. Incidence by occupation and industry of work-related skin diseases in the United Kingdom, 1996-2001. Occup Med 2006;56:398-405. 53. Allmers H, Schmengler J, John SM. Decreasing incidence of occupational urticaria caused by natural rubber latex allergy in Germain health care workers. J Allergy Clin Immunol 2004;114:347-51. 54. Meynadier J, Guillot B, Boulanger A, Meynadier JM, Pourailly F. Etiology of cronic urticaria-a series of 225 new cases. In: Champion RH, Greaves MW, Black AK, Pye RJ, editors. The urticarias. Edinburgh: Churchill-Livingstone; 1985. p. 130-1.
55. Jovanovic M, Oliwiecki S. Beck MH. Occupational contact urticaria from beef associated with hand eczema. Contact Dermatitis 1992;27:188-9. Corresponding author Marina Jovanovic, Clinic of Dermatovenereology Diseases, Clinical Center of Vojvodina, Novi Sad, Republic of Serbia , E-mail: brkics@uns.ac.rs
Journal of Society for development in new net environment in B&H
2151
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Subdural Empyema associated with Orbital Cellulitis and Petrositis
Aleksandra Stojadinovic1, Nevenka Roncevic2, Svetlana Kuzmanovic1 , Marija Knezevic-Pogancev1, Aleksandar Milojevic1
1 2
Pedatric Clinic, Institut of Health Care of Children and Adolescents of Vojvodina, Serbia, Medical faculty of Novi Sad, University of Novi Sad, Serbia.
Abstract Subdural empyema is a rare intracranial infection that requires prompt diagnosis and adequate therapy. The treatment most frequently includes surgical procedure and antimicrobial therapy. There are reports on cases of subdural empyema associated with orbital cellulitis or petrositis; however, simultaneous occurrence of all three complications has not been reported in the available literature. We presented the case of subdural empyema associated with orbital cellulitis and petrositis in a ten-year old boy. Antimicrobial therapy without surgical treatment was administered resulting in a recovery without sequelae. Key words: subdural empyema, petrositis, orbital cellulitis, child Introduction Subdural empyema is an intracranial focal collection of purulent material located between the dura mater and the arachnoid mater. Precise literature data on incidence rates of subdural empyema are not available, but it accounts for about 15-22% of pyogenic intracranial infections (1,2). Common causative organisms are anaerobes and microaerophilic streptococci, particularly members of Streptococcus milleri group (Streptococus milleri and Streptococcus anginosus), but also the Staphylococcus aureus and gram-negative bacteria such as Escherichia coli and Bacteroides species. Mixed infections are also identified (5,6). Most common agents in children are Streptococcus pneumoniae, Group B Streptococcus (GBS), Haemophilus influenzae (5,6). In a series of 31 cases of subdural empyema in children the most 2152
frequently identified causative agents were Streptococcus pneumoniae, Group B Streptococcus (GBS), Haemophilus influenzae, Salmonella sp., Escherichia coli and Pseudomonas aeruginosa. (6) Subdural empyema most commonly develops by extension of the infection from paranasal sinuses, especially from the frontal and ethmoidal ones. (3) It could also arise as a complication of otitis media, mastoiditis, septicemia, cranial trauma, cranial surgery, by spread from an intracerebral abscess, by hematogenous spread from the lungs or from septic thrombosis of cranial veins. (3,4) In the pre-antibiotic era, the mortality rate approached 100%. New developments in the field of diagnostics, application of magnetic resonance and high-resolution computed tomography, improvements in surgical treatment and effective antimicrobial therapy resulted in significant decline of morbidity and mortality rates associated with subdural empyema. In the developed countries, the mortality rate has improved tremendously, ranging between about 6 and 35%. (3,7,8,9) The early recognition of the disease, institution of aggressive antimicrobial therapy during 3-6 weeks and surgical treatment mostly enable the patient a good chance of recovery with minimal or no neurological sequelae. Case report A 10-year old boy got sick ten days prior to admission to the hospital and presented with signs of left-sided neck pain, head bent to the left, difficulties with mouth opening, speaking and swallowing, fatigue, and appetite loss. The child was examined by a surgeon, who advised the cervical collar to relieve torticollis. The pain persi-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
sted for the following few days. Two days before the admission the fever (39ºC) occurred, rising to 40o C at the day of the admission. The boy had extreme fatigue and refused food and drink. Two weeks before onset of symptoms the patient had infection of upper respiratory tract, with nasal secretion, sneezing and elevated body temperature. He was receiving antipyretics during 3 days. The patient had no history of previous severe infection. At examination the child was conscious, adynamic, with obvious movement and speaking difficulties. His head was bent to the left, he had difficulty to open the mouth, and his speech was poorly articulated. The boy was pale, with marked eye circles. His temperature was 37ºC, heart rate 98/min, respiratory rate 20/min, blood pressure 110/65 mmHg. Swelling and redness of the right upper and lower eyelids were present. Bulbar motor function preserved, pupils of the same size, round, reactive. Nostrils permeable. Lips dry and cracked, the tongue sticky and coated. Oral examination revealed dental caries, the teeth partly deciduous partly permanent, residues of gangrenous roots of primary teeth (75 and 85). Tonsils were enlarged with hyperemia. Otoscopic finding was normal. Neck mobility was markedly limited, tenderness in the region of upper third of M.sternocleidomastoideus was present. Brudzinski’s upper sign was not feasible due to torticollis, Brudzinski’s lower sign and Kernig’s sign were negative. ESR 120/132, CRP 192 mg/l, Le 20,23 G/l, with prevalent segmented granulocytes. Blod culture for aerobic and anaerobic bacteria and fungi were negative. Chest x-ray : normal. The finding on fundoscopic examination was normal. Ultrasound of the right orbit revealed swelling of the retrobulbar tissue: hypodensity of adipose tissue behind the bulb; beyond the N.opticus an attenuation collection congregating with the upper rectus. Ophthalmic vein was enlarged, suggesting compression from the upper side. Computed tomography of endocranium, paranasal sinuses and orbits revealed no visible pathological changes in brain parenchyma infra- and supratentorially.. Caudally and medially the anterior right orbital region displayed inhomogeneous hyperdense area involving lacrimal gland, and partly the intraorbi-
tal adipose tissue and infraorbital soft tissues. The bulb was of normal appearance, whereas interior and inferior orbital muscles are mildly edematous. Retrobulbary, there were no visible pathological changes. Paranasal cavities had normal appearance. No signs of destruction of examined bone structures were noticed. Antimicrobial therapy was introduced, applying ceftazidime and gentamicin. Seventy two hours after therapy commencement the patient was afebrile, his general condition had improved and he was feeling in a much better mood. The neck was movable in all directions. Swelling and redness of the right eye receded. The patient could open the mouth more easily and take food and drink. On day 7 of the hospitalization partial epileptic seizures occurred: convulsions of the right arm and leg, lasting from 0.5 to 3 minutes. The child is irritable, afebrile. Phenobarbital was introduced, resulting in seizure cessation. Endocranial MR revealed meningoencephalitis with subdural empyema in the duplicature of the falx, intraparietally/interoccipitally, suboccipitally and initially on the left temporal convexity. Signs of concomitant venous thrombosis of cortical veins within the region were noticed. There were focal parenchymal lesions of the left occipital and temporal lobe. Thrombosis of the sinus transversus and sigmoid sinus on the left side was evident., as weel as inflammatory process in the middle ear and mastoid on the left, with petrous apicitis. Lumbar puncture revealed slightly cloudy liquor with normal opening pressure, normal glycorrhachia, proteinorrhachia: 0,55 g/l, cytological finding: 750 granulocytes/mm3. CSF analysis for aerobic and anaerobic bacteria and fungi was negative. After consulting neurosurgeon and ENT specialist the conservative therapy with parenteral ceftadizime, vancomycin and metronidazole was continued. During following 4 days the boy was still adynamic and indisposed. On day 11 of the hospitalization he became febrile, ESR was 70/100, Le 22,9 G/l. Endocranial CT with intravenous contrast demonstrated fluid accumulation in the left parasagittal area, suggesting a subdural empyema about 6 mm thick. Abscesses of brain parenchyma were visible occipitally and parasagittally on the left side. There was decrease transparency of mastoid cells on the left side. There 2153
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
were no signs of large lesions in the bony septa of the mastoid. Petrous bone tip was slightly »ballooned« with reduced bone structure sizing 8 x 6 mm. Spontaneous EEG revealed dysrhythmia on the right side and dysfunction of ACT and PCT maximum on the left side, without specific changes. After consulting neurosurgeon and ENT specialist the conservative therapy was continued with vancomycin and metronidazole, whereas ceftadizime was replaced with meropenem. The applied therapy resulted in improved general condition of the patient, who felt subjectively well, yet febrile state persisted. Leukocyte count gradually decreased.
On day 23 of the hospitalization the body temperature dropped to normal. During the further course of hospitalization the child underwent extraction of gangrenous primary teeth roots, extraction of primary teeth showing resorption and repair of all carious teeth. Antimicrobial therapy has continued over 7 weeks. Control endocranial CT with intravenous contrast showed regression of subdural empyema in the duplicature of the falx, interparietally on the left, thickened tentorium on the left side, no signs of inflammation in the middle ear and mastoid, restituted aeration in the region of the left pyramid’s apex. Regression in the size of
Picture 1. Endocranial MRI 2154
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Picture 2. CT of endocranium with i.v. contrast
Journal of Society for development in new net environment in B&H
2155
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
parenchymal lesion in the occipital pole and temporally left was seen. Intraorbitally, no detectable pathological changes were observed. After completed antimicrobial therapy the patient was dismissed from the hospital in good general condition, with normal neurological finding and Phenobarbital therapy. Post dismissal, the patient underwent control examinations by pediatrician, ENT specialist, neurosurgeon and epileptologist. After several weeks, the phenobarbital therapy was withdrawn. Control CT examination revealed complete regression of subdural empyema. Discussion Subdural empyema is a severe, life-threatening disease that accounts for about 15-22% of all focal intracranial infections. (1) The disease can develop by per continuitatem extension of the infection from paranasal sinuses, especially from the frontal and ethmoidal ones, otitis media, mastoiditis, intracerebral abscess (3,4) as well as a complication of cranial trauma or surgical procedures in paranasal sinuses (2) or by haematogenous spread from pulmonary sources or septic thrombosis of cranial veins. (3,4) Subdural empyema mostly presents with the signs and symptoms of elevated body temperature, impaired consciousness, focal neurological findings, headache, meningism and convulsions. At admission, our patient was not presented with characteristic clinical picture; his consciousness was preserved, he did not report headache, which is characteristic for about 90% patients, but only pain in the neck. Clinical presentation at admission, ultrasonography and computed tomography of the orbit suggested cellulitis of the right orbit. Computed tomography of the endocranium without contrast did not reveal any signs of subdural empyema or affection of the mastoid region. Until day 7 of the hospitalization the patient had no focal neurological symptoms and signs. Upon manifestation of focal convulsion endocranial MRI was performed indicating subdural empyema, mastoiditis and petrous apicitis on the left side. Most probably, the torticollis in our patient resulted from mastoiditis or left-sided transverse si2156
nus thrombosis, which corresponds with the data from the literature. (18) In the available references there are no reports on subdural empyema associated with orbital cellulitis, mastoiditis and petrositis. Several issues concerning this case still remain unclear: Which is the correlation between mastoiditis / petrositis and orbital cellulitis? Did they occur concurrently? If both infections developed simultaneously, where is the source of infection? Could orbital cellulitis be the complication of mastoiditis and petrositis, or the contrary – could mastoiditis and petrositis be the complication of orbital cellulitis? There are reports on Gradenigo's syndrome (acute otitis media and petrositis, unilateral pain in the region of innervation of the first and second division of trigeminal nerve and ipsilateral parrhesia of abducent nerve) but not on retrobulbar orbital cellulitis associated with petrositis. (10) There are no references reporting orbital cellulitis as a possible complication of petrositis. This case strongly suggests the necessity of considering subdural empyema as a possible complication of orbital cellulitis and in a febrile child with torticollis. High-resolution computed tomography with contrast could be of help in diagnosing subdural empyema. In CT the empyema is demonstrated as a hypodense area over the hemisphere or along the falx. Application of contrast material enables better visibility of the margins and extension rate. Involvement of brain parenchyma and cranial bones can be also demonstrated in CT. In our patient, the CT without contrast was not sufficient to diagnose the subdural collection. Changes in brain parenchyma, occipital and temporal lobe, as well as changes in the region of petrous bone tip were visible only on CT with intravenous contrast. Series of 11 cases of subdural empyema was reported by Skelton et al. In five patients the initial CT was normal, and subdural empyema was first diagnosed after second or third CT-scan. All patients presented with symptoms a week or two before the diagnosis was established. (17) Recently, endocranial MRI has become the diagnostic modality of choice. MRI was found to be superior to CT scanning in demonstrating the extent of a subdural empyema, spreading rate in the region of hemispheric convexities, as well as interhemispheric
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
collections (14,15,16), whereas CT is the method of choice in case when MRI is not applicable. (11,12,13) In our patient the blood culture and CSF culture findings were negative; surgical evacuation of subdural empyema was not performed, thus causative agent was not identified. Common causative agents of subdural empyema are anaerobes, i.e. anaerobic streptococci, Haemophilus influenzae, Streptococcus pneumoniae and gramnegative bacilli. In a series of 31 cases of subdural empyema in children the most frequently identified causative agents were Streptococcus pneumoniae, Group B Streptococcus (GBS), Haemophilus influenzae, Salmonella sp., Escherichia coli and Pseudomonas aeruginosa. (6) Though the blood culture and CSF culture and findings were negative and patient was subjected only to conservative therapy (antibiotics) for 7 weeks, he completely recovered without sequelae. Taking into consideration the size, i.e. thickness of subdural empyema our patient was subjected to conservative therapy. This case demonstrated that, in smaller collections, appropriate antimicrobial therapy could result in complete recovery without sequelae and without surgical evacuation of subdural empyema. References
1. Gormley WB, del Busto R, Saravolatz LD, Rosenblum ML. Cranial and intracranial bacterial infections: In Youmans JR editor, Neurological surgery, 4th Ed, Philadelphia, WB Saunders Co 1996;5:3191-220). 2. Huff S. Epidural and Subdural Infections. Emedicine. http://emedicine.medscape.com/article/782363overview). 3. Nathoo N, Nadvi SS, van Dellen JR, Gouws E. Intracranial Subdural empyemas in the era of computed tomography: A review of 699 cases. Neurosurgery 1999;44:529-36. 4. Pathak A, Sharma BS, Mathuriya SN, Khosla VK, Khandelwal N, Kak VK. Controversies in the management of subdural empyema: A study of 41 cases with review of literature. Acta Neurochirur (Wien) 1990;102:25-32.
5. Greenlee JE. Subdural empyema. Current Treatmen Options in Neurology, 2003;5(1):13-22 6. Wu TJ, Chiu NC, Huang FY . Subdural empyema in children — 20-year experience in a medical center. J Microbiol Immunol Infect. 2008;41:62-67.) 7. Osman Farah J, Kandasamy J, May P, Buxton N, Mallucci C. Subdural empyema secondary to sinus infection in children. Childs Nerv Syst. Feb 2009;25(2):199-205 8. Hlavin ML, Kaminski HJ, Fenstermaker RA, White RJ. Intracranial suppuration: A modern decade of post-operative subdural empyema and epidural abscess. Neurosurgery 1994;34:974-81 9. Dill SR, Cobbs CG, McDonald CK. Subdural empyema: analysis of 32 cases and review. Clin Infect Dis 1995; 20: 372-386 10. Piron K, Gordts F, Herzeeel R. Gradenigo syndrome: a case report. Bull. Soc. Belge Ophtalmol 2003;290:43-7) 11. Taha ZM, Bashier El FM. Subdural Empyema, diagnostic difficulties and surgical treatment controversy. Pan Arab J Neurosurg 2002;6:21-32
12. Moseley IF, Kendall BE. Radiology of intracranial empyemas with special reference to computed tomography. Neuroradiology 1984;26:333-45 13. Bernardini GL. Diagnosis and management of brain abscess and subdural empyema. Curr Neurol neurosci Rep 2004 Nov;4(6):448-56 14. Foerster BR; Thurnher MM; Malani PN; Petrou M; Carets-Zumelzu F; Sundgren PC Intracranial infections: clinical and imaging characteristics. Acta Radiol. 2007;48(8)875-93 15. Rich PM, Deasy NP, Jarosz JM. Intracranial dural empyema. Br J Radiol2000; 73 :1329 –1336 Corresponding author Aleksandra Stojadinovic Pedatric Clinic, Institut of Health Care of Children and Adolescents of Vojvodina, Serbia, E-mail: sasas@neobee.net
Journal of Society for development in new net environment in B&H
2157
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Serum level of anti-müllerian hormone as predictor of ovarian response in IVF
Stevan V Milatovic, Vesna L Kopitovic, Djordje L Ilic, Aleksandra M Trninic Pjevic, Artur L Bjelica, Srdjan P Djurdjevic Clinical Centre of Vojvodina, Department of Gynecology and Obstetrics, Novi Sad, Serbia
Abstract Ovarian reserve assessment and the subsequent ovarian response are one of the most important factors in the evaluation of patients who are about to undergo IVF. Lately, Anti-Müllerian hormone (AMH) has been increasingly used and tested as an endocrine marker for ovarian response. The aim of this study was to evaluate the influence of AMH levels on ovarian response in IVF in order to optimize the treatment of patients with infertility problems. A prospective study was conducted on a sample of 96 women about to undergo the IVF treatment at the Clinical Centre of Vojvodina, Department of Gynecology and Obstetrics in Novi Sad. Based on their AMH levels, the patients were divided into three groups. Group 1- patients whose AMH levels were <=0.6 ng/ml (n=14), group 2 - patients whose AMH levels were 0.6-3.0 ng/ml (n=51) and group 3 - patients whose AMH levels were >3.0 ng/ml (n=30). Group 3 was a high-responder group (the average number of retrieved oocytes during aspiration was 10.70±7.23 and the average number of retrieved embryos was 6.86±6.65). The patients from group 1 had the poorest ovarian response (the average number of retrieved oocytes during aspiration was 4.43±3.10 and the average number of retrieved embryos was 2.79±2.04), p<0.001. Our results show a strong positive correlation between AMH levels and ovarian response during controlled ovarian hyperstimulation, which makes AMH a very reliable marker for ovarian response. Key words: AMH, IVF, ovarian response, ovarian reserve. 2158
Introduction An optimal evaluation of patients who are about to undergo some of the ART treatments is a prerequisite for a successful treatment and a crucial part of the approach to this problem (1). Numerous factors such as the condition of the uterine cavum , endometrial receptivity (2) and other factors must be evaluated. Probably the most important parameter in the approach to these patients is ovarian reserve assessment and the subsequent ovarian response in order to choose the most optimal treatment and predict the ART outcome. There are various ways of testing ovarian reserve such as age, Day 3 FSH, inhibin B, antral follicle count, estradiol levels, vascular resistance etc. all of which have, more or less, questionable predictivity (3,4). An ideal marker for ovarian reserve should be easily available and reliable, having a high positive and negative predictive value. Very often, the process of in vitro fertilization (IVF) itself is considered to be the best way to test ovarian reserve. Therefore, a constant search for a better marker is one of the priorities in the scientific approach to this topic. Lately, Anti-Müllerian hormone (AMH) has been increasingly used and tested as an endocrine marker for ovarian response. AMH is a glycoprotein, a member of the transforming growth factor (TGF) beta superfamily which is produced in women, exclusively in the granulosa cells of preantral and early antral follicles (5). One of the most important advantages of this marker is the fact that its levels are constant throughout the entire cycle (6). There is more and more evidence about its superiority as a predictor of ovarian reserve and it has a significantly better correlation with the decline in ovarian reserve and the antral follicle pool in comparison with other markers (7,8).
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The aim of this study was to evaluate the influence of AMH levels on ovarian response in IVF in order to optimize the treatment of patients. Material and methods A prospective study was conducted on a sample of 96 women about to undergo the IVF treatment at the Clinical Centre of Vojvodina, Department of Gynecology and Obstetrics in Novi Sad . We have a national IVF programme whose inclusion criteria are : a woman must not be over the age of 40 on the first day the IVF cycle as well as that Day 3 FSH levels must not exceed 15 IU/L. These criteria limit the study to patients who would, by the above- mentioned criteria, have the best chance for an adequate ovarian response. Other inclusion criteria were: a previous hysteroscopic treatment of the uterine pathology (polyps, septums, submucous myomas), an operative treatment of a hydrosalphinx and treatments of every possible endocrine comorbidity (hyperprolactinemia, hypothyroidism etc.) The inclusion criterion for the male partner was an adequate spermiogram finding for the IVF/ICSI purposes while patients with azoospermia and the need for TESA were not included in the study. Serum AMH levels were determined on the third day of the menstrual cycle by using the ELISA method (Enzyme linked immnosorbent assay, Immunotech-Beckman). The chosen stimulation protocol did not depend on the AMH levels and individual protocols, including GnRH analogue protocols, were used for the patients’ treatment. Based on their AMH levels, the patients were divided into three groups. Group 1- patients whose AMH levels were <=0.6 ng/ml (14 patients) - this group was expected to have the poorest ovarian response, group 2 - patients whose AMH levels were 0.6-3.0 ng/ml (51 patients) - this group was expected to have a normal ovarian response and group 3 - patients whose AMH levels were >3.0 ng/ml (30 patients) - this group was expected to have the highest ovarian response. We analysed demographic characteristics of the patients, their age, BMI, and the cause of infertility. As for the the ovarian response parameters we anal-
ysed the total consumption of gonadotropins, the length of stimulation, the number of follicles larger than 16mm in diameter, the number of retrieved oocytes during aspiration, the number of retrieved embryos as a parameter of the quality of ovarian response as well as the rate of cancelled cycles. The results were entered into a specially designed database in the MS Excel programme and statistically analysed in the SPSS (statistical package for social science) programme (version 17). The mean values and standard deviation were calculated for continuous numeric variable using the ANOVA analysis for testing statistical significance between mean values and the statistical significance of difference in frequency of categorical variables was calculated using Pearson’s chi-square test. This study was approved by ethics committee of Clinical Centre of Vojvodina. Results After carefully considering the patients’ basic demographic characteristics no statistically significant difference was noticed in the patients’ age and BMI [table 1]. The average age of the patients was 33.19 years. The analysis of the cause of infertility showed the highest frequency of the tubal factor. There was no statistically significant difference among the groups regarding the frequency of different infertility factors except for polycystic ovary syndrome (PCOS) [table 2]. Table 1. Demographic characteristics of patients per group
NO. OF CASES 1. <= 0.6 38.86 ± 2.445 23.7 ± 2.80 14 2. 0.6-3.0 33.17 ± 3.405 23.45 ± 2.98 52 3. >3.0 32.90 ± 2.618 23.37 ± 3.50 30 Total 33.19 ± 3.04 23.46 ± 3.11 P-value 0.627 0.947 AMH AGE BMI
Statistical significance was calculated using ANOVA analysis
Out of 96 women who underwent the IVF procedure, 85 reached the stage of embryo transfer with the cancellation rate of 11.5 %. 2/14 of the women from group 1 and 9/52 of the women from group 2 did not reach the stage of embryo transfer. Between 2159
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 2. Frequency of different infertility factors per group
AMH 1. <=0.6 2. 0.6-3.0 3. >3.0 Total P-value Tubal factor 6/14 42.9% 25/52 48.1 % 9/30 30% 40/96 41.47% 0.227 PCOS 0/14 0% 0/52 0 % 6/30 20% 6/96 6.3% <0.001 Male factor 5/14 35.7% 23/52 44.2 % 14/30 46.7% 42/96 43.8% 0.788 Endometriosis 3/14 21.4% 5/52 9.6 % 1/30 3.3% 9/96 9.4% 0.158 Uterine factor 2/14 14.3% 7/52 13.5 % 0/30 0% 9/96 9.4% 0.104
Statistical significance was calculated using Pearsons chi square test
Table 3. Parameters of ovarian response per group
AMH <= 0.6 06-3.0 >3,0 Average for all groups P-value Number of Consumption of Length of Number of Number retrieved ooNumber gonadotropin stimulation follicles larger of retrieved cytes during of cases (in iu/per woman) (in days) than 16 mm embryos aspiration 2214.29±712.36 2227.94±938.35 1852.50±611.26 2107.37±827.11 0.12 9.00±1.57 9.53±2.1 10.23±2.22 9.67±2-1 0.15 3.43±1.87 5.62±3.24 11.57±6.51 7.19±5.33 <0.001 4.43±3.10 5.73±3.68 10.70±7.23 7.11±5.63 <0.001 2.79±2.04 2.82±2.60 6.86±6.65 4.06±4.60 <0.001 14 52 30
Statistical significance was calculated using ANOVA analysis
these two groups there was no statistically significant difference while in group 3 all women reached the stage of embryo transfer (p<0.05). The parameters of ovarian response were the highest in group 3 (the average number of retrieved oocytes during aspiration was 10.70±7.23 and the average number of retrieved embryos was 6.86±6.65), while in group 1 the poorest ovarian response was recorded (the average number of retrieved oocytes during aspiration was 4.43±3.10 and the average number of retrieved embryos was od 2.79±2.04), p<0.001. The differences for most of the analysed parameters were found to be highly statistically significant [table 3]. Discussion Our study was designed to evaluate the value of AMH as a marker in the prediction of the ovarian response parameters. By analyzing the demographic structure of the patients we did not notice any statistically significant difference in different groups of patients whose average age was 33.19 years, i.e. they were of the advanced reproductive age. 2160
The frequency of different infertility factors does not differ significantly regarding AMH levels except for the frequency of PCOS, by which AMH confirmed its value as a reliable marker for PCOS patients (9). This is very important in order to identify patients running the risk of ovarian hyperstimulation syndrome (OHSS), a serious IVF complication and enable an adequate approach to these patients to prevent the occurrence of OHSS. The study showed that AMH levels correlate well with the ovarian response parameter values [table 3]. Lower AMH levels show a greater possibility of cycle cancellation, less retrieved oocytes during aspiration and less retrieved embryos. The results obtained correspond to the ones obtained in the previous studies (10, 11). Basal serum AMH levels very reliably represent the size of the antral follicle pool, the subsequent ovarian reserve and the subsequent ovarian response. AMH as a predictor of cycle cancellation proved to be very reliable which corresponds to the results of other studies (12). AMH can more reliably identify patients under the risk of being poor responders which can result in a more adequate approach to such patients. A recent, large prospec-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
tive trial conducted on a sample of 538 patients has confirmed that the AMH-based strategy leads to a significantly lower chance of the OHSS occurrence, poor response and cycle cancellation rate (13). Lower consumption of gonadotropins in the group of patients with high AMH levels [table 3] shows that an individualized approach to the treatment, based on this parameter, could be beneficial from the point of medication consumption. The reason why AMH is considered to be superior as a marker for ovarian response probably lies in the fact that it most realistically shows the true state of the ovarian reserve pool which is not in a direct connection with gonadotropin stimulation (14,15). Various other studies showed that AMH is a better predictor of ovarian response in comparison with the basal FSH and among its advantages, in comparison with the antral follicle count, are higher reliability, the fact that it is not cycle-dependent and the impossibility of the interobserver error (16,17). Most of the studies concentrated on AMH as a quantitative marker for ovarian response while more recent studies speak in favour of AMH being a qualitative marker for ovarian response and oocyte competence (18,19) emphasizing its value as a predictor of clinical pregnancy rate. The number of retrieved embryos in our study, which was considerably higher in group 3, could also be a qualitative parameter showing the fertilization potential of oocytes and their potential to result in pregnancy. Further prospective trials are required in order to address this topic. Conclusion Our results show a strong positive predictive correlation between AMH levels and ovarian response during controlled ovarian hyperstimulation which makes it a highly reliable marker for ovarian response. Certain results in the study also show its value as a qualitative predictor. However, further research is required to address this topic. Although it proved to be a very reliable predictor of ovarian response we consider AMH to be complementary to other markers for ovarian reserve.
Acknowledgemens We want to thank the Clinical Centre of Vojvodina and Department for Obstetrics and Gynecology, as well as the whole staff off the Department for Human Reproduction for supporting us in organizing this study. Also we would like to thank the Centre for Laboratory Medicine of Clinical Centre of Vojvodina, primarily Prof. dr Zoran Stošic, Doc. Dr Nikola Curic and dr Stanislava Tomic for their support, as well as Branislava Mendebaba, student of medicine who helped us conduct this research. References
1. Kirby T. Robert Edwards: Nobel Prize for father of in-vitro fertilization. Lancet. 2010; 376: 1293. 2. Kopitovic V, Bujas M, Fišteš-Topalski N, Pjevic M, Ilic Đ, Kapamadžija A, Bujas I. Klinicka efikasnost goserelina (Zoladex) u lecenju mioma materice kod infertilnih pacijentkinja. Medicinski pregled. 2001; 54(7-8):339-46. 3. Godinjak Z, Idrizbegovic E. Should diagnostic hysteroscopy be a routine proceadure during diagnostic laparoscopy in infertile women. Bosnian Journal of Basic Medical Sciences. 2008; 8 (1): 44-7. 4. Loumaye E. The control of endogenous secretion of LH by gonadotropin- releasing hormone agonists during ovarian hyperstimulation for in vitro fertilization and embryo transfer. Hum Reprod. 1990; 5:357–76. 5. Smitz J, Ron-El R, Tarlatzis BC. The use of gonadotropin-releasing hormone agonists for in vitro fertilization and other assisted procreation techniques: experience from three centres. Hum Reprod. 1992; 7(1):49–66. 6. The North American Ganirelix Study Group. Efficacy and safety of ganirelix acetate versus leuprolide acetate in women undergoing controlled ovarian hyperstimulation. Fertil Steril. 2001; 75(1):38–45. 7. Felberbaum RE, Albano C, Ludwig M, Riethmu¨llerWinzen H, Grigat M, Devroey P, et al. Ovarian stimulation for assisted reproduction with hMGand concomitant midcycle administration of the GnRHantagonist Cetrorelix1 according to the multiple dose protocol: a prospective uncontrolled phase III study. Hum Reprod. 2000; 15:1015–20.
Journal of Society for development in new net environment in B&H
2161
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
8. Marcus SF, Brinsden PR, Macnamee M, Rainsbury PA, Elder KT, Edwards RG. Comparative trial between an ultra-short and –long protocol of luteinizing-releasing hormone agonist for ovarian stimulation in in vitro fertilization. Hum Reprod. 1993; 8:238–43. 9. Ludwig M, Felberbaum RE, Diedrich K. LH-RH antagonist protocols in IVF do not lead to worse results than the long LH-RH agonist protocol. Ref Gynecol Obstet. 2000; 7:249–50. 10. de Mouzon J, Goossens V, Bhattacharya S, Castilla JA, Ferraretti AP, Korsak P, et al. Assisted reproductive technology in Europe, 2006: results generated from European registers by ESHRE. Human Reproduction. 2010; 25(8): 1851–62. 11. Del Gadillo JCB, Siebzehnru¨bl E, Dittrich R, Wildt L, Lang N. Comparison of GnRH agonists and antagonists in unselected IVF/ICSI patients treated with different controlled ovarian hyperstimulation protocols: a matched study. European Journal of Obstetrics & Gynecology andReproductive Biology. 2002; 2002:179–83. 12. Hsieh Y, Tsai H, Chang C, Lo H. Comparison of a single half-dose, long-acting form of gonadotropin-releasing hormone analog (GnRH-a) and a short-acting form of GnRH-a for pituitary suppression in a controlled ovarian hyperstimulation program. Fertil Steril. 2000; 73:817–20. 13. Xavier P, Gamboa C, Calejo L, Silva J, Stevenson D, Nunes A, et al. A randomised study of GnRH antagonist (cetrorelix) versus agonist(busereline) for controlled ovarian stimulation: effect on safety and efficacy. European Journal of Obstetrics & Gynecology and Reproductive Biology. 2005; 202: 185–9. 14. Vlaisavljevic V, Reljic M, Lovrec VG, Kovacic B. Comparable effectiveness using flexible single-dose GnRH antagonist (cetrorelix) and single-dose long GnRH agonist (goserelin) protocol for IVF cycles—a prospective, randomized study. Reprod Biomed Online. 2003; 7:301–8. 15. Yao-Yuan Hsieh1, Chi-Chen Chang1, HorngDer Tsai2. Comparasions of different dosages of gonadotropin=releasing hormone (GNRH) antagonist, short-acting form and single, half dose, long acting form of GNRH agonist during controlled ovarian hyperstimulation and in vitro fertilization. Taiwan J Obstet Gynecol . 2008; 47: 66-74.
16. Borm G, Mannaerts B. , Treatment with the gonadotrophin-releasing jor rmoneantagonist ganirelix in women undergoing ovarian stimulation with recombinant follicle stimulating hormone is effective, safe and convenient: results of a controlled, randomized, multicentre trial. The European Orgalutran Study Group. Hum Reprod. 2000;15(8):1877. 17. Kopitovic V, Milatovic S. Multiple trudnoce nakona ART-a – kako ih smanjiti? Novosti u humanoj reprodukciji. 4. Simpozijum sa medjunarodnim ucešcem. Zbornik radova, štampano u celosti. 2009: 26-31. Corresponding author Stevan Milatovic, Department of Human Reproduction, Clinical Centre of Vojvodina, Department of Gynecology and Obstetrics, Novi Sad, Serbia, E-mail: milatstevan@gmail.com
2162
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Diagnostic scores in acute Appendicitis with prospective evaluation of Neoplanta score in pediatric patients
Branka Radojcic1, Slobodan Grebeldinger1, Tomislav Cigic 2, Igor Meljnikov1, Nikola Radojcic3
1 2 3
Clinic for Pediatric Surgery, Institute of Child and Adolescent Health Care of Vojvodina, Novi Sad, Serbia, Clinic for Neurosurgery, Clinical Centar of Vojvodina, Novi Sad, Serbia, Department for abdominal surgery, General Hospital, Sremska Mitrovica, Serbia.
Abstract Introduction: Suspected acute appendicitis is the most common reason for urgent laparotomy in children. The diagnosis of acute appendicitis still remains a controversy, especially in pediatric patients. The aim of study is evaluation of the existing representative score systems in diagnosis of acute appendicitis. The ultimate goal is prospective validation of original Neoplanta score and its testing on a sample of pediatric patients. Material and methods: Prospective clinical study was conducted between October 1st, 2008 to January1st, 2010 in tertiary Children Hospital. One hundred fifty pediatric patients with acute abdominal pain and symptoms of acute appendicitis were included. The study evaluated the value of the different score system and their result did not effect the indicated operative treatment. The results of clinical, laboratory and ultrasound examination were analyzed and compared with the course of disease. The validity of the representative score system in the diagnosis of acute appendicitis was tested at all patients (Alvarado, Madan Samuels, Lintula, Ohman, Eskelinen, Christian, Tzanakis, Neoplanta). For each score individually the groups of patients with low and high risk of developing acute appendicitis were isolated and compared with the clinical course of the disease. Results: By evaluating the diagnostic significance, the data obtained in our sample showed high predictivity in Neoplanta, Ohman, Lintula, Eskelinen and Tzanakis scores. The worst prediction of appendicitis shows Madan Samuels For the correct prediction of positive obligate appendicitis, a series of diagnostic scores are as follows: Neoplanta- Lin-
tula-Ohman-AIRS-Alvarado-Tzanakis. For the negative prediction points to the following schedule: Neoplanta- Lintula-Ohman. Neoplanta appendicitis score defined three test zones: without appendicitis (0-4), possible appendicitis (5-7) and appendicitis (8-11). Prospective evaluation of Neoplanta score showed sensitivity 0,915, specificity 1, positive predictive value 0,977 and negative predictive value 1. Conclusion: Neoplanta score improves the diagnosis of acute appendicitis selecting a high-risk group of patients who need operative treatment and avoid negative appendectomy in pediatric patients. Key words: acute appendicitis, scoring system, child, Neoplanta score Introduction The diagnosis of acute appendicitis still remains a controversy, especially in pediatric patients. Suspected acute appendicitis is the most common reason for urgent laparotomy in children. Current trends impose wide use of diagnostic imaging examinations and laparoscopy. These techniques are limited by experience-dependent variable validity of ultrasonography, costs and followed by risks of ionizing radiation (CT) and the concomitant morbidity (diagnostic laparoscopy). [1] Diagnostic score systems are useful and simple models that facilitate the rational surgical decision. [2] They sublimed the most important clinical, laboratory and ultrasound parameters and provide an objective, comprehensive, mathematically precise diagnosis of acute appendicitis. [3] The aim of their use is to increase the diagnostic accuracy and to reduce the negative appendectomy rate. [4] 2163
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The first attempts that deal with the application score system in the diagnosis of acute appendicitis dating from two decades ago. Several diagnostic score systems have been developed, characterized as non-invasive, user-friendly, cost-effective and comprehensible to the physician - Teicher 1983 [5], Arnbjörnsson 1985 [6], Alvarado 1986 [7], Fenyo 1987 [8], Lindberg 1988 [9], Izbicki 1990 [10], de Dombal 1991 [11 ], Christian 1992 [12], Eskelinen 1992 [13], Ohman 1995 [14], Madan Samuel 2002 [15], Lintula 2005[16], Tzanakis 2005 [17]. The value of score systems is measured by their sensitivity, specificity, positive and negative predictive value. The sensitivity is the ability to recognize acute appendicitis while the specificity is the ability to exclude the same condition. Positive and negative predictive value is the percentage of patients with or without acute appendicitis who were correctly diagnosed. The ideal score system would have sensitivity, specificity and the predictive value of 100%, without false positive and false negative results, the absolute probability of 100% and the diagnostic index 1. Although most authors reported the high predictive value, only some score confirmed their applicability in prospective randomized trials. [5,6,10,12] The ability of the scores to fulfill standardized performance criteria has varied. The following criteria for scores in acute appendicitis are: negative appendectomy rate of less than 15%, a potential perforation rate of less than 35%, a missed perforation rate of less than 15%, and a missed appendicitis rate of less than 5%. Evaluated the performance of ten scores, Ohman found that only the Alvarado score fulfilled all four criteria, while the Lindberg, the Fenyo and the Christian scores fulfilled two criteria each. [14] Most appendicitis scoring systems have been originally developed for adult population, and therefore the scores have been applied in children with varying success. [7,9,11,13,18] Several authors report on reducing the number of negative appendectomies for 50% (Ambjorssen, Alvarado, Christian). In prospective study the use of the Alvarado score in pediatric patients reduced the negative appendectomy rate from 44 to 14%. Recently, Dado retrospectively tested a modified Lindberg’s score and showed that the scoring sy2164
stems could have reduced the negative appendectomy rate from 23% to 8%, while 8% of patients with acute appendicitis remained unrecognized. Madan Samuel created pediatric appendicitis score from eight variables (six clinical and two laboratory). Prospective validation confirmed the high sensitivity and specificity, making it one of the most reliable scoring systems in children. [15] Recently, we created an original pediatric Neoplanta appendicitis score which include clinical and ultrasound criteria. [19] In contrast to these reports, some authors have claimed that clinical scoring systems would not contains variables that would allow for separation of appendicitis from the other conditions mimicking it in children. [20,21]. Alvarado score Alvarado score was originally described at 1986. and is based on the results of the study in Nazareth Hospital in Philadelphia. The study included 305 patients aged 4 to 80 years presented with abdominal pain and suspected acute appendicitis. The acronym MANTRELS was formed from the initial letters of the components of the Alvarado score. Table 1 The value of the Alvarado score was in the range of 0-10, with recommendations for further treatment modality. Table 2 In the original study Alvarado score had a sensitivity of 81%, specificity 74%, PPV 92% and NPV 46%, [7] and similar results have been confirmed in repeated prospective studies. [22,23,24] Table 1. Components of the Alvarado score and their numeric value
Variable Migration of pain Anorexia Nausea, vomiting Tenderbness in RLQ Rebound pain Elevated temperature Leukocytosis> 10 000 Shift of white blood cells count to left *
*Shift to the left-neutrophils> 75%
number of points 1 1 1 2 1 1 2 1
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 2. Alvarado score and recommendation
Number of points 5-6 7-8 9-10 Status appendicitis observation probably appendicitis very likely appendicitis Recommendation observation surgery surgery
Madan Samuels score Madan Samuels score was developed in 2002. and is based on the results of five-year study at the Southampton General Hospital and St. George’s Hospital in London. The study included 1170 patients aged 4 to 15 years with abdominal pain and suspected acute appendicitis. Using multiple linear logistic regression analysis, the diagnostic score was established from 8 variables. Table 3. Cut-off point was determined on score values of 5, which eliminated potential perforation or missed appendicitis, where the number of unnecessary appendectomy was 19 in 1170 patients. Samuels score ≤ 5 is not, while a score ≥ 6 is compatible with the diagnosis of appendicitis. Score value from 7 to 10 indicates a high probability of appendicitis. Retrospective application of score confirmed the sensitivity of 100%, specificity 92%, PPV 96%, NPV 99%. [15] Table 3. Madan Samuels score
Parameter Points 1 1 1 2 2 1 1 1
tomies in children with suspected acute appendicitis. Lintula score was initially included 35 history variables and clinical findings, and results were compared with operative, histopathological findings and the clinical outcome. Statistical significance was confirmed for the fifteen variables (p ≤ 0. 05) that are marked as components Lintula pediatric appendicitis score. (Table 4) The score had a minimum of zero and a maximum of 32 points. The cut-off level for acute appendicitis was ≥ 21, which corresponded to an appendicitis probability of 100%, and the cut-off level for non- appendicitis ≤ 15 , at which the probability of appendicitis was zero. By choosing the two cut-off points in the appendicitis score one could divide the patients into three groups: non-appendicitis group (Lintula score ≤ 15); observation group (Lintula score 16-20); acute appendicitis group (Lintula score ≥ 21). Lintula score was tested prospectively and these performance criteria were used to access the diagnostic accuracy of appendicitis score allotted unnecessary appendectomy rate, potential perforation rate, missed perforation rate and missed appendicitis rate. [16, 21, 25] Table 4. Lintula pediatric appendicitis score
Parameter Gender Intensity of pain Relocation of pain Vomiting Pain in RLQ Fever Guarding Bowel sounds Rebound tenderness Score Male 2 Female 0 Severe 2 Mild or moderate 0 Yes 4 No 0 Yes 2 No 0 Yes 4 No 0 Yes (≥37,5) 3 No ( ≤37,5) 0 Yes 4 No 0 Absent, tinkling 4 Normal 0 Yes 7 No 0
Migration of pain
Anorexia Nausea, vomiting Tenderness in RLQ Cough, percussion and movement increase the sensitivity
Elevated temperature
* Shift to the left-neutrophils> 75%
Ohman score Ohman score for the diagnosis of acute appendicitis included the following variables (Table 5) and determine their quantitative value. [104, 112] The Ohman score was tested prospectively, obtained a probability of acute appendicitis for each score value. Table 6
Leukocytosis> 10 000 Differential leukocyte counts *
Lintula score Lintula developed a pediatric diagnostic score to reduce the number of unnecessary appendec-
Journal of Society for development in new net environment in B&H
2165
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 5. Ohman score
Parameter Pain in RLQ Rebound tenderness Without dyzuric symptoms Permanent pain Leukocytosis >10000 Age <50 years Migration of pain in RLQ Muscle defence Points 4,5 2,5 2 2 1,5 1,5 1 1
a quick, unexpensive, simple and applicable score with high positive predictive value. [8,9] Christian score The five-criteria scoring system of Christian have been established at 1994and developed from parameters: abdominal pain, vomiting, RLQ pain, moderately elevated temperature to 38. 8°C, leukocytosis (WBC> 10000, polymorphonucleary> 75%). [12] If on the admission were present four or five symptoms, surgery was recommended. The presence of three signs required active observation and in case of new characters indicate the operations. Prospective one-year study of 58 adult patients confirmed the proportion of negative appendectomy rate 6. 5% (3/46 operated), while in the control group was 17% (19/59). Later studies haven’t confirmed the Christian score’s validity. The clinical performance of the original system was found to be disappointing. The sensitivity was high- 91%, but this was not so with specificity and accurancy which were 60% and 78% respectively. [27] Teicher score Teicher conducted a study that included 100 consecutive, retrospectively analyzed patients with proven appendicitis and 100 consecutive patients with negative appendectomy. Twentythree potential variables that could indicate the development of acute appendicitis were analyzed, and the predictive value was determined for each. These were age, sex, duration of symptoms, pain location, loss of appetite, nausea, vomiting, dyzuric symptoms, stage and regularity of menstrual cycle, vaginal discharge, fever, tenderness, muscular defense, rebound phenomenon, palpable abdominal mass, peristaltic sounds, rectal sensitivity, palpable rectal mass, WBC count, fecalith on native abdominal X-ray. [5]
Table 6. The probability of acute appendicitis for each Ohman score value
Ohman score < 4 4-5,5 6-7,5 8-9,5 10-11,5 12-13,5 >14% 45% 70% 88%
The AA 1% 3% 10 % 20% probability
Eskelinen score Eskelinen have analyzed the 32 sectional variables, 14 clinical signs and three tests. Multivariate analysis found the best combination of independent predictors of acute appendicitis. Table 7 . Score value ≥55 is indicative for acute appendicitis. Later validation of Eskelinen score in dealing by Sitter define the cut-off point ≥ 57. [13,26] Table 7. Eskelinen score
Parameter Tenderness Defance Leukocite Rebound phenomen Pain Duration of pain Number of points Factor RLQ-2 other -1 11,41 yes-2 no-1 6,62 >10000- 2 5,88 <10000- 1 да – 2 не-1 4,25 RLQ-2 other-1 3,51 <48 hours – 2 2,13 >48 hours - 1
Fenyo-Lindberg score Fenyo-Lindberg score included eight clinical and one laboratory parameter - sex, WBC count, duration, progression and migration of pain, vomiting, increase of pain with coughing, rebound phenomenon, muscle defence, RLQ pain. This is 2166
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Appendicitis Inflammatory Response Score (AIRS) Andersson created a clinical scoring system from eight variables with independent diagnostic value. This mathematical model focuses on the detection of advanced appendicitis and include inflammatory markers that have a strong diagnostic accuracy. AIRS score included RLQ pain, rebound phenomenon, muscle defance, WBC count, C-reactive protein, fever and vomiting. Instead dichotomy variables, clinical variables were graded according to severity of symptoms and signs, while laboratory variables were divided into intervals. [28] Tzanakis score Tzanakis formed a simple scoring system which included a combination of clinical, laboratory and ultrasound parameters, and then compared the use of such a score and eleven existing systems to identify acute appendicitis. [17] Initially in patients with suspected acute appendicitis were examined 15 variables (including ultrasound parameters) that multivariate analysis compared with operative findings. Tzanakis have applied the previous experience [29] and defined ultrasound signs of acute appendicitis: target phenomenon, apendicolith, perityphlitic tissue, thickening appendiceal wall, non-compresibile appendix, fluid in Douglas space. Logistic regression analysis identified four independent indicators of acute appendicitis – RLQ pain, rebound phenomenon, migration of pain and guarding. Coefficients for the parameters are duplicated and each is determined by a numerical value. Table 8 Tzanakis score had value from 0-15. Low values (0-4) excluded of acute appendicitis. The high value score of 8-15 is confirmed acute appendicitis. Limit value score of 5-7 indicated the need for further observations. Table 8. Tzanakis score
Parameter Number of points A positive ultrasound signs RLQ pain
Neoplanta score The Neoplanta score is original pediatric appendicitis score system which we created in previous study from the most important clinical and ultrasound sign of acute appendicitis. [19,30] It contains three anamnestic data, two physical signs and ultrasound signs of acute appendicitis. Each of these criteria is, based on it’s position in the evaluation system at the group level, given the appropriate value (“force”) which is expressed quantitatively. Neoplanta score components and their numeric values are represented in Table 9. Score validation is determined and the cut-off points for which the Neoplanta score system has the highest sensitivity and specificity in recognizing acute appendicitis pediatric patients. Also, the score clearly defines and gives a recommendation for further treatment modality. Table 10 Table 9. Neoplanta score, components and their numeric values
Variable Lower right tenderness Loss of appetite Nausea, vomiting Fever> 37. 5 ° Abdominal muscle defance positive test compressible Appendiceal wall (> 2. 5 mm) Ultrasound grade (III ili IV) outer diameter of appendix (≥ 7 mm) Indirect US signs of appendicitis Number of points 1 1 1 2 1 1 1 1 1 1
Table 10. Neoplanta score and recommendation
Score value 0-4 5-7 8-11 Status Non apendicitis Possible apendicitis Apendicitis Recommendation MARK release observation surgery 0 1 2
Rebound phenomenon
WBC > 12000
Total
6
4
3
2
15 2167
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The aim of study is evaluation of the existing representative score systems in diagnosis of acute appendicitis. The ultimate goal is prospective validation original Neoplanta score and its testing on a sample of pediatric patients. This will improve the diagnosis, help to determine the high-risk patients group with suspected acute appendicitis and reduce the negative appendectomy rate. Material and methods A case-control clinical study was designed and conducted at tertiary care Children hospital between from 1st October, 2008 to 1st January, 2010. The study included 150 patients aged 4 to 18 years with acute abdominal pain and symptoms, which included acute appendicitis as a differential diagnosis. From the study were excluded patients who had previously had appendectomy. All patients were examined clinically, with laboratory and ultrasound tests performed. The study evaluated the value of the different score system and their result did not effect the indicated operative treatment. Patients with a positive clinical presentation of acute appendicitis were hospitalized. Non hospitalized patients were also controlled. Only the first clinical decision was observed and compared with the result of the treatment. Operative treatment was indicated if even after conservative measures taken, the symptoms of acute appendicitis persisted. The evidence of acute appendicitis was confirmed on histopathology report. For the statistical analysis all patients are grouped as follows: Appendicitis group are those patients in whom the intraoperatively macroscopically and histopathologically was set the diagnosis of acute appendicitis. 1) true positive - admitted on time, operated and with confirmed acute appendicitis (SPOA); 2) false negative - initially unrecognized, missed appendicitis but treated surgically, confirmed appendicitis (LNOA); Non appendicitis group 1) true negative - on the basis of diagnostic procedures performed the acute appendicitis 2168
ruled out and in the course of the study were not reported with a similar problem (SNNA); 2) false positive - operated - rulled out the existence of acute appendicitis (LPONA); - hospitalized, but not operated (LPNO); - false negative, undergone surgery, no appendicitis (LNONA). Primary variables of interest were divided into categories of demographic data (age, sex, body mass), anamnestic data -pain duration and localisation (RLQ, periumbilical, epigastrium, diffuse), loss of appetite, nausea, vomiting, diarrhea, temperature > 38. 5 o C, clinical variables- antalgic position, coated tongue, pain localisation (ileocoecal, periumbilical, diffuse, epigastrium), palpation tenderness, guarding RLQ, WBC and ultrasound findings. The ultrasound examinations were performed with Siemens sonoline sienna ultrasound color Doppler with 7. 5MHz linear transducer. We previosly described a new ultrasound signs of acute appendicitis in pediatric patients. [30] Table 11 Table 11. Ultrasound signs of acute appendicitis
positive test compressible outer diametar of appendix ≥ 7mm appendeceal wall thickness ≥ 2,5mm appendicolith nonperistalic appendix fluid-filled abscess circumferential color-flow identified around the appendix free fluid noted in the right low quadrant of the abdomen and the pelvis. ultrasound grade
Ultrasound grades emerged as new criteria in diagnosis of acute appendicitis. Attempts to correlate ultrasound and patohystological findings are reported. Severity was classified into four grades based on the appearance of intramural appendiceal structure. [31] The validity of the representative score system in the diagnosis of acute appendicitis was tested at all patients (Alvarado, Madan Samuels, Lintula, Ohman, Eskelinen, Christian, Tzanakis, Neoplanta). For each score individually the groups of patients with low and high risk of
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
developing acute appendicitis were isolated and compared with the clinical course of the disease. Statistical analysis The data collected were imported in the database formed in the Excel software package ver. 2007. Descriptive statistical methods were used for the processing of demographic characteristics of the population. Encoded conditions are imported into the basic modules of the software package Statistica, ver. 8. 0 for the correspondent canonical analysis. The correspondent canonical analysis was used in order to present the impact of the condition, anamnestic, clinical, laboratory and ultrasound parameters to define the difference between the studied groups as well as the mutual influence of the subgroups. Achieved results are shown in the coordinate space of the correspondent axis with the help of dendograms obtained by the cluster analysis of correspondent scores of patient groups studied. The original Neoplanta score was also tested together with the other scores, but in the same time on it’s own in relation to the frequency of appendicitis occurrence in the examined sample. Multivariante statistical analysis was performed by using the software package Statistica, ver. 8. 0, Statsoft Inc. , Tulsa, OK, USA. It was performed at the Department of Biology and Ecology, Faculty of Natural Sciences, University of Novi Sad. The collected data were grouped and presented in tables and graphs. Results The study included 150 patients aged 4-19 years (11,53 years) with acute abdominal pain and symptoms, which included acute appendicitis as a differential diagnosis. Sex ratio of the sample was 89 girls (59. 33%) and 61 boys (40. 66%). The highest frequency of clinical conditions with a suspicion of acute appendicitis is at the age of 12 to 15 years, especially among girls. After completion of standard diagnostic algorithm 103 patients were hospitalised. Among non hospitalised patients (n = 47) the existence of appendicitis was definitely ruled out at 37 patients- true negative
group (24. 66%). In this group there were also 10 false negative patients (6,66%) that the initial check up were not recognised, but were hospitalised and sent to surgery after the control examination. Out of 103 admitted patients, 49 were not operated (false positive) and after the release did not re-emerged with signs of acute appendicitis. The total sample had 64 operated patients (42. 66%) and acute appendicitis was confirmed in 53 patients (82. 8%)- true positive group, while in 11 the appendicitis wasn’t confirmed (negative appendectomies rate) -17. 18%. In the group of operated patients 10 of them were not hospitalized initially - missed appendicitis (15. 62%). Out off 11 negative appendectomies two patients were initially returned and after reoccurrence they were hospitalized and operated, but acute appendicitis was not confirmed histologically. Scores results comparative review Implementation scores for multifactorial analysis of one of the possibilities of differentiation of groups based on several characteristics. These characteristics carry with them an appropriate risk as a possible doubling of subjective mistakes, but the only way of collecting data in order to make a conclusion. As a number of scores for the evaluation of acute appendicitis is already known in literature, the comparison of the well-known representative scores is performed on our sample. Table 12 By evaluating the diagnostic significance, the data obtained in our sample showed high predictivity in Ohman, Lintula, Eskelinen and Tzanakis scores. The worst prediction of appendicitis shows Madan Samuels score. Observed in the presence of a subgroup analysis shows that all scores had a strong positive maximum prediction related to the group correctly diagnosed appendicitis (SPOA group). But that in which scores did not show the same sensitivity was first correctly diagnosing patients from LNOA, which is only in the case of AIRS almost universally distributed properly. The only thing this score would be less sensitive LPNOA the group that really did not have appendicitis, but some still mistakenly separated. Variability in scores sensitivity can be monitored and different levels of classification of patients LPNO group (Figure 1-9). More 2169
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
or less all the scores are highlighted sensitive and specific for appendicitis, however, the appropriate combination really is the most realistic one that reflects the state of the patients. Table 12. Diagnostic value of the representative scores for acute appendicitis
sensitivity positive predictive value specificity Negative Predictive value 1. 000 0. 333 1. 000 1. 000 1. 000 0. 545 0. 143 1. 000 Score
Alvarado Madan Samules Lintula Ohman Eskelinen Christian Tzanakis Neoplanta 0. 915
0. 827 0. 872 0. 971 0. 913 0. 955 0. 884 0. 870
1. 000 0. 073 1. 000 1. 000 1. 000 0. 154 0. 042 1. 000
0. 524 0. 519 0. 694 0. 778 0. 667 0. 535 0. 635 0. 977
Figure 3. Distribution of advanced Lintula score in the subgroup of patients
Figure 4. Distribution of advanced Ohman score in the subgroup of patients
Figure 1. Distribution of advanced Alvarado score in the subgroup of patients
Figure 5. Distribution of advanced Eskelinen score in the subgroup of patients
Figure 2. Distribution of advanced Madan Samuels score in the subgroup of patients 2170
Figure 6. Distribution of advanced Christian score (≥4) in the subgroup of patients
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Figure 7. Distribution of advanced AIRS score (≥9-12) in the subgroup of patients
vant points are the positions of state scores that detect appendicitis and their familiarity with the group centroid. For the correct prediction of positive obligate appendicitis, a series of diagnostic scores are as follows: Neoplanta- Lintula-Ohman-AIRSAlvarado-Tzanakis. For the negative prediction points to the following schedule: Neoplanta- Lintula-Ohman. Figure 10 Interaction in all three axes synthesize the data and thus show where the scores that would otherwise identify your appendicitis, some elements are not clearly determine the patients and refer them to other groups. In the case of experiments carried out all the above scores are positive or negative prediction of appendicitis are not sufficiently precise system that separates the wrong part of the sample to LPONA subgroup.
Figure 8. Distribution of advanced Tzanakis score( ≥8) in the subgroup of patients
Figure 10. The positions of subgroup of patients and the status of the all score in the space of the firts and second correspodence axis In the final phase of the study the original pediatric appendicitis score system, originally named Neoplanta score which contains three anamnesis data, two physical signs and ultrasound criteria of acute appendicitis was formed. Each of these criteria is, based on it’s position in the evaluation system at the group level, given the appropriate value (“force”) which is expressed quantitatively. Neoplanta ccore validation is done and the cutt-off points for which the Neoplanta score system has the highest sensitivity and specificity in recognizing acute appendicitis pediatric patients are determined. Also, the score clearly defines and gives a recommendation for further treatment modality. Neoplanta score is tested independently on the current sample and the results obtained show a high 2171
Figure 9. Distribution of advanced Neoplanta score in the subgroup of patients Observation of the position evaluation scores and centroids in the correspondent area enables you to specify a number of diagnostic scores for acute appendicitis by performance tested on a sample of patients. This form of testing involves the interpenetration of all the scores of each other in multivariate space, and the levels of sensitivity to be discreetly moved in relation to the individual test whose results were presented earlier. The rele-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
sensitivity and positive predictive value. In addition to independent testing the new score was subjected to the entire set of cross-checks. By the use of correspondent analysis with all-made scores, we got the results that are in favour for the use of Neoplanta score. Within the first two correspondence axes the position of Neoplanta score in diagnostic phase of the disease, found in the vicinity of the SPOA group centroids and surrounded by positions of state scores that proved to be the best in previous work. Also in the opposite area of the same correspondent axis, the negative Neoplanta score is in the vicinity of the SNNA group’s centroids, but also the negative values of individual old scores. Figure 11 Within the second and third correspondent axis it’s emphasized the agglomeration centroid subgroups and condition due to reduced levels of variability in the sample. In this environment the positions of the relevant points of the Neoplanta score shows the accuracy of given values for all elements. Neoplanta score 0 is in the close range to SNNA group, while Neoplanta score 2 is close to SPOA group. Neoplanta score 1 centroid is surrounded by centroids different in origin and with no clear orientation and as far as the studied groups are concerned , they are close to the set of centroids, whose origin is not absolutely defined. Figure 12. If we test the new score alone, we get the same results. Any proposed boundary module has it’s close subgroups. The subgroup SPOA is oriented towards the value of score 2, and they are joined at an appropriate distance, by the subgroup LNOA. The opposite side is reserved for the nonapendicitis group in which the SNNA subgroup is surrounded by a zero score value. A condition that requires further observation and examination (NEOPLANTA: 1) gathers the undefined group of patients by status. Discussion The diagnosis of acute appendicitis is still an open problem in pediatric surgical practice. The delay in diagnosis and treatment leads to the subsequent morbidity increase, length of hospitalization and increased costs of treatment. [26,27,28] Respecting the risk of complications arising due to delay in recognising and treatment leads to ear2172
ly surgical explorations and the increase in the number of negative appendectomies. The goal of modern surgical treatment focuses on the balance between the negative appendectomie rate and the perforation rate in the time of the surgery. It is therefore advisable to create a predictive criteria to properly identify the group of patients with high risk of developing acute appendicitis. From a practical standpoint, clinically useful prognostic score system must include a minimum number of available variables. It must be applicable in all cases, fast, reliable and economically justified. Clinical diagnosis involves a subjective synthesis of more complex information depending on the surgical knowledge and previous experience in similar situations.
Figure 11. The positions of centroids subgroup of patients and the status of all scores in the space of the first and second correspondence axis
Figure 12. Subgroup patients centroid positions and the NEOPLANTA score status in the space of the first and second correspondence axis
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
This process can be improved by applying clinical score system that can objectively determine the prognosis of a particular patient, based on the experience of similar patients on the basis of which the score was created. They can serve as the basis of the structural algorithm for the treatment of patients depending on the probability of developing appendicitis. Implementation scores for multifactorial analysis is one of the possibilities of differentiation groups based on several characteristics. As known in the literature a number of scores for evaluation of acute appendicitis, was performed to compare the scores of well-known representative of our sample. Previously established score systems, including the Alvarado score as the most famous, are not widely accepted because they did not show their importance in prospective studies. A score system would ideally be constructed from variables that have the strongest independent discriminative capacity to identify groups of patients suspected of acute appendicitis. All the previous score systems lose their capacity of discrimination because most of them are made of dichotomy variables. Also, the failure of some score system lies in the use of inadequate mathematical models for their constructions. The criteria for assessing the validity of score system in the diagnosis of acute appendicitis are well known and mentioned before. [34] Criteria for assessing the validity of score systems in the diagnosis of acute appendicitis, the number of negative appendectomy rate below 15%, the risk of perforation below 35%, overlooked perforations below 15% and the number of unrecognized appendicitis below 5%. [19] By analyzing ten score systems, Ohman found that only the Alvarado score meets all four criteria, while Fenyö and Christian score meet two criteria. [17,35] Curran in the one-year prospective study evaluated and compared the diagnostic value of a modified Alvarado score and ultrasonographic examination of adult patients with clinical suspicion of acute appendicitis. They found no significant differences in the safety of these diagnostic algorithms individually, but together can only increase the safety of diagnosis. [36, 37] Modern score system for acute appendicitis, in addition to clinical and laboratory parameters includes the ultrasonographic criteria. Tzanakis created the original score that included
clinical, laboratory and ultrasonographic parameters and tested it prospectively in adult patients. [18] However, in children’s surgical practice, such a score system has not yet been implemented. Most score systems define the cut-off point with a high sensitivity to detect appendicitis, whereas the specificity is low in order to define and bring the decision on surgical treatment. The rational approach is based on defining the three diagnostic test zones and the accompanying high-sensitive surgical decision (surgery, observation, discharge). By calculating the diagnostic significance of that. its basic elements obtained data indicate that in the case of a group of patients that includes the study accurately bring AIRS score that bears a sensory evaluation, and is characterized by the high positive predictive value, which is similar to the results Watters in 2008. year. [39] On the basis of our sample the high predictivity scores were given by Neoplanta, Ohman, Lintula, Eskelinen and Tzanakis. Madan Samuels score shows the worst appendicitis prediction. Observed in the presence of a subgroup analysis shows that all scores had a strong positive maximum prediction related to the group correctly diagnosed appendicitis (SPOA group). The string of diagnostic scores for the correct positive prediction of the definite appendicitis is as follows: Neoplanta- Lintula-OhmanAIRS-Alvarado-Tzanakis. As far as negative prediction is concerned Neoplanta-Lintula-Ohman are outstanding in that order. As a result of research is created the original prognostic score system that incorporated representative clinical and ultrasound criteria, determined their factors of significance and prognostic safety. The Neoplanta score clearly defines the three diagnostic areas (without appendicitis, possible appendicitis, appendicitis), and is also one of the few systems that besides the recognition of acute appendicitis provides recommendations for for further treatment modality. The Neoplanta score is independently tested on the current sample, and the results show a high degree of its sensitivity and high positive predictive value. The value of successful prediction of the patient’s condition is almost 1 and thus shows a high correlation module with selected features and elements of their expression. Testing Neoplanta score on the complete sample of the study confirmed the sensitivity 0. 915, 2173
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
specificity 1. 000, positive predictive value of 0. 977 and negative predictive value of 1000 New score despite high specificity for SPOA subgroup showed the defect to a single set of characters that were visokospecificni the subgroup SPOA, but also for the subgroup LNOA, and partly for LPONA However, even with the specific objections the proposed score implies a high degree of effectiveness in resolving diagnostic uncertainty the already complex compositions of symptoms of acute appendicitis. If the new test scores alone, we get the same results. Each module has a suggested limit of its close subgroups. Subgroup SPOA-oriented score values of 2, and they are at an appropriate distance joins and sub LNOA. The opposite side is reserved for nonapendicitis group in which subgroups are SNNA surrounding zerovalue score, a status that requires further observation and examination (ie NEOPLANTA: 1) is a non-defined status groups of patients. Conclusion Set precise and timely diagnosis of acute appendicitis is still an art. No self-score system is not sufficient to indicate an appendectomy The Neoplanta score system proved to be very practical, simple and multidisciplinary. It sublimed the most important variables significant for identifying patients with acute appendicitis. Data for its creation were obtained from clinical and ultrasonographic parameters. By applying an adequate score system its possible to provide for all patients, an optimal form for further treatment, timely recognition of acute appendicitis and reducing the negative appendectomy rate. Abreviations WBC- white blood cells PPV-positive predictive value NPV- negative predictive value RLQ- right low quadrant AIRS-Appendicitis Inflammatory Response Score
References
1. Andersson R. Artifitial neural networks: Useful aid in diagnosing acute appendicitis. World J Surg, 2008; 32:310-311. 2. Galindo Gallego M, Fadrique B, Nieto M, et al. Evaluation of ultrasonography and clinical diagnostic scoring in suspectal appendicitis. Br J Surg, 1998; 85:37-40. 3. Grebeldinger S. Ultrasonografska dijagnostika akutnog apendicitisa. Med Pregl, 1996; 49:487-90. 4. Sitter H, Hoffman S, Hassan I, Zielke A. Diagnostic score in appendicitis. Langebeck Arch Surg, 2004; 389:213-218. 5. Teicher IRA, Landa B, Cohen M, et al. Scoring system to aid in diagnoses of appendicitis. Ann Surg, 1983; 753-9. 6. Arnbjornsonn E. Scoring system for computer-aided diagnosis of acute appendicitis. The value of prospective versus retrospective studies. Ann Chir Gynaecol,1985;74:159-66. 7. Alvarado A. A practical score for early diagnosis of acute appendicitis. Ann Emerg Med, 1986;15:557564. 8. Fenyo G. Routine use of a scoring system for decision making in suspected acute appendicitis in adults. Acta Chir Scand, 1987;153:545-51. 9. Lindberg G, Fenyo G. Algorithmic diagnosis of appendicitis using Bayes’ theorem and logistic regression. In:Bernardo JM, De Groot MH, Lindley DV, Smith AF (eds) Bayesian statistics 3, Oxford University Press, Oxford, 665-668. 10. Izbicki JR, Wilker DK, Mandelkow HK, et al. Retround Prospektive Untersuchung zur Wertigkeit klinisher und laborchemisher. Daten bei der akuten Appendicitis. Chirurg,1990;61:887-93. 11. de Dombal FT. Diagnosis of Acute Abdominal Pain. 2nd ed. Edinburgh:Churchill Livingstone,1991:105-6. 12. Christian F, Christian GP: A simple scoring system to reduce the negative appendicectomy rate. Ann R Coll Surg Engl, 1992:74:281-5. 13. Eskelinen M, Ikonen J, LipponenP. A computer-based diagnostic score to aid in diagnosis of acute appendicitis. A prospective study of 1333 patients with acute abdominal pain. Theor Surg, 1992;7:86-90. 14. Ohman C, Franke C,Yang Q. Diagnoses score fur acute Appendicitis. Chirurg, 1995; 55:135. 15. Madan Samuel. Pediatric appendicitis score. J Ped Surg, 2002;37:877-881.
2174
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
16. Lintula H, Pesonen E, Kokki H, et al. A diagnostic score for children with suspected appendicitis. Langebecks Arch Surg, 2005; 390:164-170. 17. Tzanakis N, Efstathiou S, Danulidis K, et al. A New Approach to Accurate Diagnosis of Acute Appendicitis. World J Surg, 2005; 29:1151-1156. 18. Bond GR, Tully SB, Chan LS. Use of MANTRELS score in childhood appendicitis: a prospective study of 187 children with abdominsl pain. Am Emerg Med, 1990;19:1014. 101. 19. Grebeldinger S, Radojcic B, Meljnikov I, Radojcic N. Neoplanta score for acute appendicitis diagnosis in pediatric patients. HealthMED, 2011; in press. 20. Macklin CP, Radcliffe GS, Merel JM, et al. A prospective evaluation of the modified Alvarado score for acute appendicitis in children. Ann R Coll Surg Engl, 1997; 79:203-205. 21. Lintula H, Kokki H, Pulkkinen, et al. Diagnostic score in acute appendicitis. Validation of a diagnostic score (Lintula score) for adults with suspected appendicitis. Langebeck Arch Surg, 2010; 395:495-500. 22. Sooriakumaran P, Lovell, Brown R. A comparison of clinical judgment vs the modified Alvarado score in acute appendicitis. Int J Surg, 2005; 3:49-52. 23. Talukder DB, Siddiq A. Modified Alvarado scoring system in the diagnosis of acute appendicitis. JAFMC Bangladesh, 2009: 5(1):18-20. 24. Sanei B, Mahmoodeih M, Hasseinpour M. Evaluation of validity of Alvarado scoring system for diagnosis of acute appendicitis. Pak J Med Sci, 2009; 25 (2):298-301. 25. Lintula H. Kokki H, Kettunen, Eskelinen M. Appendicitis score for children with suspected appendicitis. A randomized clinical trial. Langebeck Arch Surg, 2009;394: 999-1004. 26. Eskelinen M, Ikonen J, Lippnonen P. Sex-specific diagnostic scores for acute appendicitis. Scand J Gastroenterolog, 1994; 29:59-66. 27. Chung ECH, Chu DW, Wu AHW. Clinical evaluation of a 5-criteria scoring system for diagnopsing acute appendicitis in adults. Hong Kong Prectitioner, 1993; 15. 28. Andersson M, Andersson E, Watters J. The Appendicitis Inflammatory Response Score : A Tool for the Diagnosis of Acute Appendicitis that Outperforms the Alvarado Score World Journal of Surgery, 2008; 32 (8): 1843-1850.
29. Puylaert JBCM. Acute appendicitis: US evaluation using graded compression. Radiology, 1986;355-360. 30. Grebeldinger S, Radojcic B, Meljnikov I, Draškovic B, Uram-Benka A. The news in ultrasound diagnostic of acute appendicitis in pediatric patients. HealthMED Journal, 2010; 4(4) suppl. 1: 964-972. 31. Kaneko K, Tsuda M. Ultrasound-based decision making in the treatment of acute appendicitis in children. J Pediatr Surg, 2004; 39:1316–1320. 32. Meljnikov I, Radojcic B, Grebeldinger S, LucicProstran B, Radojcic N. History of aooendicitis surgical treatment. Vojnosanitetski pregled, 2009; 10: 845-851. 33. Mazeh H, Epelboym I, Reinherz J, et al. Tip appendicitis: clinical implications and management. Am J Surg, 2009; 197: 211-5. 34. Roach JP, Patrick DA, Bruny JL, et al. Complicated appendicitis in children: a clear role for drainage and delayed appendectomy. Am J Surg, 2007; 194: 769-773. 35. Rothrock SG, Pagane J. Acute appendicitis in children: emergency department diagnosis and management. Ann Emerg Med, 2000; 36:39-51. 36. Schneider C, Kharbanda A, Bachur R. Evaluation Appendicitis Scoring Systems Using a Prospective Pediatric Cohort. Annals of Emergency Medicine, 2007; 49(6) 778-784 37. Curran TJ, Muenchow SK. The treatment of complicated appendicitis in children using peritoneal drainage: results from a public hospital. J Pediatr Surg, 1993; 28: 204-208. 38. Newman K, Ponsky T, Kittle K, et al. Appendicitis 2000: variability in practice, outcomes and resource utilisation at thirty pediatric hospitals. J Pediatr Surg, 2003; 38:372-9. 39. Watters J. The Appendicitis Inflammatory Response Score: A Tool for the Diagnosis of Appendicitis Outperforms the Alvarado Score. World J Surg, 2008;32:1850. Corresponding author Branka Radojcic Clinic for Pediatric Surgery, Institute of Child and Adolescent Health Care of Vojvodina, Novi Sad, Serbia, E-mail: branka. radojcic@gmail. com
Journal of Society for development in new net environment in B&H
2175
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Good preoperative evaluation and preparation of disabled patients for dental procedures significantly reduce perioperative complications
Biljana Draskovic, Anna Uram Benka, Gordana Turanjanin-Tomic, Dejan Dimitrijevic, Danica Stanic Institute of Child and Adolescent Health Care of Vojvodina, Clinic of Paediatric Surgery, Novi Sad, Serbia
Abstract Introduction: Persons with developmental or acquired disability – disabled patients, for dental procedures usually require general anaesthesia. General anaesthesia should be adjusted by the type and the length of procedure, the conditions of day case surgery, and above all the health of the patient which is very often severely impaired. The preference during the anesthesia procedure was on modern intravenous and inhalatory short-acting anesthetics. Aim: To present the complexity of preparing and conducting anesthesia of disabled patients during the dental intervention, and explain the methods of reducing potential perioperative complications to minimum. Material and methods: The clinical retrospective-prospective study gathered 359 patients from the daily hospital, who were treated in general anaesthesia or sedation, on the Dental Clinic during the 8 year period. Preoperative evaluation and preparation by the anaesthesiologist was of crucial importance. For most of the patients a longer optimization and preoperative preparation was required along with additional diagnostic methods and consultations with other specialists. Half hour after the premedication was given, patient was anaesthetized and airway was secured by endotracheal tube. During the anaesthesia and recovery patients were monitored for the possible complications. Patients were released 4 hours after the procedure at the earliest, after the thorough examination by anaesthesiologist and with the recommendation for further treatment. 2176
Results: Among the analyzed patients 74,09% had neurological-psychiatric diseases. Half of them were 11-20 years old, 86,62% patients received intramuscular premedication. The duration of the operation was from 30 to 120 minutes. For 97,21% patients induction was intravenous, and for 42,12% patients TIVA was administered. Airway was secured by the placement of endotracheal tube in 95,55% patients. All patients (but one) were released home 4 hours after the dental intervention, without significant intra and postoperative complications. Conclusion: Good and thorough preoperative preparation, along with the good choice of general anesthesia allows the maximum safety when working with disabled patients. The possibility of complications for these patients is reduced to minimum. Key words: disabled patients, general anaesthesia, dental interventions Introduction Most dental procedures are performed under local anaesthesia or without it. There are cases and interventions that demand general anaesthesia (GA). The need for GA exists in cases of very painful procedures, allergies on local anaesthetics, great fear, small children who don’t cooperate, patients with complex medical state, children with orofacial trauma, also the need for GA exists in cases of children that are being treated in intensive care unit, but mostly this need exists for treatment of patients with congenital or acquired disabilities
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
(1,2,3,) - such as: cerebral paralysis, Down syndrome, autism, degenerative conditions etc. These patients frequently have combined diseases such as: congenital heart failure, frequent respiratory infections, atlantooccipital instability, subglottic stenosis, thyroid dysfunction, spinal deformities. Cooperation with these patients is difficult, they are often aggressive, with movement disorders followed with spasticity or uncontrolled movement. We can define a disabled patients as an individual with mental or physical dysfunction which significantly limits one ore more important everyday activities (self care, walking, hearing, sight, breathing, reading, work, speech, learning, thinking, concentration, communication and other) (3). One classification of disabled patients is on physical invalidity, sensational, mental, and cognitive. The “developed disability” is caused by the impairment that happened during the growth period (from the birth until 18 years old). The impairment can occur prenatal, perinatal or postnatal. The “acquired disability” is caused by the damage that appeared after the growth period such as head or spinal injuries, multiple sclerosis, and arthritis. Malamed has made a list of advantages and disadvantages for use of GA for disabled patients in dentistry. Advantages are: The patient’s cooperation is not absolutely necessary, patient is not conscious during treatment, does not react to pain, and the amnesia is present after awakening. Leading disadvantages are: Considering the complex medical state, perioperative complications are more frequent, problems in securing the airway are more common, the need for sophisticated equipment exists along with the need for highly qualified medical staff (4). Preoperative preparation - GA needs to be adjusted to the length and the type of the intervention and to the patients needs. The preoperative preparation of the patient is very important, it is performed by the anaesthesiologist, and it requires introduction to the patient’s health. For most of the patients a longer optimization and preoperative preparation was required along with additional diagnostic methods and consultations with other specialists, in order to optimize patient’s health before the GA (4,5).
The gold standard for securing the airway through out the GA for dental patients is endotracheal tube. We often meet altered airway and difficult intubation when working with disabled patients or patients with associated anomalies, and it is necessary to focus on the preoperative preparation and evaluation on airway. It is very important to have equipment for difficult intubation always available during the intervention. Nasotracheal intubation provides the more comfort for the dental team, but it has its limitations and complications. Orotracheal intubation is acceptable, but in that case it is necessary to change the position of endotracheal tube often within the oropharynx during the dental intervention. The advantages of the placement of endotracheal tube this way are the quick placement and minimum damage during the placement of the tube. Armored laryngeal mask (LMA) can be suitable for interventions in which bleeding or any other liquid content is not expected in the mouth. It is easily placed but does not provide absolute protection of airways from the aspiration. The lack of LMA is that it interferes with the placement of the dental instruments. In literature, for the very short interventions the use of inhalation anaesthetics is mentioned through face mask or nasal cannula. At the end of the procedure when all of the dental equipment is removed, it is important to check carefully if the airway is clear, hemostasis adequate and after that extubate the patient. Postoperative recovery – Most dental procedures are performed in so called day case surgery, which means that the patient is admitted and released from the hospital in the same day. It is recommended that this type of procedures last between two and four hours. After the procedure the patient is placed in to the post-anaesthesia recovery room where they are under the constant supervision of anaesthesiologist and nurse / technician. In this phase the degree of patient’s wakefulness is monitored along with vital parameters and pain management therapy is implemented. For the pain release usually acetaminophen is enough but other analgetics are also used. In this period sometimes intravenous fluid resuscitation is needed and sometimes antiemetics need to be used (4). If the period after the intervention passes without any complications patient can leave the hospital accompanied by the adult person no earlier than 4 hours after the procedure, and with the con2177
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
sent of the anaesthesiologist. Before the discharge from the hospital parent or accompanied person is given detailed instruction and recommendation for the further pain management therapy, regular therapy which the patient already uses, nutrition regimen and physical activity (7). Aim To present complexity of preparation and performance of anaesthesia for disabled patients during the dental procedures and methods for minimizing the potential complications based on the 8 years of experience. Material and methods Clinical prospective-retrospective study that included all patients, 359 of them, that were operated in GA or sedation at Dental Clinic of Vojvodina in Novi Sad during the period 2002 to 2009. Patients were treated in the day hospital. Preoperative examination by the anaesthesiologist has been conducted the day before at the clinic for paediatric surgery. Patients came to the clinic on the day of the dental intervention escorted by the parent or the guardian. Most patients received intramuscular premedication (atropine 0,01 mg/ kg – max. dosage 0.5 mg, and midazolam 0,1 mg/ kg – max. dosage 5 mg) 30 minutes prior to the intervention. Before entering the operating room, an intravenous cannula was placed. Before induction of GA, connect patients on standard monitoring (electrocardiogram, noninvasive blood pressure measurement, monitoring of heart rate, pulse oximetry, end-tidal CO2). During the intervention all complications were recorded. At the end of the intervention when the sufficient breathing is established, an adequate cleaning of oral cavity has been done, and endotracheal tube is removed in the operating room, patient were transferred to the recovery room where they were under the constant supervision of anaesthesiologist and anaesthetist. During the postoperative recovery analgetics were administered along with all other necessary therapy. Patients were released home four hours after the intervention, with the consent by the anaesthesiologist and escorted by the adult person. 2178
Results Patient structure Analyzing the age of the patients ( Chart 1) we notice that the majority of patients was between 11 and 20 years old (49,01%), and that only one patient had more than 46 years. Among the operated patients more were male 209 (58,22%) (Chart 2).
Chart 1. Age structure
Chart 2. Gender structure Analyzing Chart 3 we notice that most patients 344 (95.82%) belonged to the ASA group II and III, and only 15 patients (4,18) belonged to ASA I group, meaning they were healthy.
Chart 3. ASA classification Analyzing the primary disease (Table 1) it is noticeable that most patients had neuropsychiatric diagnosis (74,09%), cardiovascular diseases were present in 18 patients (5,01%), 10 patients had lung diseases (2,78%), obesity was present in 13 cases (3,62%), and 43 patients (11,98%) had allergies. 138 had continuous therapy (38,44%)
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
– psychiatric therapy, antihypertensives, anti-asthmatic therapy and hormone substitutes. Table 1. Primary disease
Disease Number of Percentage patients (%)
Table 2. Induction of anaesthesia
Induction Intravenous tiopenthal propofol ketamin Inhalatory Number of patients 349 243 98 8 1 Percentage (%) 97,21 67,69 27,3 2,23 0,28
Neuropsychiatric diseases Cardiovascular diseases Lung diseases Obesity Hyperthyreoidism Diabetes mellitus Renal diseases Congenital anomalies Anaemia Allergy
266 18 10 13 2 1 3 2 10 43
74,09 7,79 2,78 3,62 0,58 0,27 0,83 0,54 2,78 11,97
Maintenance of anaesthesia Combined anaesthesia – inhalational with intravenous was administered in 199 cases (55,43%), and intravenous anaesthesia (TIVA) in 151 (42,06%) cases. (Chart 5). Dental intervention under analgosedation was performed in 8 cases (2,23%) and 1 patient (0,28%) had local anaesthesia after premedication.
Duration of intervention Dental intervention lasted between 30 and 120 minutes in 278 (77,43%) patients (Chart 4). Only 4 patients (1,11%) had interventions longer than 3 hours, and 25 patients (6,69%) had interventions shorter than 30 minutes.
Chart 5. Maintenance of anaesthesia During GA for most patients 289 (80,50%) opiod analgetics were administred: fentanyl in 284 cases (97,11%), alfetanyl in 5 cases (1,39%), methamizol in 6 cases (1,67%). (Chart 6) Chart 4. Duration of intervention Premedication 350 patients (97,5%) were premedicated 30-45 minutes prior to the dental intervention. Because of the total lack of cooperation 9 patients (2,51%) weren’t premedicated. Premedication was intramuscular for 311 patients (86,63%). Induction of anaesthesia 349 (97,21%) patients had intravenous induction and only one patient (0,28%) was induced to GA via inhalation of sevoflurane.
Chart 6. Intraoperative analgesia Muscle relaxants were given to 343 patients (95,58%): succinylcholine alone for 127 patients (35,38%), in combination with rocuronium for 104 patients (28,97%), with atracurium for 47 patients (13,09%), with pancuronium for 1 patient (0,28%), with mivacurium for 17 patients (3,90%). Rocuronium was administered in 46 cases (12,81%), atracurium in 1 case (0,28%), and mivacurium in 3 cases (0,84%). 2179
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 3. Muscle relaxants
Relaxant Succinylholine Succinylholine + Rocuronium Succinylholine + Atracrium Succinylholine + Pancuronium Succinylholine + Mivacurium Rocuronium Atracrium Mivacurium Number of patients 127 104 47 1 14 46 1 3 Percentage (%) 37,03 30,32 13,70 0,29 4,08 13,41 0,29 0,87
Chart 8. Postoperative analgesia Along with analgetics, other necessary therapy was also given. Complications Complications were registered in only 35 (9,75%) cases mostly during anaesthesia, and 3 patients (0,84%) had postoperative complications (Table 4). Complications were transient, in most cases it was bradycardia, arrhythmia, bronchospasm and allergic reactions, but didn’t affect dental procedure in way it had to be stopped (Table 5). All patients were released 4 hours after the surgery with the consent by the anaesthesiologist, escorted by adult person. Only one patient (0,28%) was hospitalized for 24 hours because of respiratory complications. Table 4. Complications
Period of anaesthesia Induction Maintenance Awakening Postoperative Number of patients 11 15 6 3 Percentage (%) 3,06 4,18 1,67 0,84
The reversal of muscular block with neostigmine was administered in 100 cases (27,85%). Airway Airway was secured for 343 (95,54%) patients by the placement of endotracheal tube, orotracheal intubation in 334 cases (93,03%) and nasotracheal intubation in 9 cases (2,51%) (Chart 7). 13 patients (3,62%) had difficult intubation, but the placement of endotracheal tube was possible. During the dental intervention 16 patients (4,46%) was breathing spontaneously with O2 through the mask.
Table 5. Type of complication Chart 7. Airway Postoperative course During the postoperative course, depending on the type of the intervention, patients were given analgetics. 144 patients (40,11%) were given analgesia immediately after the surgery – methamizol in 123 cases (34,26%), Ketorolac for 8 patients (2,23%), Paracethamol for 9 patients (2,51%), Diclofenac for 4 patients (1,11%) (Chart 8). 2180
Complication Urticaria Bradycardia Tachycardia Hypertension Arrhythmia Bigeminia Cuff leak Bronchospasm Bleeding Prolonged awakening Respiratory insufficiency
Number of Percentage patients (%) 4 1,11 7 1,95 2 0,56 2 0,56 6 1,67 2 0,56 2 0,56 4 1,11 2 0,56 3 0,84 1 0,28
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Discussion Most disabled persons do not cooperate enough during the dental procedures and require GA. Disabled persons are often patients with high risk for general anaesthesia because of severe comorbdity and anomalies which follow their primary illnesses (1). Pointing out to advantages and disadvantages of GA in patients with disability, Malamed and associates underlain that this is the way to bypass hard and sometimes impossible cooperation, but also it opens up new risks that follow GA (4). With this in mind patients who are going to be subjected to dental procedure in GA require extensive preoperative preparation and assessment (2,4) which was conducted for analyzed patients. Only those patients who didn’t have any acute disease or exacerbation of chronic illness were included in operation program. In case of acute disease, dental intervention in GA was postponed for two weeks. For registered deterioration of chronic illness, additional analyses and consultations with specialists have been done. Only when the optimal health state was accomplished, dental intervention had been done in GA (4,5). Most of our patients (more than 90%) belonged to ASA II and III groups, and usually beside their primary illness had other comorbidities, only 15 patients were healthy, from ASA I group and were subjected to GA because of fear and lack of cooperation. Patients from ASA IV and V groups needed intensive care and hospitalization because of their poor general condition which is why their dental interventions couldn’t be done in day hospital. Even though nowadays a priority is given to oral premedication (6), because of difficulties in cooperation most of our patients were given premedication intramuscularly. Because of hypersalivation, and intervention inside the mouth all patients without contraindications were given Atropine in their premedication. Only one patient didn’t accept placement of intravenous cannula and had inhalation induction to anaesthesia, all other patients had intravenous induction with the use of hypnotic, opioid analgetic and muscle relaxant. For patients with the possibility of difficult intubation short acting succinylholine was used as relaxant (taking in consideration the possible contraindications).
13 (3,79%) patients had difficult intubation, but all were ultimately intubated. There was no life threatening situations when securing the airway. More than 40% of patients had total intravenous and others had balanced anaesthesia (8). Thanks to the good preoperative preparation, incidence and severity of complications were small (less than 10%). Most was noted during anaesthesia (bradycardia, bradyarrythmia, bronchospasm and others) and was transient with the therapy and without it. Post-anaesthesia observation was done with the constant supervision by anaesthesiologist, anesthetist and parent / guardian during 4 hours and more after awakening. All patients were released from the hospital but one who had to be hospitalized 24 hours due to the respiratory complications. Conclusion Years of experience (more than 15), trained team, good algorithm of preoperative planning and conducting anaesthesia and modern technical equipment helped in making anaesthesia for this complex group of patients, be performed with minimal complications. Abbreviations GA – general anaesthesia LMA – laryngeal mask airway References
1. Dougherty N. The dental patient with special needs: a review of indications for treatment under general anesthesia. Spec Care Dentist 29(1): 17-20, 2009. 2. Vargas-Roman Mdel P, Rodriquez-Bermudo S, Machuca Portill G. Dental treatment under general anesthesia: A useful procedure in the third millennium (II). Med Oral. 2003 Aug.Oct; 8 (4): 281-7. 3. Burtner P. Oral health care for persons with disabilities: an online by Department of Pediatric Dentistry College of Dentistry University of Flori-
Journal of Society for development in new net environment in B&H
2181
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
da. [cited 2009 March 19]. Available from: www. dental.ufl.edu/faculty/pburtner/disabilities/english/ defdisab.htm 4. Malamed SF. Sedation: a guide to patient management, 4th ed. St. Louis, MO: Mosby; 2003:428-31. 5. Caputo AC. Providing deep sedation and general anesthesia for patients with special needs in the dental office-based setting. Spec Care Dentist 29(1): 26-30, 2009. 6. Soreide E, Eriksson LI, Hirlekar G, Eriksson H, Henneberg SW, Sandin R et al. Pre-operative fasting quidelines: an update. Acta Anaesthesiol Scand 2005; 49: 1041-1047. 7. Jinzenji A; Maeda S; Higuchi H; Yoshida K; Mori T; Egusa M; Miyawaki T. Partial laryngospasms during general anesthesia with a laryngeal mask airway for dental treatment: a report of 5 cases. J Oral Maxillofac Surg 2010; 68 (10):2554-7. 8. Turanjanin-Tomic G., Draskovic B., Stanic-Canji D., Uram-Benka A. Specificnosti opste anestezije u stomatologiji kod osoba sa posebnim potrebama. Medicinski pregled 2010;LXIII(7-8):535-40. 9. Messieha Z. Risks of general anesthesia for the special needs dental patient. Spec Care Dentist 29(1): 21-25, 2009. 10. Asahi Y, Kubota K, Omichi S. Dose requirements for propofol anaesthesia for dental treatment for autistic patients compared with intellectually impaired patients. Anaesth Intensive Care 2009; 37: 70-73. Biljana Draskovic Institute of Child and Adolescent Health Care of Vojvodina, Clinic of Paediatric Surgery, Novi Sad, Serbia, E-mail. drbiljanadraskovic@gmail.com
2182
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Metatarsalgia caused with Osteoid Osteoma in active gymnast: case report
Maric M.D1, Djan I2, Maric L.D4, Madic D3, Petkovic D5, Velickovic S5, Gajdobranski Dj1
1 2 3 4 5
Institute for health care of children and youth of Vojvodina, Pediatric Surgery Clinics, Novi Sad, Serbia, Institute for Oncology, Radiology Department; Sremska Kamenica, Serbia, Faculty of Sport and physical culture Novi Sad, Serbia, Faculty of Medicine, Department of Anatomy, Novi Sad, Serbia, Faculty of Sport and physical culture Nis Serbia.
Abstract We report the case of a 17-years old girl, active gymnast for longer then 10 years, complained having the pain in the upper part of the foot. Diagnosis was established by clinical examination, patient history and radiography of the foot. Diagnosis was osteoid osteoma of the second metatarsal bone. Operative treatment was indicated. At our clinics modified techniques of percutaneous nidus excision was performed. In postoperative period therapy was inactivity, leg elevation, walk with cruthes. Control X-ray after three months showed complete restitutio of excision localization. We think that our technique is very efficient in the treatment of accessible osteoid osteoma, very low cost, easily applicable, and lead to fast loss of pain and fast recovery of sportsmen to everyday activities. Key words: osteoid osteoma, gymnast, percutaneous excision, nidus biopsy Introduction Metatarsalgia presents a painful state in the area of metatarsus. It can be localized and difuse (1, 2). Pain cause can be multiple – due to soft tissues, bones, articular and periarticular structures (3,4). Clinical manifestations are often unspecific, so due to the limitations of radiography, and in the scope of the most precise diagnostics, in everyday clinical practice MRI was implemented (5, 6).
Sportsmen whose everyday activities are high impact sports that include running, jumping, and contact sports as well are exposed to foot injuries (7) The most often cause of metatarsal pain is disbalance of metatarsal bones. These bones absorb weight during walking, so if one of the bones is too long, broken or afected by some other pathology, that leads to the disfunction of all bones causing metatarsal pain. Large number of tumor changes, and most of those benign, can be present in metatarsal region (8). Morton neuroma, fibromatosis, higromas are more often then other neoplastic changes (9). The aim of this paper is to present case study of metatarsalgia in active sportsman caused by osteoid osteoma of second metatarsal bone. Case report A 17-years old girl, active gymnast for longer then 10 years, complain having the pain in the upper part of the foot during mount and dismount. She complains to the general practice physician who gives diagnosis of plantar fascitis, and councils the change of training regime, as well as footpad that relieves pressure on the metatarsal area. At the first period the pain occurs during the night, and after two months of everyday pain, pain with lower intensity occurs after every training. Pain was easily healed by ibuprofen. After two months from the beginning the pain was constant. She then complains to the orthopedics (first author of this pa2183
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
per) which performed X-ray of the foot and gave diagnosis osteoid osteoma of the second metatarsal bone (Figure 1). He indicated operative treatment. At our clinics modified techniques of percutaneous nidus excision was performed. Our modification of percutaneous excision consists of following: we use percutaneous canullised biopter 8mm diameter. Under RTG control nidus is marked by Kirschner needle, verifying the position of the needle within nidus itself (Figure 2.). Canulised biopter is then inserted to the nidus by circle movement with light pressure, exactly 1mm below lower edge of the nidus. In that case nidus with surrounding tissue is totally excised.(figure3) After excision remained cavum is curettaged. Osteoid osteoma nidus obtained by biopsy and curettage content are sent to the patohistological examination. Surgery is performed in bloodless field with Esmarch tourniquet lasting for 15 minutes. In postoperative period therapy is inactivity, leg elevation, walk with crutches for 14 days without support to the upper part of the foot, and after that walk with crutches by gradual increase of the support to the upper part of the foot to the maximum within following 14 days. Control X-ray after three months showed complete restitutio of excision localization (Figure 5). Discussion Metatarsalgia is a term describing pains in the upper part of the foot, especially around the heads of metatarsal bones. Symptoms connected to the pathology are pain and sensitivity of the region to the palpation with the pain projection to the lower part of the sole. Spectra of the pathoanatomical and pathophysiological causes vary to athletic stress. Foot position in equinus during physical activities leads to pressure increase on the upper part of the foot. This pressure leads to lower absorption of ground reaction forces during walk, and excessive stress of metatarsal heads (10). In sportsmen, gymnasts, ballet dancers overstressing also occur, due to high pressure force on the low plane dimension during figures performed. The basic treatment of metatarsalgia is elimination of increased stress overload to the upper part 2184
of the foot. In certain patients changing of type and quality of the footwear during everyday activities can lead to pain decrease (11). Inflammation in the foot region such as plantar fascitis or inflammation of perifacial structures can hide real pathology (12). It also can occur due to repeated trauma of plantar fascia the most often on its insertion on tuberculum of calcaneus bone. Stress on plantar fascia can occur by exceeded pronatio (13) that leads to exceeded extension of plantar fascia, which again increases plantar fascia tension. Factors that can cause overstress of upper part of the foot are muscle weakness, Achile’s tendon tension, structural deformities of the foot (14) Different localizations of osteoid osteoma were described, most often long bones and spine (15,16,17,18;). Clinical examination and radiography could be like in case of infection. Pain which always occurs can be decreased or gone after an acetilsalicil acid. Radiography often shows radioluscent nidus surrounded by bone sclerosis, but this image is not pathognomonic for the osteoid osteoma so in certain number of cases diagnosis can be given after MRI, by CT imaging or even after scintigraphy of the skeleton (19) For a long time period treatment of osteoid osteoma was wide excision. The negative effects of this treatment were need for wide open surgical approach and long postoperative recovery period (20,21,22)). These facts led to the development of percutaneous techniques which enable fast loss of symptoms after nidus excision, and fast recovery after procedure, so the wide excision is recommended for the areas which are not accessible for the percutaneous excision (23,24). Conclusion We think that our technique is very efficient in the treatment of accessible osteoid osteoma, very low cost, easily applicable, and lead to fast loss of pain and fast recovery of sportsmen to everyday activities. Percutaneous excision of nidus enable restitution of foot biomechanics and increased pressure in affected bone is removed. After that a sportsmen can start isometric, isotonic and isokinetic excercises without pain.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
References
1. Fuhrmann, R.A., Roth, A., Venbrocks, R.A. (2005) Metatarsalgia. Differential diagnosis and therapeutic algorithm. Orthopade 34(8),:767-775. 2. Dzankovic F., Avdic D., Macic-Dzankovic A.Result of treatment of simple unstable uncomplicated lower leg shaft fractures treated operatively, Health med Vol4, No1,2010; 95/101. 3. Quirk, R. (1996) Metatarsalgia. Aust Fam Physician 25, 863–869. 4. Wu, K.K. (2000) Morton neuroma and metatarsalgia. Curr Opin Rheumatol 12, 131–142. 5. Hockenbury, R.T. (1999) Forefoot problems in athletes. Med Sci Sports Exerc 7 Suppl, S448-458. 6. Moranjkic M.,Ercegovic Z., Hopdzic M., Brkic H., Ljuca F. Diagnostic caracteristic of neuroradiological test in lumbar disc herniation. Helath med, Vol4,No3,2010. 7. Foo, L.F., Raby, N. (2005) Tumours and tumour-like lesions in the foot and ankle. Clin Radiol 60,308–332. 8. Decherchi, P. (2007) Thomas George Morton metatarsalgia. Presse Med 7-8, 1098-1103. 9. Bolgla, L.A., Keskula, D.R. (2003) A biomechanical approach to evaluating and treating lower leg dysfunction. Athl Ther Today 8(5), 6-12. 10. McPoil, T.G. (1997) The foot and ankle. In: Orthopedic and sports physical therapy Eds: Malone, T.R., McPoil, T.G., Nitz, A.J. 3rd edition. St. Louis: Mosby. 291-292. 11. Kwong, P.K., Kay, D., Voner, P.T., White, M.W. (1988) Plantar fascitis: mechanics and pathomechanics of treatment. Clin Sports Med 7(1),119-126. 12. Chandler, T.J., Kibler, W.B. (1993) A biomechanical approach to the prevention, treatment and rehabilitation of plantar fasciitis. Sports Med 15,344-352Fuller, EA. (2000) The windlass mechanism of the foot: a mechanical model to explain pathology. J Am Podiatr Med Assoc 90(1), 35-46. 13. Crist, B.D., Lenke, L.G., Lewis, S. (2005)Osteoid osteoma of the lumbar spine. A case report highlighting a novel reconstruction technique. J Bone Joint Surg Am 87(2), 414-418. 14. Klingenberg, L., Konradsen, L. (2008) Osteoid osteoma in the hip of 12-year-old girl. Ugeskr Laeger 170(50), 4142 15. Koós, Z., Than, P. (2005) Rare localization of osteoid osteoma in the patella. Pediatr Radiol 35(9), 929-930.
16. Katolik L. (2009) Osteoid Osteoma of the Scaphoid Presenting with Radiocarpal Arthritis: A Case Report. Hand (N Y). Guimaraes, M.C.et al. (2006) Metatarsalgias: differential diagnosis with magnetic resonance imaging. Radiol Bras 39.4 Săo Paulo July/Aug. Iconographyc essey (4) 17. Hadjipavlou, A.G., Tzermiadianos, M.N., Kakavelakis, K.N., Lander, P. (2008) Percutaneous core excision and radiofrequency thermo-coagulation for the ablation of osteoid osteoma of the spine. Eur Spine J [Epub ahead of print] 18. Solarino, G., Scialpi, L., De Vita, D., Cimmino, A. (2004) Multiple osteoid osteoma. A clinical case. Chir Organi Mov 89(2), 161-166. 19. Lisbona, R., Rosenthall, L. (1979) Role of radionuclide imaging in osteoid osteoma. Am J Roentgenol 132, 77-80. 20. Sans, N., Galy-Fourcade, D., Assoun, J. et al. (1999) Osteoid osteoma: CT-guided percutaneous resection and follow-up in 38 patients. Radiology 212, 687–692. 21. Hoffmann, R.T., Jakobs, T.F., Kubisch, C.H., Trumm, C.G., Weber, C., Duerr, H.R., Helmberger, T.K., Reiser, M.F. (2009) Radiofrequency ablation in the treatment of osteoid osteoma-5-year experience. Eur J Radiol [Epub ahead of print] 22. Sierre, S., Innocenti, S., Lipsich, J., Lanfranchi, L., Questa, H., Moguillansky, S. (2006) Percutaneous treatment of osteoid osteoma by CT-guided drilling resection in pediatric patients. Pediatr Radiol 36, 115–118 23. Van Royen, B.J., Baayen, J.C., Pijpers, R., Noske, D.P., Schakenraad, D., Wuisman, P.I. (2005) Osteoid osteoma of the spine: a novel technique using combined computer-assisted and gamma probeguided high-speed intralesional drill excision. Spine 30(3),369-373. 24. Maric D. Djan I., petkovic L.,Vidosavljevic M/. Sopta J., Maric D., Madic D Osteoid osteoma: fluoroscopic guided percutaneous excision techinque/oue expirience. J Ped orthop B, 2011, Vol20,No 1 Corresponding author Maric M.D Institute for health care of children and youth of Vojvodina, Pediatric Surgery Clinics, Novi Sad, Serbia, E-mail: healthmedjournal@gmail.com
Journal of Society for development in new net environment in B&H
2185
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Retroperitoneal lymphadenectomy following chemotherapy for testicular cancer – analysis of postoperative complications according to ClavienDindo classification
Dimitrije Jeremic, Sasa Vojinova, Ivan Levakov, Goran Marusic Urology Clinic, Clinical Center of Vojvodina, Novi Sad, Serbia
Abstract Summary: Surgical complication is any undesirable and unexpected result of an operation affecting the patient. Lately, postoperative complications have been recognized as quality assessment tool. Before comparing complication, we must find single, overall applicable grading system. Objective: to classify postoperative complications of postchemotherapy retroperitoneal lymphadenectomy for advanced testicular cancer by the modified Clavien-Dindo classification system. Patients and methods: We used Clavien Dindo classification. Our research included 59 patients operated in five years time frame. Results: The results based od Clavien Dindo classification are: 27 % of patients had complications (19 complications in 16 patients). We noted following complications: seroma, wound infection, paralitic ileus, arrhythmia, urinary infection, blood transfusions, retroperitoneal haemathoma and wound dehiscence. Conclusion: Incidence and type of complication correlates to those found in literature. Retroperitoneal lymphadendectomy is an extensive procedure, accompanied with significant postoperative complications. Using uniform system for classification of postoperative complications allows different types of therapy to be compared, and as a result objective decrease in morbidity. Key words: Chemotherapy; Retroperitoneal lymphadenectomy; Testical carcinoma; ClavienDindo classification; Complication 2186
Introduction Retroperitoneal lymphadenectomy (RPLND) is an extensive and demanding procedure, followed by frequent postoperative complications. Surgical complication is any undesirable and unexpected result of an operation affecting the patient [1,2]. Lately, postoperative complications have been recognized as quality assessment tool [3]. By defining postoperative complication rates for different procedures, the best procedure can be set as standard. But, before comparing complication rates, we must decide for a single, overall applicable grading system, like Clavien - Dindo classification. When choosing the procedure with minimal postoperative complications we are choosing the most acceptable treatment for the patient. Growing expenses of medical treatment are significant, putting even more accent on need for classification of postoperative complications. Very few articles address issues regarding incidence of postoperative complications for RPLND after chemiotherapy. In their work from 1995 Buniel J. and al. described postoperative complications, but no classification method for those complications has been applied [1] . In another article from this author from 1999, incidence of complications were analyzed, but also without classification system applied [4]. After review of available online literature, other articles related to this issue couldn’t be identified. It is apparent that there is relative lack of information regarding incidence and classification of postoperative complications according to an accepted classification system.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Objective To classify postoperative complications of postchemotherapy RPLND for advanced testicular cancer by the modified Clavien-Dindo classification system. Material and methods Retrospective study has been conducted, overall 59 consecutive patients had been enrolled. All patient were operated in five years time frame (20052010). Inclusion criteria were: patients had radical orhiectomy for testical carcinoma, after which retroperitoneal lymphadenomegaly has been observed on CT. In average they received three cisplatin, etoposide and bleomycin (PEB) cycles after which unilateral or bilateral retroperitoneal lymphadenectomy has been performed. Patients were identified by type of operation (radical orhiectomy and retroperitoneal lymphadenectomy), and selection narrowed only to those patients who also had chemotherapy. Unilateral or bilateral nerve sparing retroperitoneal lymphadenectomy was performed. Borders for bilateral lymphadenectomy are: renal vein cranialy, ureters lateraly and a.iliaca comunis caudaly. In case of unilateral lymphadenectomy we used modified right and left sided lymphadenectomy. Data regarding postoperative follow up was extracted from medical histories (therapy, operative, anesthesiology and discharge lists). We used Clavien-Dindo classification of postoperative complications, that has five grades:
Results All patients had PEB protocol, in average three rounds. The mean age was 31.95 (range 19-57) years. Right to left ratio was 29 : 30. After radical orhiectomy patohistological finding was: tumor mixtus in 44,06 %, carcinoma embrionale 20,33%, teratoma 11,86 %, other 13,69% six patients had inconclusive medical documentation. CT findings showed that patients had residual retroperitoneal mass with mean length of 6,3 cm in longest diameter (range 4,1 to 10,3 cm). CT findings also showed that 28 patients (47,5%) had elements of necrosis and fibrosis within retroperitoneal masses. Patohistological finding after removal of retroperitonela lymph nodes were:
Chart 1. Patohistological finding after retroperitoneal lymph node dissection The mean time from castration to RPLND was 9,26 months (range 2-36). The median operative duration, defined as time from incision to skin closure, was 277 minutes (range 150-510). Unilateral
Table 1. Clavien-Dindo classification of postoperative complications
Any deviation from the normal postoperative course without the need for pharmacological treatment or surgical, endoscopic and radiological interventions. Grade I: Allowed therapeutic regimens are: drugs as antiemetics, antipyretics, analgetics, diuretics and electrolytes and physiotherapy. This grade also includes wound infections opened at the bedside. Requiring pharmacological treatment with drugs other than such allowed for grade I Grade II: complications. Blood transfusions and total parenteral nutrition are also included. Grade III-a: intervention not under general anesthesia Grade III-b: intervention under general anesthesia Grade IV: Life-threatening complication (including CNS complications)‡ requiring IC/ICU-management Grade IV-a: single organ dysfunction (including dialysis) Grade IV-b: multi organ dysfunction Grade V: Death of a patient
Journal of Society for development in new net environment in B&H
2187
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
RPLND was preformed in 19 cases and bilateral in 40 cases. Average length of hospitalization was 10.65 days (range 7-23). Mean intraoperative blood loss was 156 ml (107-713 ml, n=59), 21 patient recived blood transfusion postoperatively. Overall 27 % of patients had complications (19 complications in 16 patients).
Chart 2. Distribution of complications
Grade I complications were: seroma, wound infection, paralitic ileus. Grade II: arrhythmia, urinary infection, blood transfusions and grade III b : retroperitoneal haemathoma, wound dehiscence.
Disscusion Retroperitoneal lymphadenectomy is an extensive procedure and further assessment of postoperative complications is needed for better postoperative care. Data found in literature suggests that complication rates vary between 20 and 33% [5]. Majority of those studies classifies those complications by significance or time they have occurred. This is amenable to personal judgment and subjective estimation. In our study we used Clavien Dindo classification which is based on applied therapy. Therefore, no misleading personal judgment has been involved in our estimation of postoperative complications. We found that complications occurred in 27%, affecting overall 16 patients. Mean age in operated cohort was 31,95 years. This is a favorable fact, but complication rates are expected when taking in consideration the fact that nearly all patients had bulky retroperitoneal lymphadenomegaly. Large and necrotic postchemotherapy masses (mean 6,3 cm in longest diameter) 2188
and significant number of patients whith necrotic changes contributed to significant percentage of postoperative complications. Overall 17 patient had modified retroperitoneal lymphadenectomy, thirteen on left side and four on right side. 42 patients had bilateral retroperitoneal lymphadenectomy. No difference in postoperative complication rates between those two groups have been observed. Only one patient had reccurence after unilateral RPLND, for this patient bilateral RPLND has been performed. We found that 10 patients had only residual mass removal, without lymph node dissection to defined borders. In this group the most common patohistological finding was teratoma and no recurrence has been observed among these patients. Data acquired from this analysis regarding operative duration, blood loss and length of hospitalization highly correlate with data found in literature. Using applied therapy as marker for complications makes this estimation exact and accurate. Data regarding applied therapy are always on disposal and objective. Using the extent of severity (minor/ major) as a ranking principle makes this estimation subjective. Retrograde analysis very often doesn’t report complication rates with accuracy, because many of complications haven’t been noted. Data about therapy applied to treat those complications are always present. As this was retrograde analysis, including five years time frame, we found data extraction to be easy and consistent. There has been a significant increase in health care demand recently. Availability of diagnostic methods and aging population contribute to over usage of constrained financial resources. Postoperative complications, length of hospitalisation and applied therapy significantly increase treatment costs. Indentifying and further assessment of those parameters by a unified system is needed. This could provide further evaluation for assessment of indications, operative techniques, surgeon volume thresholds and outcomes. The primary goal must remain“non nocere”, meaning that financial outcomes mustn’t be more important than patient benefit. At this moment there isn’t a classification model that is universally accepted as the standard. Using diverse definitions of complications and postoperative classifications disables definitive assessment of operative techniques and treatment [6,7,8,9].
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Conclusion Retroperitoneal lymphadenectomy in group of patients that received chemotherapy for testicular carcinoma is an extensive and demanding operation. Extensive dissection and large volume of postchemotherapy mass combined with desmoplastic reaction in tissue makes this operation even more difficult. Mean age of patients in this group is certainly a favorable fact, resulting in low postoperative complication rate. There is a small number of studies regarding postoperative complications after postchemotherapy retroperitoneal lymphadenectomy. It is important to classify those complications according to single, overall applicable system like Clavien – Dindo classification. This is a good base for further comparison and improvement of operative techniques, medicament treatment and perioperative management. References
1. J. Baniel, R.S. Foster, R.G. Rowland, R. Bihrle, J.P. Donohue Complications of Post-Chemotherapy Retroperitoneal Lymph Node Dissection. The Journal of Urology. 1995; 153(3):976-980. 2. Daniel K. Sokol , James Wilson. What Is a Surgical Complication. World Journal of Surgery. 2008;32(6):942-944. 3. Daniel Dindo, Nicolas Demartines, Pierre-Alain Clavien. Classification of Surgical Complications A New Proposal With Evaluation in a Cohort of 6336 Patients and Results of a Survey. Annals of Surgery. 2004; 240(2): 205–213. 4. Jack Baniel, Avishay Sella Complications of retroperitoneal lymph node dissection in testicular cancer: Primary and post-chemotherapy. Seminars in Surgical Oncology 1999; 17(4) 263–267 5. Vairavan S. Subramanian, Carvell T. Nguyen, Andrew J. Stephenson, Eric A. Klein. Complications of open primary and post-chemotherapy retroperitoneal lymph node dissection for testicular cancer. Urologic Oncology. 2010;28(5):504-509. 6. Clavien P, Sanabria J, Strasberg S. Proposed classification of complication of surgery with examples of utility in cholecystectomy. Surgery. 1992;111:518– 526.
7. Veen M, Lardenoye J, Kastelein G, et al. Recording and classification of complications in a surgical practice. European Journal of Surgery. 1999;165:421–424. 8. Pillai S, van Rij A, Williams S, et al. Complexityand risk-adjusted model for measuring surgical outcome. British Journal of Surgery. 1999;86:1567– 1572. 9. Dimitrije Jeremić, Sasa Vojinov, Goran Marusić, Ivan Levakov, Srdjan Zivojinov. Radical cystectomy – analyses of postoperative course. Vojno Sanit Pregl 2010;67(8):649-52. Corresponding author Dimitrije Jeremic, Urology Clinic, Clinical Center of Vojvodina, Novi Sad, Serbia, Email: dimitrijejeremic@gmail.com
Journal of Society for development in new net environment in B&H
2189
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Assessment of life quality in patients with Rheumatoid Arthritis
Snezana Tomasevic-Todorovic¹, Ksenija Boskovic¹, Radmila Matijevic², Cila Demesi-Drljan³, Slobodan Pantelinac¹, Aleksandar Knezevic¹ ¹ Clinic for Medical Rehabilitation, Clinical Center of Vojvodina, Serbia, ² Clinic for Orthopedic Surgery and Traumatology, Clinical Center of Vojvodina, Serbia, ³ Institute for Children and Youth Health Care of Vojvodina, Serbia.
Abstract Purpose: The aim of this study was evaluation of the quality of life of patients with rheumatoid arthritis. Material and Methods: We studied 94 patients (80 women and 14 men), their mean age being 51.24 ± 8.33 years. The patients were examined and treated in a multidisciplinary fashion in the Rehabilitation Clinic and the Special Hospital for Rheumatic Diseases in Novi Sad. To assess the quality of life of the treated patients Short Form 36 (SF-36) test was used. Findings: The patients with rheumatoid arthritis are found to have poor quality of life in all its segments, especially with respect to roles of physical and emotional functioning, physical health and pain. Conclusion: Using the SF-36 questionnaires to assess the quality of life of patients with rheumatoid arthritis provided an insight into the nature and the extent to which it affects health and life segments. The routine use of questionnaires at clinics aimed at assessing the quality of life would set guidelines for therapeutic approaches. Key words: arthritis, rheumatoid; quality of life, SF-36. Introduction Rheumatoid arthritis is a chronic, progressive and inflammatory disease with an unpredictable course that leads to the emergence of strains, as well as to a significant reduction of functional and working ability (1, 2). In patients with rheumatoid arthritis, persistent pain and limitation of fun2190
ctional capacity contributes to the disorder of the physical, psychological and social function (1). Psychological and social aspects of rheumatoid arthritis have often been unfairly ignored by medical experts although they significantly reduce the quality of life of patients and require adaptation (3). Recent clinical guidelines have recognized the importance of psychosocial factors in the multidimensional approach to evaluation and treatment of patients with rheumatoid arthritis (4). Patients with rheumatoid arthritis require a lifelong drug therapy and periodic medical rehabilitation. Moreover, assessment, monitoring and improving their quality of life are of vital importance. Numerous studies indicate to the importance of biopsychosocial and multidisciplinary approach to rehabilitation that takes into account the importance of physical and mental domains of health as such an approach contributes to the improved quality of life of patients with rheumatoid arthritis (5, 6). Measuring the quality of life of patients during a rehabilitation treatment is the best indicator of the actual situation, as well as the recovery of patients; it is proposed as a mandatory measure in a comprehensive approach to treating patients with chronic pain (7, 8). SF 36 is a commonly used questionnaire in assessing the quality of life of patients with rheumatoid arthritis in the course of drug /biological, DMARDs / and therapeutic procedures (physical agents, kinesiotherapy, hydrotherapy, occupational therapy) (9, 10, 11, 12, 13). Objective The aim of this study was to assess the quality of life of patients with rheumatoid arthritis.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Materials and methods The study included 94 patients (80 women and 14 men) with rheumatoid arthritis who were treated at the Department of Rehabilitation and Hospital for Rheumatic Diseases in Novi Sad. All patients were ergonomically trained and the overall physical treatment was administered (kinesiotherapy, hydrotherapy, laserotherapy, low frequency pulsed electromagnetic field and ultrasound). Data were obtained from history and current medical records. The anatomic and functional stages were also assessed as suggested by Steinbrocker, and so were the disease activity (DAS 28) and functional status (Health Assessment Questionnaire, HAQ). The questionnaire included the assessment of the quality of life of patients with rheumatoid arthritis using a generic questionnaire Short-Form-36 Health Survey (SF-36), which contains 36 questions. The questions were grouped into 8 domains regarding quality of life: physical functioning, role of physical functioning, role of emotional functioning, social relationships, physical pain, mental health, vitality and general health. The domains were obtained by grouping the two summary scores - physical and mental scores. The answer to each question was scored from 0-100. The coding of responses, the calculation of the value of each domain and summary scores were performed using a mathematical model standardized for the general U.S. population. We used the definition of the individual SF-36 questionnaire by which patients are given explanations with respect to the manner and purpose of the test. Results The group encompassed 94 patients with rheumatoid arthritis of both genders (80 women and 14 men), their age being 51.24 ± 8.33 years (Table 1). The majority of respondents (54) were over 50 years old. Forty-eight (51.06%) patients had secondary school education and 41 (43.61%) completed primary school education. The minority of patients (2, 2.13%) were college educated (Table 1). The analysis of the patients’ marital status shows that the majority of respondents (78 of them, or 82.98%) were married, as shown in Table 1.
Table 1. General characteristics of the patients (n = 94)
Patients characteristics Age (years), X±SD Sex (n, %) Male Female Education Primary high school college university degree Marital status Marriage single Values 51,24±8,33 14 (14,89) 80 (85,11) (n, %) 41 (43,61) 48 (51,06) 3 (3,19) 3 (3,19) (n, %) 78 (82,98) 16 (17,02)_
The measures of the central tendency of the assessment of the disease activity shown in tables indicate to the fact that the average duration of the disease is 8.48 ± 7.22 years, and the average value of the disease activity in DAS28-RA group is 5.18 ± 0.98 (Table 2). The average values of anatomical staging according to Steinbrocker’s were 1.96 ± 0.66, whereas the functional class was 1.98 ± 0.63 (Table 2). The results of the tests of functional ability of patients using a questionnaire-HAQ Health Assessment Questionnaire showed the average values of 1.67 ± 1.61 (Table 2). Table 2. The average values of indicators of disease activity
Indicators of disease activity Average values ± SD Duration of illness 8,48±7,22 Anatomical stage 1,96±0,66 Functional class 1,98±0,63 5,18 ± 0,98 DAS28 1,67 ± 1,61 HAQ
*DAS28-disease activity score 28, HAQ-Health Assessment Questionnaire,
The results of the assessment of the quality of life using the SF-36 questionnaires are presented according to different scales, as well as in the form of integrated physical and mental scores. The questions assessed the quality of life in the last 4 weeks, except for the health perception domain, which assessed the health changes over the last year. 2191
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The values of bodily pain (38.68 ± 21.69) show the existence of an intense pain in patients with rheumatoid arthritis (Table 3). The values of the physical functioning domain (44.92 ± 22.53) and the role of physical functioning (24.78 ± 20.94) were low in the examined patients, as shown in Table 3. The values of the domain of physical functioning and the role of physical functioning were statistically significantly lower than in the general population average (p<0.01) (Figure 1).
Figure 1. Results of SF36 questionnaire The tests of the general health domain (38.66 ± 16.51) and mental health (56.06 ± 20.27) showed high values at the time of testing (Table 3). The obtained values are lower with respect to the emotional functioning domain (25.36 ± 18.36) in patients with rheumatoid arthritis as opposed to
the average value of the general population. Low values in the domain of emotional functioning are best reflected in performing common daily activities (Figure 1, Table 3). The table values show a low vitality score (46.71 ± 21.94) in patients with rheumatoid arthritis and are a result of fatigue and exhaustion (Table 3). The analysis of the domain of social relationships (54.29 ± 24.49) points to limited social contacts in the study group during the test as a result of hospitalization (Table 3). Applying a mathematical model, the average values of the physical summary score (35.90) were calculated based on the domains of physical functioning, the role of physical functioning, general health and bodily pain. The average values of the mental domain (39.30) were obtained from the value of the role of emotional functioning, mental health, vitality and social relations. The mathematical model for calculating is standardized due to which the values of these domains for the general U.S. population are 50 ± 10. Creating this model has made the interpretation of results easier owing to the difference of 10 points (a difference of one standard deviation in relation to the general population in the United States). The values of physical and mental summary scores were lower than the values in the general population, as shown in Table 3.
Table 3. Quality of life of patients with rheumatoid arthritis
Questionares SF36 Pain Physical functioning Role, physical Role, emotional Mental health Vitality General health status Social relations Overall physical health Overall mental health X 38,68 ±21,69 44,92±22,53 24,78 ± 20,94 25,36±18,36 56,06±20,27 46,71±21,94 38,66±16,51 54,29±24,49 35.90 39,30 Standard values 75,5 85,4 81,2 81,3 74,8 61,0 72,2 83,6 50±10 50±10
*RP-Role functioning physical, BP-bodily pain, GH-general health, VT-energy, SF-social functioning, RE-Role functioning emotional, MH-mental health, PCS-physical summary score i MCS-mental summary score)
2192
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Discussion The most common concepts of the quality of life assess physical function, psychological, social function and general health status. The SF36 questionnaire has been frequently used in assessing the quality of life owing to its simplicity and accuracy, as well as due to its good correlation with all indicators of disease severity, the only exception being disease duration (13, 14). This questionnaire is used for the assessment of the overall reduction and the reduction in quality of life with respect to its particular segments, which enables a targeted treatment approach and greater attention to the most damaged segments during treatment. Literature data indicate to the fact that rheumatoid arthritis affects women more frequently than men (3-5 times), with the highest incidence of occurrence of rheumatoid arthritis between the ages of 4 and 6 (15, 16). In our group there was an inversely proportional relationship between the sexes (5.71:1, i.e. 80 women and 14 men), and the average age of patients was 51.24 ± 8.33 years, which is consistent with the literature data. It is known that low level of education is a risk factor for a significant reduction in functional disability (HAQ score high), as well as for the development of depressive disorders (17, 18). The increased HAQ scores at the beginning of diseases are poor prognostic factors for the work ability (18). The largest number of patients studied had high school education (48), and the smallest number of them completed higher and university education (3). Viewed from the perspective of their educational background, there were no significant differences among patients with rheumatoid arthritis with respect to different sexes, emotional modes of behavior or level of education within the groups (p> 0.1). The analysis of the marital status shows that the majority of respondents (78) were married, as well as that there was no statistically significant difference in marital status with respect to gender (p> 0.1). The consideration of the marital status is important for the motivation of patients with rheumatoid arthritis as there is a risk of developing symptoms of depression due to the lack of social support, especially that among bachelors and divorced patients (20).
The SF 36 questionnaire is the “gold standard” in assessing the quality of life of patients with rheumatoid arthritis. Psychological changes have a significant impact on the quality of life of patients with rheumatoid arthritis; the changes include: sense of helplessness, hopelessness and depression. The change of one’s lifestyles, which presupposes an interruption of common activities and interests, requires the isolation of the patients and their psychological adjustment (3). The assessment of the quality of life has led doctors to examine the patients’ emotional problems and consider the introduction of antidepressants in the treatment, which all indirectly causes reduction in the degree of pain and the use of analgesics (14). Numerous studies have shown a significant reduction in the quality of life in patients with chronic arthritis, especially in the areas of bodily pain and physical functioning, as well as the patients’ social activities (21, 22). The ability of patients with rheumatoid arthritis to perform daily physical activity has been limited. The values in the domain of physical functioning were significantly lower than the values of the general population. The obtained low values in the domain of physical functioning indicate to the patients’ inability to perform more demanding activities when bowed or partially bowed, as well as to their inability to walk longer distances. The authors found differences with respect to gender in the domains of physical functioning. It was found that more women complained about problems in physical functioning than men, which is consistent with the previously published findings (23). The analysis of the issues concerning the role of physical functioning showed a significant influence of the physical health of patients on performing everyday activities. A high percentage of patients were unable to perform common activities owing to experiencing bad effects of work, the time spent at work was shortened, they were restricted with respect to the type of work and the work done required their increased efforts. Other authors also obtained low values in this domain (22). The results obtained by analyzing the responses of the patients pertained to the intensity of physical pain indicate to an intense pain and consequently limited ability to perform everyday activities, which is consistent with the findings of other authors (24). 2193
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
There were no statistically significant differences with respect to the mean pain intensity and unpleasantness of the pain, as measured by the visual analogue scale, between men and women with rheumatoid arthritis, which can be explained by the sex distribution of patients with rheumatoid arthritis (p> 0.1). Literature data indicate to different characteristics of pain in men and women, as well as to different assessments and descriptions of pain. Various strategies of control pain were described, and so were varied ways of coping with the pain, all of them subject to the influence of sociocultural norms (25). Testing in the domains of social relations (54.29±24.49), and mental health (56,06±20,27) showed high values at the time of testing. However, they do not have a greater impact on discomfort, i.e. quality of life of patients with rheumatoid arthritis, which is consistent with the findings of other authors (22). The assessment of the role of emotional functioning indicates to its significant impact on the performance of everyday physical activities of patients with rheumatoid arthritis. The resulting lower value of this domain (25.36 ± 18.36) indicates to the existence of emotional problems in patients with rheumatoid arthritis and their impact on their common daily activities. Similar results pertaining to the interrelation and the incidence of psychological problems and rheumatoid arthritis were obtained by many authors (26). They all recommend the introduction of psychological testing as a routine clinical practice. The low values obtained through the assessment of vitality in patients with rheumatoid arthritis are the consequence of their fatigue and exhaustion, poor quality of sleep. Literature data suggest that physical functioning, bodily pain, fatigue and mental health cause a decrease in quality of life of patients with rheumatoid arthritis (9). The analysis in the domain of social relations indicates to limited social contacts in the study group as a result of the respondents’ hospitalization. Based on their findings, some authors emphasize the importance of social relationships for the improved rate of recovery (22). The values obtained by physical summary scores were lower than with respect to general population due to the impact domains of physical pain 2194
on the domain of physical functioning and the role physical functioning of the patients. In a nutshell, mental score values influenced emotional problems of patients with rheumatoid arthritis, which is consistent with the findings of other authors (26, 27). The patients with rheumatoid arthritis complained about the lack of life energy, nervousness, moodiness, fatigue, exhaustion and sleep problems, all of which can significantly contribute to reducing the summary of both physical and mental score, which is in concert with previously published findings (9, 27, 28, 29). Conclusion Tests for quality of life of patients with rheumatoid arthritis using the SF-36 questionnaires provide an insight into the nature and degree of damage to health and life segments. A routine clinical use of the questionnaires to assess the quality of life has set the guidelines for therapeutic approaches aimed at more complete and better recovery of patients with rheumatoid arthritis. References
1. Sprangers MA, De Reight EB, Andries F et al. Which chronic conditions are associated with better or poorer quality of life?J Clin Epidemiol 2000;53:895-907. 2. Subasic Dj, Karamehic J, Gavrankapetanovic F at al. Correlation of C3D effector molecules concentrations, C1Q-CIC level and clinical activity in patients with rheumatoid arthritis. HealthMed 2010;4(1):1113-1119. 3. Devins GM. Psychologically meaningful acitivity, illness intrusiveness, and quality of life i rheumatic diseases. Arthritis care Res 2006;55:172-4. 4. Simon LS, Lipman AG, Jacov AK; Candill-Slosberg M, Gill LH, Keefe FJ, Kerr KL et al. Pain in Osteoarthritis, Rheumatoid arthritis and Juvenile chronic arthritis. 2 nd edition Glenview IL:American Pain Society;2002 [Clinical Practice Guideline,no.2]. 5. Backman CL. Arthritis and pain. Psychosocial aspects in the management of arthritis pain. Arhritis Research &Therapy 2006;8:221.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
6. Parker J C, Bradley L A, Devellis R M, at al. Byopsychosocial contributions to the management of arthritis disability. Arthritis & Rheumatism, 1993; 36: 885–889. 7. Schipper H.Quality of life assessment in clinical trials. New York: Raven Press, 1990:11-23. 8. Wood-Dauphinee SL. Assessment of back-related quality of life:the continuing challenge. Spine 2001;26(8):857-61. 9. Kiltz U, van der Heijde. Health-related quality of life in patients with rheumatoid arthritis and in patients with ankylosing spondylitis.Clin Exp Rheumatol 2009;27(55):S108-S111. 10. Strand V, Scott DL, Emery P. et al. Physical functuion and health related quality of life: analysis of 2-year data from randomized, controlled studies of leflunomide, sulfasalazine, or methotrexate in patients with active reeumatoid arthritis. J rheumatol 2005;32(4):575-7. 11. Emery P, Kosinski M, Li T, et al. Treatment of rheumatoid arthritis patients with abatacept and methotrexate significantly improved health.realted quality of life. J Rheumatol 2006; 33(4):681-9. 12. Pasqui F, Mastrodonato L, Ceccarelli F, et al. Occupational therapy in rheumatoid arthritis: short prospective study in patients treated with antiTNF-alpha drugs. Reumatismo 2006;58(3):191-8. 13. Ware JE, Shelbourne CD. The MOS 35-item Short Form Health Survey (SF-36). Med care 1992;30(6):473-83. 14. Guyatt GH, Feeny DH, Patrick Dl. Measuring health-related quality of life. Ann Intern Med.1993;1118:622-9. 15. Lipsky EP. Rheumatoid arthritis. In: Harrison’s principles of intrenal medicine. New York :Mc Graw-Hill, 2001; 1928-37. 16. Vujasinovic-Stupar N. Reumatoidni artritis. U: Pilipovic N. Reumatologija. Beograd:Medicinska knjiga, 2000; 282-322. 17. Katz PP, Zelin EH. Acitivity loss and the onset of depressive symptoms:do some activities matter more than other ? Arhritis Rheum, 2001;44:1194-202. 18. Pincus T. Patient questionnaires and formal education as mores signioficant prognosis markers then radiographs or laboratory tests for rheumatoid arthritis mortality. Bull NYU Hosp Jt Dis 2007;65(1):S29-S36. 19. Scott DL, Pugner K, Kaarela K. The links between joint damage and disability in rheumatoid arthritis. Rheumatology 2000; 39:122-32.
20. Lisulov R. Afektivni poremecaji. U: Kneževic A. Psihijatrija. Udžbenik za studente medicine i psihologije. Novi Sad: Medicinski fakultet; 1996:63-85. 21. Brankovic S. Ispitivanje funkcijske sposobnosti i kvaliteta života bolesnika sa hronicnim artritisom. Acta Rheum Belgrad.2006; 36(1):29-34. 22. Mustur D, Vesovic-Potic V, Vujasinovic-Stupar N, Ille T. Korisni efekti banjskog lecenja na funkcionalni status i kvalitet života osoba obolelih od reumatoidnog artritisa. Srp Arh Celok lek.2008;136(7-8):391-6. 23. Thompson PW, Pegley FS. A comparison of disability measured by the Stanford Health Assesment Questionnaire disability scales (HAQ) in male and female rheumatoid out-patients. Br J Rheumatol 1991;30:298-300. 24. Tomasevic-Todorovic S. Uticaj bola na emocionalne i kognitivne disfunkcije obolelih od reumatoidnog artritisa. 5 Simpozijum o bolu 2010; 36. 25. Robinson ME, Riley JL, Myers CD. Psychosocial Contributions to Sex-Related Differences in Pain Responses. Sex, Gender, and Pain. Progress in Pain Research and Management. IASP Press. Seattle. 2000;17:41-68. 26. Tomaševic-Todorovic S. Assessment of functional state and depression in patients with rheumatoid arthritis. EPS Yangzhou International Medical Development Forum, China 2011, 68-69. 27. Wolfe F, Hawley DJ, Wilson K. The prevalence and meaning of fatigue in rheumatic disease. J Rheumatol 1996;23:1407-17. 28. Bruce TO. Comorbid depression in rheumatoid arthritis:pathophysiology and clinical implications. Curr Psychiatry Rep 2008:10:258-64. 29. Corbacho MI, Dapueto JJ. Assessing the functional status and quality of life of patients with rheumatoid artritis. Bras J Rheumatol 2010;50(1):31-43. 30. Pehlic E, ar all. Identification of synthesized 2-(4-benzoylphenyl)-2-methyl propionic acid by thin layer chromatography in the system ethyl acetate-cyclohexane and benzene-cyclohexene. HealthMED 2010; 4: 867 – 878 Corresponding author Snezana Tomasevic-Todorovic, Clinic for Medical Rehabilitation, Clinical Center of Vojvodina, Novi Sad, Serbia, E-mail: drtomasevic@gmail.com
Journal of Society for development in new net environment in B&H
2195
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Does the patients with cervical infection and symptoms of imminent preterm delivery has elevated serum levels of interferon gamma (IFN-γ)
Mirjana Bogavac1, Snezana Brkic2, Dejan Celic3, Aleksandra Novakov-Mikic1, Tatjana Ilic3, Zelimir Eric4
1 2 3
4
Faculty of Medicine, Clinical centre of Vojvodina, Department of Obstetrics and Gynecology, Novi Sad, Serbia, Faculty of Medicine, Clinical centre of Vojvodina, Clinic for infectious diseases, Novi Sad, Serbia, Faculty of Medicine, Clinical centre of Vojvodina, Department of nephrology and Clinical Immunology, Novi Sad, Serbia, Department of Physiology, Faculty of Medicine, University of Banjaluka, Bosnia and Herzegovina.
Abstract Preterm delivery (PTD), defined as delivery prior to 37 completed weeks, increases risks of neonatal morbidity and mortality There is a growing body of evidence that intrauterine infection, as well as cervicovaginal bacterial infections and chlamydial infection are possible cause of preterm delivery(13,14). Host response to cervicovaginal and/or intrauterine infections is a release of various inflammatory mediators, many of which are cytokines. Aim of the study: To find out if cervical infection influence the level of serum interferon–γ in patients with clinical symptoms of imminent preterm delivery. Methods: 78 pregnant women (from 24 to 30 weeks of gestation) with clinical simptoms of imminent preterm delivery were divided in: study group - patients with cervical infection and control group - patients without cervical infection. The level of proinflammatory interferon–γ in the serum was measured by ELISA test. Results: There wasn`t statistically significant difference in serum level of interferon–γ between two investigated groups. (p=0.576) Conclusions: The physiologic interferon–γ levels in circulation during pregnancy is irrespective of the presence of cervicovaginal infections. Key words: cytokines, interferon gamma, preterm delivery, bacterial infection, Candida, Chlamydia trachomatis 2196
Introduction Preterm delivery (PTD), defined as delivery prior to 37 completed weeks, increases risks of neonatal morbidity and mortality(1). It is now well accepted that intrauterine infection causes a significant proportion of spontaneous PTD, particularly earlier deliveries. Bacteria ascend from the lower genital tract before or during pregnancy, infect the membranes and initiate an inflammatory response culminating in preterm labor (PTL) or preterm premature rupture of membranes (PROM)(2). Other inflammatory pathways, perhaps involving maternal metabolic syndrome and vascular disease, may impact placentation and/or perturb later stages in the course of pregnancy to result in PTD(3). Cytokines are a diverse group of soluble proteins that mediate inflammation and many other processes(4). These proteins exhibit pleiotropy and functional redundancy, up - and down-regulating one another to result in complex networks(4) involved in establishment and maintenance of pregnancy(5) and complications such as miscarriage(6), preeclampsia(7) and spontaneous PTD(2). A long-standing paradigm classifies cytokines based on their T-cell lineage as Th1 or Th2. The balance between these two types has been considered a measure of the immune milieu: cell-mediated if Th1 cytokines predominate, humoral if Th2 cytokines predominate(8). Normal pregnancy has been characterized as a Th2-dominant state(9), although the timecourse of the expected shift
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
to Th2 dominance in peripheral blood is not clear(8, 10, 11) . Many researchers have conceived of both recurrent spontaneous abortion(12) and preeclampsia(7) as resulting from Th1 dominance. There is a growing body of evidence that intrauterine infection, as well as cervicovaginal bacterial infections and chlamydial infection are possible cause of preterm delivery(13,14). Host response to cervicovaginal and/or intrauterine infections is a release of various inflammatory mediators, many of which are cytokines(15). Proinflammatory cytokines could be a good markers of intrauterine infections, whereas anti-inflammatory cytokines could be very important for normal course of pregnancy(16). There are scarse data available on the role of interferon-gamma, which is a proinflammatory cytokine and inducer of the Th1 immune response. This cytokine is one of the crucial ones for the host response to many infections and might adversely affect the course of pregnancy(17). The aim of the study was to investigate if local cervical infections can influence the serum level of proinflammatory cytokine interferon–γ in pregnant women with clinical symptoms of imminent preterm delivery. Materials and methods The study enrolled 78 pregnant women at a gestational age range from 24 to 30 weeks of gestation (WG), admited at the Department of Gynecology and Obstetrics at the Clinical Center of Vojvodina (Novi Sad), with clinical simptoms of imminent preterm delivery (presence of contractions or increased tonus of the uterus, but without cervical changes or an evident rupture of membranes). Gestational age was based on last menstrual period and was confirmed by an early first trimester ultrasonography. The protocol was approved by the Institutional Ethical Board of Faculty of Medicine, University of Novi Sad and Clinical Centre of Vojvodina (Novi Sad). Each patient was provided with the written informed consent. Investigated pregnant women were divided in two groups according to the following criteria: 1) patients with presence of cervical bacterial infection (CB) or candidial infection (CI) or chlamydial infection (Chl) (n=50, study group) and patients with absence of CB, CI and Chl (n=28, control group).
Some other factors that can cause preterm delivery, such as general factors (mother deseases: cardiovascular diseases, preeclampsia, kidney diseases, urinary infections, diabetes mellitus), than local factors (uterine malformation, cervical insufficiency, uterine and adnexal tumors, Asherman syndrome, cervical conization, other genital infections) and obstetric risk factors (multiple pregnancy, polyhydramnion) were excluded in all patients. Furthermore, the factors which can influence the level of interleukins in the serum, such as autoimmune deseases, hormonal disorders, special complications of hypersensitivity and infectious deseases were also excluded during selection of patients. Microbiological diagnosis was performed by classic Amsel`s criteria and by direct cervicovaginal swab preparation colored by methylene blue and by Gram stain. Cultivation was performed by standard bacteriological techniques (isolation and identification), while Candida was cultivated on Sabouraud agar plates. Presence of chlamydial infection was detected by Chromatographic immunoassay kit (BIOKIT S.A. LLICA d` AMUNT. Barcelona, Spain) and by direct fluorescent microscopy (DIF test). All patients with positive cervicovaginal swab were treated with antibiotics according to antibiogram (mostly from cephalosporine or penicilin groups), after the samples were taken from the patients. Serum samples preparation and immunoassay for IFN-γ: Venous blood was collected from all patients during the first 24 hours after the first simptoms of preterm delivery. Serum was obtained by centrifugation at 4000g for 15 minutes and stored at -20o C before use. Measurements of proinflammatory interferon–γ in the serum were performed by ELISA test (R&D Systems). Absorbance was measured in duplicates with a microplate reader (Beckman Coulter). The final concentration was expressed in pg/ml. Sensitivity of method was 8,0 pg/mL of IFN-γ. Dexametason therapy (6 mg four times per day in duration of 48 h) was administered in all patients for fetal lung maturation. Also the patients received tocolytic therapy (atosiban: amp. 0.9 ml iv. in bolus; after 2 amp. of 5 ml in 90 ml 0.9% NaCl in duration of 3 hours with infusion pump; after 2 amp. of 5 ml in 90 ml 0.9% NaCl in duration of 24 hours with infusion pump) and sedatives 2197
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
from benzodiazepam group (2 times tbl. 5 mg or amp. 10 mg). All the aforimentioned therapy was instituted 30 min after maternal blood collection and there were not any significant difference in that interval between the two groups of patients. Statistical analysis is performed with Statistical Package for Social Sciences (SPSS) for Windows. The results were statistically evaluated with nonparametric Mann-Whitney test, and p-values less than 0.05 were considered statistically significant. Results In Table 1 maternal demographic characteristics (age of the patients, gestational age, information about previous pregnancies as well as previous deliveries) in study (SG) and control group (CG) are given. The isolated microbiological strains from cervicovaginal swabs of patients from study group are shown in Figure 1. The following microbes from study group have been identified: Chlamydia trachomatis in 16, Candida sp. in 10, Escherichia coli in 7, Enterococcus and Staphylococcus sp. both in 5, Klebsiella pneumoniae in 4 and Streptococcus agalactiae in 3 pregnant women.
Limits SG 18 - 42 24-30 1-12 1–6
Figure 1. Isolated microbes from cervix of pateints from study group Serum levels of interferon–γ in patients from study and control groups are summarized in Table 2. IFN- γ was detected in study group in 28% of cases and in 30% of patients from control group. The mean value of interferon–γ level in serum of patients from the study group (pregnant women with cervical infection) was 5.1 ± 17.4 pg/ml. In the control group the mean value of interferon–γ level was 3.2 ± 5.4 pg/ml. The mean value of interferon–γ level in study group was not significantly higher than in the control group (p=0.576). Pregnancy outcome in investigated groups of patients was shown in Table 3. In the study group
Table 1. Demographic and pregnancy associated data of 78 pregnant women enrolled
Characteristics Maternal age Gestational age (w) Gravidity Parity mean ± SD CG 19-37 24-30 1-6 1-3 SG 27.7 ± 5.4 26.8 ± 6.3 2.3 ± 1.8 1.7 ± 1.0 CG 26.3±4.9 27.0±4.5 2.1±1.5 2.2±0.9
Table 2. Levels of interferon-γ in the serum (pg/ml) of investigated pregnant women
Group Study Control N 50 28 Detectability (%) 28 30 min 0.00 0.00 max 116.70 22.75 mean ± SD 5.13± 17.45 3.23± 5.48
N-number of patients enrolled; p=0.576
Table 3. Pregnancy outcomes in investigated groups
Study group Total number Spontaneous preterm delivery Term delivery Death of infants Number 50 18 29 3 % 100.0 36.0 58.0 6.0 Control group Number 28 11 15 2 % 100.0 39.3 53.6 7.1
p=0.927
2198
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
there were 18 preterm and 29 term deliveries, while in control group 11 women delivered preterm and 15 in term. There were also 3 deaths of infants recorded in the study group and 2 in the control group. There was no statistically significant difference in distribution of pregnancy outcomes between two investigated groups of patients (p=0.927). Disscusion Cytokine pathways have been intensively investigated, with most studies examining cytokines in serum, cervical, vaginal or amniotic fluid in women who present with preterm labor or had preterm prelabor ruptures of membranes (PPROM) [3, 5, 9]. Also, IFN–γ was measured in cervical fluid of pregnant women with microscopic findings of vaginal wet mount [10]. However, there are scarce data about the serum level of IFN–γ in pregnant women with cervical infection. IFN–γ is defined as proinflamatory cytokine belonging to Th1 immunological profile. Almoust all Th1 cells can produce IFN–γ, which predominantly activate antigen presenting cells, macrophages, neutrophils and NK cells and stimulate production of other interleukins such as IL-1, IL-6, IL-8, IL-18 ant TNF-α. IFN-γ is produced in normal pregnancies and, along with TNF-α, seem to play essential role in activation of uterine NK cells which are essential for adequate placentation and angiogenesis at the begining of pregnancy. [11]. Towards the end of pregnancy Th2 type cytokines predominate and make the friendly environment for the fetus. In the paper of Piccinni, concentrations of IFNγ produced by decidual T cells of women with unexplained recurrent abortions (URA) and normal pregnancy did not differ. No increased production of IFNγ by decidual T cells was found in URA, as could be expected because of the potential role of Th1-type cytokines on allograft rejection, bearing in mind the paradigm of the fetus as a semiallograft. [12] So the proper conclusion might be stated as that ‘there is a bias against type 1 cytokine expression and function in pregnancy’. Type 2 cytokines may not be essential to pregnancy per se, but they may provide a bias away from type 1 cytokines. Surely Th1 cytokines, depending on their time of
expression, the stage of gestation and their relative concentrations, could have a positive influence on pregnancy. The elevation of pro-inflammatory cytokines in maternal serum or in amniotic fluid during infection and shortly before parturition has also been extensively described [13] Significantly higher levels of the proinflammatory cytokines IL-1, TNFalpha, IL-6, and IL-8 have been found in the amniotic fluid of women with infection-associated preterm labor [13]. Several researchers have suggested that the estimation of cytokine concentrations in cervicovaginal fluid could be of some value in predicting intrauterine infection and preterm birth, especially in the relatively short period immediately prior to delivery [13,14], or even several weeks prior to it [15, 16]. Higher levels of IFN-γ in cervicovaginal fluid, have been demonstrated in the amniotic and chorionic-decidual tissues and in the cervical secretions [13] from women with PTD as compared to those from women with normal term delivery. Excess production of IFN-γ appear to be potentially harmful to pregnancy, since it has been associated with preterm birth (Mor and Abrachams 2003). Nenadic i Pavlovic found that IFN- γ was detectable in all cervical fluid tested and that IFN-γ concentrations gradually increased in patients with pathologic microscopic findings in the vaginal wet mount [10]. In our study the concentration of IFNγ was detectable in only 30% of cases, so it may be assumed that the amount of IFN-γ entering the maternal circulation from lower genital tract in the presence of the infection is very small. However, cytokines act locally and the measurements of T cell cytokine amounts at the feto-maternal interface are of greater significance than measurements in the peripheral blood. The results of our study also suggest that there is no significant difference in serum IFN-γ concentration between pregnant women with symptoms of imminent preterm delivery with cervical infection and without it. We can conclude that the physiologic cytokine network in circulation during pregnancy is irrespective of the presence of cervicovaginal infections. The reported studies on the measurement of cytokines in maternal serum in preterm labour or in the presence of the infection are still rare and 2199
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
have consisted of small number of patients, so further studies are needed with standardized methods and in larger sample sizes. Acknowledgements The work was supported by the grant of Provincial Secretariat for Science and Technological Development of Vojvodina (Grant No. 114-45100592/2005-01. References
1. Goldenberg RL, Hauth JC, Andrews WW. Intrauterine infection and preterm delivery. N Engl J Med 2000;342:1500–7. 2. Holst E, Goffeng AR, Andersch B. BVand vaginal microorganisms in idiopathic premature labour and association with pregnancy outcome. J Clin Microbiol 1994;32:176–86. 3. Romero R, Erez O, Espinoza Y. Intrauterine infection, preterm labour and cytokines. J Soc Gynecol Invest 2005;12:463–5. 4. Bowen JM, Chamley L, Keelan JA, Mitchell MD. Cytokines of the placenta and extra-placental membranes: roles and regulation during human pregnancy and parturition. Placenta 2002;23:257–73. 5. Fortunato S, Menon R, Lombardi SJ. The effect of transforming growth factor and interleukin-10 on interleukin-8 release by human amniochorion may regulate histologic chorioamnionitis. Am J Obstet Gynecol 1998;179:794–8. 6. Saito S. Cytokine network at the feto-maternal interface. J Reprod Immun 2000;47:87–103. 7. Bogavac M. Infekcije kao uzrok prevremenih porođaja. Monography, copyright Medical faculty, Novi Sad, 2003; pp. 15-19. 8. Jerant-Patic V. Imunologija, copyright Buducnost Novi Sad, 2000. 9. Bahar AM, Ghalib HW, Moosa RA, Zaki MSZ, Thomas C and Habri O. Maternal serum interleukin 6, interlukin 8, tumor necrosis factor alpha and interferon gamma in preterm labour. Acta Obstet Gynecol Scand 2003;82:543-549 10. Nenadic DB, Pavlovic MD. Cervical fluid cytokines in pregnant women: Relation to vaginal wet
mount findings and polymorphonuclear leukocyte counts. Eur J Obstet Gynecol Reprod Biol 2008;140:165–170. 11. Croy B.A., Esadeg S., Chantakru S, et al. Update on pathways regulating the activation of uterine NK cells, their interactions with decidual spiral arteries and homing of their precursors to the uterus. J Reprod Immunol 2003;59:175-191 12. M.P. Piccinni. T cells in normal pregnancies and recurrent pregnancy loss. RBM Online 2006; Vol 13, No 6: 840-844 13. R.Raghupathy, J.Kalinka. Cytokine imbalance in pregnancy complications and its modulation. Frontiers in Bioscience 2008;13:985-994 14. M.R.Genc, A.B.Onderdonk, S.Vardhana, et al. Polymorphism in intron 2 of the interleukin 1 receptor antagonist gene, local midtrimester cytokine response to vaginal flora and subsequent preterm birth. Am J Obstet Gynecol 2004;19:1324-1330 15. J.Kalinka, W.Sobala, M.Wasiela, et al. Decreased proinflammatory cytokines in cervicovaginal fluid, as measured in midgestation, are associated with preterm delivery. Am J Reprod Immunol 2005;54:70-76 16. H.N.Simhan, S.N.Caritis, M.A.Krohn, et al. Decreased cervical proinflammatory cytokines permit subsequent upper genital tract infetions during pregnancy. Am J Obstet Gynecol 2003;189:560567 Corresponding author Mirjana Bogavac, Clinical Center Vojvodina, Clinic for Obstetrics and Gynecology, Serbia, E-mail: mbogavac@yahoo.com
2200
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Secondary Lymphedema of the arm in malignant breast tumors and oncological rehabilitation
Svetlana Popovic-Petrovic1,2, Sanja Tomic1,2, Vasa Petrovic3, Dragana Milutinovic2
1 2 3
Oncology Institute of Vojvodina, Sremska Kamenica, Serbia, Faculty of Medicine, Novi Sad, Serbia, Health Center “Dr Milorad Mika Pavlović“ Indjija, Serbia.
Abstract The paper presents literary data on secondary lymphedema of the arm, as the most often posttherapeutic functional complication of the breast carcinoma: definition, epidemiological data, risk factors, clinical forms and therapy. The paper presents prevention principles and therapies of the secondary arm lymphedema in patients with breast carcinoma operated at the Oncology Institute of Vojvodina. The priority of the Rehabilitation Department is preventive oncological rehabilitation in patients with operated breast carcinoma, which is implemented from the second postoperative day and implies kinesitherapy program of an “early” rehabilitation, patients’ education on risk factors as well as their elimination and it is continued through the patients’ follow-up. If a secondary lymphedema of the arm is developed, depending on the malignant disease course and the clinical characteristics of the lymphedema, the principles of restorative, supportive or palliative oncological rehabilitation are implemented. Key words: secondary arm lymphedema, breast cancer, oncological rehabilitation, Oncology Institute of Vojvodina Introduction Although a malignant breast tumor has been known for hundreds of years, a secondary lymphedema of the arm (SLEA) was first described in 1921 (Halsted). SLEA is the result of a functional overload of a lymphatic system, when the volume of lymph
exceeds the existing transportation capacities. It is also defined as an abnormal accumulation of the interstitial fluid rich in proteins, conditioned by the mechanical insufficiency of the lymphatic system, most often as a consequence of operation, irradiation therapy, infection, etc. (1-6). SLEA may develop during the therapy of a malignant breast carcinoma, which occurs very rarely, but also some tens of years later, and the most usual time of occurrence is one to two years after the therapy (7). Depending on the clinical characteristics and the expression of fibrous changes, SLEA stages are defined as follows: - „0“ stage – latent or subclinical: transportation capacities of the lymphatic system are preserved and there is no visible arm edema; - I stage – spontaneously reversible: there is an accumulation of the interstitial fluid rich in proteins; edema is soft and there are no fibrous changes; edema reduction after the elevation of the arm; - II stage – spontaneously irreversible: edema of a more solid consistence, moderately (to severely) expressed fibrous changes; there is no edema reduction after the elevation of the arm; - III stage – lymphostatic elephantiasis: expressed fibrosclerotic changes; skin is described as the “orange peel“; often present lymphorrhea (8). Depending on the size of the edematous arm, SLEA is classified as: - Mild SLEA: difference in volume of 2-2.9 cm at, at least, one of the measured symmetrical levels; - Moderate SLEA: difference of 3-4.9 cm at, at least, one of the measured symmetrical levels; 2201
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
- Severe SLEA: difference of 5 and more cm at, at least, one of the measured symmetrical levels. Insufficiently known Incidence Data on SLEA incidence are insufficient due to prolonged period of development, ununified criteria and techniques for SLEA diagnosis, insufficient organization of rehabilitation centers, unreporting of the SLEA by the health care professionals and ignoring by the patients themselves (6,9). In the study, which encompasses the data from multiple continents, SLEA incidence of 6.7% to 63% was recorded. The largest number of studies gives the incidence range from 20% to 30% (6,7,10). Pathophysiological mechanism The function of lymphatic system is to return fluids, proteins and lipids from the interstitium into intravascular space. Starling forces: hydrostatic pressure in an artery and venous capillary, oncotic pressure of plasma, oncotic pressure of the interstitial fluid and hydrostatic pressure of the interstitium („-3“ mmHg) regulate transportation of fluids and proteins at the level of the artery capillary – interstitium – lymphatic vessel – venous capillary. About 90% of the filtrated fluid from the artery capillary is reabsorbed in venous capillaries, and 10% of the rest of the interstitial fluid rich in proteins, thanks to the “negative” hydrostatic pressure in the interstitium and the permeability of the lymphatic vessel wall for protein molecules, enters lymphatic capillaries and larger lymphatic vessels with valves, ensuring a one-way direction of the lymph flow. In SLEA, transportation capacity of lymph is reduced, i.e. normal quantity of fluid exceeds the level of the lymphatic system transportation capacity due to reduction of the lymphatic network. Stagnation of fluid rich in proteins leads to additional increase of the fluid and protein quantity in 2202
the interstitium with development of the edema. Accumulation of the interstitial fluid causes dilatation of the lymphatic vessels and valvular incompetence, conditioning a reverse lymph flow from the sub-skin tissue into the skin. Lymphatic vessels undergo fibrosis and the formed thrombi obliterate lymphatic vessels, which enhances the existing reduction of the lymphatic network of the arm. In the interstitium, an aggregated fluid and proteins initiate inflammatory reaction, and the increased macrophagous activity leads to destruction of the elastic fibers and production of fibrosclerotic tissue, with a change from the softer to the more solid edema (11). Risk factors Risk factors for occurrence of SLEA are: extensiveness of the surgical intervention, total received irradiation dosage and the type of field (axilla, supraclavicular part), postoperative conditions (longer drainage, infection, larger number of serum punctures), non-existence of early rehabilitation program, non-existence or inadequate patients’ education, infection of ipsilateral arm, traumas, etc (7,9,12). Although many risk factors of SLEA are known, there are still many pending questions: why SLEA occurs in various time periods, why it also occurs in women without axilla dissection, why some segments of the ipsilateral arm are included, and not the entire arm, if there are any genetic predispositions for development of SLEA, etc. Prevention and therapy Risk reduction for developing SLEA is in preoperative and postoperative preparation of patients, education on risk factors and their elimination, implementation of continuous kinesitherapy program and training for self-control – the principles of preventive oncological rehabilitation (5,12-15). Therapy of SLEA is not etiological, but it is directed to reduction of volume of the extremity, returning to the state equal to the one before the breast surgery (restorative oncological rehabilitation), or maximally possible functional impro-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
vement (supportive oncological rehabilitation). If SLEA occurs in the terminal stage of the disease, the aim of the oncological rehabilitation is the reduction of subjective difficulties, i.e. achievement of as good quality of life as possible (palliative oncological rehabilitation). Non-pharmacological therapy of SLEA – a complex of decongestive physical therapy (CDPT) (skin care of the ipsilateral arm, education, kinesitherapy program, manual lymph drainage massage and placement of elastic bandages or sleeves) proved itself the most efficient therapeutical method. It is performed in two phases: the first phase is a therapeutical phase with the aim of edema reduction by mobilization of the aggregated interstitial fluid and reduction of fibrous changes, while the second phase is the phase of maintenance of achieved therapeutical effects. As an additional part of CDPT, a sequential external pneumatic compression (SEPC) is recommended. Implementation of a low power laser in the treatment of SLEA is presented in the studies with
Clinical image Preventive oncological rehabilitation Restorative oncological rehabilitation Reversible SLEA Mild or moderate SLEA Rarely MT progression Contracture Rarely plexopathy Irreversible SLEA Rarely elephantiasis Moderate (severe) SLEA Subjective difficulties Contracture Plexopathy – more often Terminal stage of MT Progression of MT Severe SLEA – more often Subjective difficulties Contracture Plexopathy – often Reduced ADL
smaller number of patients and it did not have the anticipated results in the longer period of time. Medicamentous therapy with coumarin preparations, flavonoids and diuretics, is not recommended in reduction of SLEA, even though it proved to have positive effects, due to numerous side effects (toxic effects, increased fibrosis). The aim of a surgical approach is the restitution of the lymphatic flow (physiological approach), or reduction of the “extra tissue“ and interstitial fluid (reduction approach), but it is rarely applied in the treatment of SLEA (16-19). Secondary lymphedema of the arm and oncological rehabilitation at the Oncology Institute of Vojvodina With the aim of quality of life improvement of the patients with malignant tumors at the Oncology Institute of Vojvodina, in 1996, a Rehabilitation Department was established.
Activities Early rehabilitation Late rehabilitation Education Controls CDPT SEPC Education TENS Cryotherapy CDPT SEPC Education TENS Cryotherapy Orthotic facilities Elevation Positioning Mild massage KTH TENS Cryotherapy Help in ADL Orthotic facilities Effect Without SLEA
Without SLEA ↓ SLEA ↓ subj. difficulties ↑ functional status
Supportive oncological rehabilitation
Palliative oncological rehabilitation
↓subjective difficulties ↑ ADL
Figure 1. Algorithm of oncological rehabilitation in malignant breast tumors at the Oncology Institute of Vojvodina
Abbreviations: SLEA – secondary lymphedema of the arm; MT – malignant tumor; CDPT – complex decongestive physical therapy; SEPC – sequential external pneumatic compression; TENS – transcutaneous electro-nerve stimulation; ADL – activities daily living; KTH- kinesitherapy
Journal of Society for development in new net environment in B&H
2203
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Activities of the Department are mostly directed towards the preventive oncological rehabilitation in malignant breast tumors, and are performed from the second postoperative day, through kinesitherapy program of the “early“ rehabilitation, quantitative evaluation of the risk for SLEA development, patient’s education on the risk factors and their elimination, as well as the training on compensatory techniques (e.g. activation of the “muscle“ pump). (Figure 1.) The training on preventive activities is continued after the first control (one month later) through the program of a “late“ rehabilitation, as well as during the continuous follow-up of the patient. If SLEA develops in the phase of reversible changes, the following is implemented: a complex decongestive physical therapy (CDPT) and sequential external pneumatic compression (SEPC), patients’ education, and if necessary, physical procedures (TENS, cryotherapy, heating). The effect of the applied therapy is restitution of the functional state into the state, equal to the one prior to malignant disease diagnosis – the principles of the restorative oncological rehabilitation (Figure). Irreversible SLEA, which is the consequence of the permanent damage, is often conjoined with the mobility damage in humeroscapular joint and the damage of the brachial plexus. CDPT and SEPC are implemented, with possible application of the physical procedures and orthotic facilities. The end effect of implementation of the supportive oncological rehabilitation principles is the improvement of the functionality status (Figure). In the terminal phase of the disease, the principles of the palliative oncological rehabilitation are implemented, i.e. the reduction of subjective difficulties (pain, nausea, weakness) and provision of the conditions for as great independency as possible within the daily activities, by elevation of the arm and by placement of mitela, mild massage, implementation of TENS, cryomassage, help at transfers (Figure) (20-26). Conclusion The establishment of the oncological rehabilitation program in patients with malignant breast tumors at the Oncology Institute of Vojvodina, first of 2204
all, the principles of the preventive oncological rehabilitation and the continuous follow-up of the patients, resulted in reduction of clinically manifested SLEA, which was diagnosed in 8.3% to 11.04% of patients, operated at the Oncology Institute of Vojvodina in the period from 2001 – 2006. Stated results are the recommendation for implementation of the oncological rehabilitation in all medical institution, which deal with oncological problems. References
1. Bomar L, Humphrey K. Lymphedema. Rehab Oncol 1999;17(2):25-8. 2. Szuba A, Rockson GS. Lymphedema: classification, diagnosis and therapy. Vasc Med 1998;3:145-56. 3. Struble CD. Secondary lymphedema and breast cancer. Rehab Oncol 2001;19(1):6-15. 4. Cohen RS, Payne KD, Tunkel SR. LymphedemaStrategies for management. Cancer 2001;92(4 suppl):980-7. 5. Tunkel SR, Lachmann E, Boland JP, Ho LM. Physical rehabilitation. In: DeVita V editor. Cancer: Principles and Practices of Oncology. Baltimore, Lippincott, Williams@ Willkins, 2000. p. 2191-224. 6. Petrek AJ, Heelan CM. Incidence of breast carcinoma-related lymphedema. Cancer 1998;83:277681. 7. Hayes CS, Janda M, Cornish B, Battisttuta D, Newman B. Lymphedema after breast cancer: incidence, risk factors, and effect on upper body function. J Clin Oncol 2008;26(21):3536-42. 8. Lawenda DB, Mondry ET, Johnstone ASP. Lymphedema: a primer on the identification and management of a chronic condition in oncologic treatment. CA Cancer J Clin 2009;59:8-24. 9. Park JH, Lee WH, Chung HS. Incidence and risk factors of breast cancer lymphedema. J Clin Nurs 2008;17(11):1450-9. 10. Norman AS, Localio AR, Potashnik LSh, Torpey HS, Kallan JM, Weber LA et all. Lymphedema in breast cancer survivors: Incidence, Degree, Time course, Treatment and Symptoms. J Clin Oncol 2009;27(3):390-7.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
11. Revis RD. Lymphedema. http//emedicine.medscape.com/article 191350 12. Popović-Petrović S. Faktori rizika za razvoj sekundarnog limfedema ruke kod malignih tumora dojke. (Dissertation). Novi Sad, Medical faculty, 2008 (in Serbian) 13. Lacomba TM, Sanchez MJY, Gofii AZ, Merino PD, delMoral MO, Tellez CE, et all. Effectiveness of early physiotherapy to prevent lymphedema after surgery for breast cancer: randomized single blinded clinical trial. BMJ 2010;340:b5396. 14. Campisi C, Zilli A, Maccio A, Shenone F, DaRin E, Erreta C, et all. Prevention of lymphedema secondary to the treatment of breast cancer: a case report and proposed for a prevention protocol. Chir Ital 2004;56(3):419-24. 15. Saskia RJ, Thiadens RN. 18 Steps to Prevention Revised: Lymphedema risk-reduction Practices. Dostupno na URL: 16. http//www.lymphnet.org/ lymphedema FAQs/riskReduction/riskReduction.htm 17. Casley-Smith RJ, Boris M, Weindorf S, Lasinski B. Treatment for lymphedema of the arm- the CasleySmith method. A noninvasive method produced continued reduction. Cancer 1998;83:2843-60. 18. Bicego D, Brown K, Ruddick M, Storey D, Wong C, Harris SR. Exercise for woman with or at the risk for breast cancer related lymphedema. Phys Ther 2006;86(10):1398-405. 19. Box RC, Reul-Hirche HM, Bullock-Saxton JE, Furnival CM. Physiotherapy and breast cancer surgery: results of a randomized controlled study to minimize lymphedema. Breast Cancer Res Treat 2002;75(1):51-64. 20. Kaviani A, Fateh M, Nooraie YR, Alinagi-zadeh M, Fashtami AL. Low-laser therapy in management of postmastectomy lymphedema. Laser Med Sci 2006;21(2):90-4. 21. Popović-Petrović S. Onkološka rehabilitacija. In: Jovanović D. editor. Osnovi onkologije i palijativna nega onkoloških bolesnika (in Serbian). Novi Sad, Medical faculty 2008. p. 376-82. 22. Popovic-Petrovic S, Tomic S, Popovic M. Rehabilitation in oncology. HealthMED 2010;4(4):8158.
23. Popović-Petrović S, Nedeljković M, Petrović T, Vasović M. Physical treatment of secondary lymphedema of the arm in breast cancer patients. Arch Oncol 2002;10(4):261-2 24. Popović-Petrović S, Nedeljković M, Kordić V, Hemun S, Tomić S, Babić M. Onkološka rehabilitacija kod malignih tumora dojke u Institutu za onkologiju Vojvodine. Zbornik radova VI Kongresa fizijatara Srbije i Crne Gore sa medjunarodnim učešćem, 2006 nov 1-4; Vrnjačka banja, Srbija, 2006. 25. Hemun S, Popović-Petrović S, Tomić S. Rana rehabilitacija kod operisanih od malignih tumora dojke. 42. Kancerološka nedelja Beograd; 2005 26. Nedeljković M, Popović-Petrović S, Kordić V, Hemun S, Tomić S, Babić S. Sekundarni limfedem ruke i maligne neoplazme dojke – naša iskustva. Zbornik radova VI Kongresa fizijatara Srbije i Crne Gore sa medjunarodnim učešćem, 2006 nov 1-4; Vrnjačka banja , Srbija, 2006. 27. Popović-Petrović S, Vasović M, Nedeljković M. Prevention and treatment of secondary lymphedema of arm in breast cancer. Arch Oncol 2002;10(2):77-8. Corresponding author Svetlana Popovic-Petrovic Oncology Institute of Vojvodina, Rehabilitation Department, Sremska Kamenica, Serbia, E-mail: petrovic.svetlana@onk.ns.ac.rs
Journal of Society for development in new net environment in B&H
2205
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Managers’ orientation of health care organization – comparison study of Serbia, Macedonia and Slovenia
Vesna Damnjanovic, Vinka Filipovic, Slavica Cicvaric Kostic, Branka Novcic, Radmila Janicic Faculty of Organizational Sciences, University of Belgrade, Serbia.
Abstract Objective: In order to better understand manager attitude in health care organization in Slovenia, Macedonia and Serbia we analyzed and compare their goal statement which are oriented internal (on employees) or on external perspective (patient attitude). We also summarized the differences between countries in achieving patient satisfaction and necessary skills from manager’s view. Methodology: The questionnaires were conducted with 310 managers in health care organizations in Serbia, Slovenia and Macedonia. We used previous similar studies to define questionnaire form. Results: The findings suggest that the health care managers should educated to adopt various management practices of better adopting to the environment changes and improve their managerial skills which are important for better managing the health care organization. The management goals behind adopting these best practices were related not only to patients but also to employees. The research study describes better understanding of similarity and differences of achieving patient satisfaction between three different countries in region: Serbia, Slovenia and Macedonia and explain what kind of health care management practices may improve in the future from the managerial perspective. Conclusions: Our research study presents that the health care manager in Serbia and Macedonia are oriented on carry out the activities of all employees and fulfillment of the norms regarding the number of patients. Managers from Serbia also focus their goal on the competence of employees in the health care practice. Managers from health care organizations from Slovenia are more external oriented. They focus more on achieving patient 2206
satisfaction and correct attitude towards patients. Also, we have investigated the most important skill for better managing the health care organization for Serbia, Macedonia and Slovenia is decision making skill. Another similarity between Serbia and Macedonia health care system was describe through statistical analysis with Anova and Tukey multiple comparison analysis of achieving patient satisfaction and statistical deference exist for Slovenia and Serbia and Slovenia and Macedonia managerial opinions. Key words: Managers’ orientation, manager skills, healthcare organizations, Serbia, Slovenia, Macedonia Introduction Health care organizations meet new environmental changes and various challenges. Perception of environmental changes influences strategic response (efficiency-oriented or market-focused) of health care organization [9]. Categories such as customer focus and service quality are highly recognized as determinants of success in health care sector [1] and perceived quality of service, among others, depends on managers’ orientation [5]. As Wise reports [23], “relationship management can be applied in a variety of fields, but there is perhaps no other field that could benefit more from the application of relationship management than public health”. Market and customer orientation is proved as important organizational factor in implementing a competitive service strategy for high-contact healthcare encounters[21] , especially when environment is perceived as instable and uncertain [15].
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Academic researchers find that managers’ orientation, seen for instance through leadership [4], and satisfied and confident employees [6] is important for better service in health care, where the “good service is the result of systematic approach to delivery and an environment or culture conducive to high standards”. [14] Market orientation is one of the factors influencing business performance in competitive healthcare environment [22, 16, 12, 13, 3]. Furthermore, user centered service delivery and quality improvement could ensure health care improvements [18]. Author [20] also report that, among others, market orientation and customer focus significantly affect service quality. Due to many and various issues that transition brought, the role of managers in health care became extremely important, as it is in any organizational change [7]. This is the reason why this study focused on the general orientation of managers in researched countries, which was measured by identifying the main goals of their institutions. This study examined cross countries orientation of health care managers, by hypothesizing that various stages of transition and reforms in three countries affect managers’ orientation. There appears to have been no research that has directly addressed the cross countries comparison analysis of health care institution managers’ orientation of the health care organization. The comparative analysis included three countries, one developed - Republic of Slovenia, and two developing countries - Republic of Serbia, and former Yugoslav Republic of Macedonia (FYRM), which constituted the same state, Socialist Federal Republic of Yugoslavia, before the transition process. Even they had, more or less, similar starting points, they managed transition process and changes in various manners and had different effects, according to various political, economic and social circumstances. The transition included restructuring the health care systems in all three countries. As restructured health care system meet patients’ needs, improve service quality and patient satisfaction [2], this research embodied health care markets in three countries and found the similarities and differences in reaching mentioned effects. This study takes a step towards better understanding the factors responsible for the patients’ satisfaction and manager skills, from the managers’ point of view in all three countries.
Methodology The purpose of this research was to define how managers of health care institutions are oriented to business environments where they operate and to compare their managerial skills in Serbia, Slovenia and Macedonia. We have investigated employees from the different private and state-owned health care institutions (health centers, clinics, hospitals) in Serbia, Slovenia and Macedonia in March 2009. The research was carried out using a questionnaire form which had 18 questions. Questions are divided into three categories: general issues respondents: age, gender, years of experience, education, issues that reflect the activities of respondents within the health organizations: managerial and mediac expertise and specific questions that analyze the improvement of patient satisfaction and most importantly the patients criteria consider when choosing health care organizations. In a survey of the health care managers and doctors who passed education to work in managerial positions. The questionnaire form was tested by two health care organizations and 19 respondents in Belgrade in February 2009 which was based on the suggestions of the pilot group modified. A total of 310 employees in health care organizations: 90 in Serbia, 139 in Slovenia and 81 in Macedonia. The main limitation of this research study is analyzing the health care organizations in most urban areas in Serbia (Belgrade adn its surroundings) and Slovenia (Ljubljana) while in Macedonia market resereach carried out in a small city (Bitola). For the formulation of questionnaires were used previous studies.[8, 10, 21]. In data analysis, the SPSS 17.0 statistical computer analysis package was used to analyze research findings. Results and discussion I Questionnaire, data analysis and statistical tools We used structured questionnaire form; see Table 1 for this investigation. Table 1. The questionnaire form 1. Remark your country Serbia Slovenia Macedonia 2207
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
2. What is your position in health care organization? Manager Doctor 3. Gender Male Female 4. Age 18-25 26-35 36-45 46-55 Over 55 5. Activities of your job in health care organization Mainly treat patient Mainly managerial task Treatment and managerial tasks 6. Work experience Until 3 4-10 11-20 Over 20 7. Health care organization: Public Private 8. Fill out the statements that best describe goals of health care organization: Correct attitude towards patients Fulfillment of the norms regarding the number of patients Become the most competent institution in its field. Achieving patient satisfaction. Conscientiously carry out the activities of all employees. Good interpersonal relations and mutual respect of employees. Conscientiously carry out the activities of all employees. Profit and increase salaries. 9. How do you assess the current number of patients your health organization? Insufficient number (with the capacity to be able to servicing an increasing number of patients) Optimal number Larger number than we are able to accommodate 10. Does your health care organization has a defined mission and strategic goals? 2208
11.
12.
13.
14.
15.
16.
Yes No I don’t know Does your health care organization use an electronic database of patients? Yes No I don’t know If the patient satisfaction survey carried out, how does it work? surveys by interviwing staff boxes for comments from the consulting agency that has been specially hired for this purpose for otherwise, how:______________ According to the satisfaction survey patients are: very satisfied satisfied satisfied as average dissatisfied very dissatisfied How would you rate your knowledge of patient satisfaction in health care organization? Excellent Very good Good Not good Poor What you think is the most important reason for introducing the program to improve patient satisfaction? The possibility of losing patients to competitors' health care facilities The possibility of loss of profit The possibility of loss of reputation, health organizations in the region Other:__________________________ What factors most influenced your opinion on presenting the improvement of patient satisfaction program: Additional education in the field of patient satisfaction in health care The willingness of all employees to support the introduction of patient satisfaction program Support by consultants or agencies for the introduction of patient satisfaction program
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
More funding for the introduction of patient satisfaction program Establishment of a system of rewarding employees in relation to the results of patient satisfaction 17. What do you think two key skills for manager of health care organizations Motivation of employees Leadership skills Team building skills Internal and external communication skills (informing, listening, sharing information and follow up) Decision making skills (conflict resolving, coordination, strategic planning, change management, managing IT system and operation) Building partnership with environment 18. What is the most important criteria to consider when selecting when a patient choose the health care organization? 1 - Important 2 Mostly important 3 - Not important Service price 1 2 3 Waiting period 1 2 3 Relationship between nurse – patient 1 2 3 The doctor-patient relationship 1 2 3 Competence of doctors 1 2 3 Pleasant ambience of the institution 1 2 3 Courtesy medical staff 1 2 3 Trust in health care organization 1 2 3 Promotional activities through the media 1 2 3 Good technical equipment of organizations 1 2 3 Recommendation from a friend or someone else 1 2 3 After expiration of surveying period and acquisition of the satisfactory number of completed surveys, results were coded and inserted in the SPSS
17.0 software, which was used for statistical analysis of collected data. Following good practice of [19, 17], prior to data analysis, error screening and data cleaning was undertaken. After insuring that there are no missing values or values of the variables that fall outside defined ranges, it was proceeded to the data analysis. Following statistical tools were used: descriptive statistics tools (means, frequencies etc.) were used to capture average values on the examined issues. These tools were very helpful to extrapolate demographic profile of participants and their general impressions on different issues we explored. Furthermore, crosstabs were used to explore and compare same issue in different country. We also use Anova test and Turkey test for multi comparison analysis. II Demographic profile of research participants In total we had 310 examinees, whilst 90 examinees were health care managers from Serbia, 81 from Macedonia, and 139 examinees were from Slovenia. The examinee was in average 30.36 years old (std. dev. 9.969, median 27, mode 25, range 15 to 81 years). 45.5% of participants were male, whilst 54.6% female. III Statements that can best describe the goals of your institution? Respondents had request to fill out two statements that the most desribe the goal of their health care organization. In the table 2 we described analysis for Serbia, Macedonia and Slovenia. According to table 1 we have summarized that the managers who work in health care organization in Serbia more focus on conscientiously carry out the activities of all employees (63,2%) and become the most competent institution in its field (40%). The results from manager perspective from Macedonia identified the goal in health care organization which are oriented on conscientiously carry out the activities of all employees (54,4%) which is similar in Serbia and fulfillment of the norms regarding the number of patients (25%). 2209
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 2. The statement that best describe goals of health care organization from the managers perspective
Goal statements Correct attitude towards patients. Fulfillment of the norms regarding the number of patients. Become the most competent institution in its field. Achieving patient satisfaction. Conscientiously carry out the activities of all employees. Good interpersonal relations and mutual respect of employees. Profit and increase salaries. Serbia (N=90) Yes 22.0% 25.0% 40.0% 22.0% 63.2% 11.5% 9.2% No 37.1% 30.6% 26.9% 35.1% 36.8% 88.5% 88.7% Macedonia (N=81) Yes 19.9% 25.0% 23.1% 21.2% 54.4% 22.1 % 5.9% No 26.5% 23.0% 23.3% 24.7% 45.6% 77.9% 94.1% Slovenia (N=179) Yes 58.2% 50.0% 36.9% 56.8% 37.2 19.7% 0.7% No 36.4% 46.4% 49.8% 40.2% 62.8% 88.2% 99.3%
Managers in Slovenia are more focused on external perspective - patient orientation. The findings showed that from manager view goal from health care organization in Slovenia basis on correct attitude towards patients (58,2%), achieving patient satisfaction (56,8%) and fulfillment of the norms regarding the number of patients (50%). IV The important skills for health care managers Another issue related to the most important skills which managers from health care organizations should have that will be successful in top management position. We have investigated different management skills: motivation of employees, leadership skills, team building skills, internal and
external communication skills, decision making skills and possibility to building partnership with environment. We did comparison between Serbia, Macedonia and Slovenia in the table 3. Findings from all three countries described similarities that decision making skills (conflict resolving, coordination, strategic planning, change management, managing IT system and operation) are the most important for managers (70.15% in Macedonia, 59,1% in Serbia and 51,11% in Slovenia). The second important skill for health care managers was motivation of employees (62,21% in Macedonia, 45,93% in Slovenia and 39,77% in Serbia). Leadership health manager skills are more important in Slovenia (38,52%) that in Serbia (23,86%) and Macedonia (14,93%) and the internal and external communication are similar in Slovenia (23,70%) and Serbia (22,73%).
Table 3. The skills of successful manager of health care organization from the managers’ perspective
Health care managers skills Motivation of employees Leadership skills Team building skills Internal and external communication skills (informing, listening, sharing information and follow up) Decision making skills (conflict resolving, coordination, strategic planning, change management, managing IT system and operation) Building partnership with environment Serbia (N=90) Yes 39,77% 23.86% 25% 22.73% No 61.21% 77.14% 75% 77.27% Macedonia (N=81) Yes 62,21 14.93% 22.39% 13.43% No 38.79% 85.07% 77.61% 86.57% Slovenia (N=179) Yes 45.93% 38.52% 24,44% 23.70% No 44.07% 61.48% 75.56% 76.3%
59.1% 11.36%
30.9% 88.64%
70.15 5.9%
29.85% 94.1%
51.11 7.4%
48.89% 92.6%
2210
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
V Achieving patient satisfaction – comparison study through countries For the analysis of the managers participating in the questionnaire from three different countries and the goal of achieving patient satisfaction, we used the Anova test. The null hypothesis in this case is that there is no difference between the achieving patient satisfactions and those relating to managers in health care organization from Serbia, Macedonia and Slovenia. In ANOVA test we identified the results with different statistical dependence (p = .014), but these difference is small between the countries (1.7011,1.6324,1.5109), see Table 4. Because of the fact that the level of significance is lower that 0.05 for criteria achieving patient satisfaction in health care organization, we are declining the null hypothesis. ANOVE is limited because it does not show between which groups significant differences exist. That is why it is necessary to do the PostHoc test, thanks to which we will clearly see between which groups the significant difference exists. We used the Turkey multiple comparison.
We have used multiple comparison analysis for identified the influence of achieving patient in health care organization. Respondents were split into three groups: health care managers from Serbia, Slovenia and Macedonia. Test showed that that a certain difference does exist between countries: F(4,324)=4.6, p=.014. If we analyze Post hoc using table 5. Turkey test it is easy to conclude that a certain difference does exist between Serbia (M=1.7001, SD =0.46) and Slovenia (M=1.5109, SD=0.428), but the difference does not exist between group 2 Macedonia (M=22.10, SD=4.15) and Serbia p= 0,657 which is more than 0,5. We also identified that there is a difference between Group 2 (Macedonia) and Group 3 (Slovenia), p = 0213 is less than 0,5. Conclusion Through cross countries research, this study aims to explore how different stages and effects of transition process and reforms affect managers’ orientation and perception of factors responsible for the patients’ satisfaction and managerial skills in the health care organization.
Table 4. Descriptive statistics - Achieving patient satisfaction
N Mean Std. Deviation Std. Error 95% Confidence Interval for Mean Lower Bound Upper Bound Minimum Maximum
Serbia 87 1.7011 Macedonia 68 1.6324 Slovenia 137 1.5109 Total 292 1.5959
.46041 .48575 .50171 .49156
.04936 .05891 .04286 .02877
1.6030 1.5148 1.4262 1.5393 df 2 289 291
1.7993 1.7499 1.5957 1.6525 Mean Square 1.021 .236
1.00 1.00 1.00 1.00 F 4.324
2.00 2.00 2.00 2.00 Sig. .014
Table 5. ANOVA - Achieving patient satisfaction
Between Groups Within Groups Total Sum of Squares 2.043 68.272 70.315
Table 6. Tukey multiple comparison analysis
(I) country (J) country Mean Difference (I-J) Std. Error MAC .06880 .07867 SRB SLO .19020* .06663 SRB -.06880 .07867 MAC SLO .12140 .07210 SRB -.19020* .06663 SLO MAC -.12140 .07210 Sig. .657 .013 .657 .213 .013 .213
* The mean difference is significant at the 0.05 level.
95% Confidence Interval Lower Bound Upper Bound -.1165 .2541 .0332 .3472 -.2541 .1165 -.0485 .2913 -.3472 -.0332 -.2913 .0485
Journal of Society for development in new net environment in B&H
2211
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
First, our findings indicate that there were managerial goals related to external orientation (patient satisfaction and attitude) in Slovenia more than in Macedonia and Serbia which results more related to other stakeholders – employees as an internal perspective. These results seem to be logical because of faster development of Slovenia health care system reform and better implementation of marketing orientation. The second conclusion summarized the similarity of decision making skills (conflict resolving, coordination, strategic planning, change management, managing IT system and operation) as the most important for managers for successful managing the health care organizations in three examining countries: Serbia, Slovenia and Macedonia. Other important result underline the less important skill for managers is building partnership with the environment. The third conclusion examined the differences of achieving patient satisfaction from managerial view with Anova test in Serbia, Macedonia and Slovenia. Health care managerial attitude in achieving patient satisfaction using Tukey comparison analysis from Serbia and Macedonia are more similar than in the Slovenia and significant differences (p=0,657) does not exist. Further research will focus on investigation of patient attitudes of managerial orientation in these countries and better use of existing resources (“staff attitudes”) in health care organizations. This study should help managers to exchange of experiences among countries and empower managers to improve knowledge and skills which will help them in the future for successful managing of health care organizations.
References
1. Avali J, Yasin MM. The role of quality improvement initiatives in healthcare operational environments. Int J Health Care Qual Assur, 2008 21 (2): 135145. 2. Blumenthal S. Effects of market reforms on doctors and their patients. Health Aff 1996, 15(2):170-184. 3. Boonekamp LCM. Marketing for Health-care Organization: An Introduction to Network Management. J Manag Med 1994, 8(5): 11-24. 4. Brazier DK. Influence of contextual factors on health-care leadership. Leader Organ Dev J 2005, 26(2): 128-140. 5. Burke JR. Managerial feedback, organizational values and service quality. Manag Serv Qual1999, 9(1): 53-57. 6. Chilgren AA. Managers and the New Definition of Quality. J Healthc Manag 2008, 53(4): 221-230. 7. Engstrom AK, Axelsson R. The double spiral of change—experiences of privatization in a Swedish hospital. Int J Health Plann Mgmt 2010, 25(2): 156–168. 8. Fattore,G., Economic Evaluation in Health Care: The Point of View of informed Physicians, International Society of Pharmacoeconomics and Outcome Research, Value in Health, 2006, 9(3):155-157. 9. Filipovic V, Cicvaric S, Stavljanin V, Damnjanovic V, Radojicic Z, Zarkic Joksimovic N, Gogic A. Influence of healthcare institution managers’ proactive approach to communication activities on patient satisfaction. Vojnosanit Pregl, 2010, 67 (4): 267-271. 10. Guo KL. An Assessment Tool For Developing Healthcare Managerial Skills and Roles. J Healthc Manag 2003; 48 (6):367-376. 11. Guo, L.K. (2003), An Assessment Tool for Developing Health Care Managerial Skills and Roles, J Healthc Manag,2003, 48(6): 367-376. 12. Hatton MJ, Mathews BP. Relationship marketing in the NHS: will it bring the buyers and suppliers together again. Market Intell Plann 1996, 14(2):41-47. 13. Hult GTM, Lukas BA. Classifying health care offerings to gain strategic marketing insights. J Serv Mark 1995, 9(2): 36-48
2212
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
14. Jensen JB, Markland RE. Improving the application of quality conformance tools in service firms. J Serv Mark 1996, 10(1): 35-55. 15. Kumar K, Subramanian R, Strandholm K. Market and efficiency-based strategic responses to environmental changes in the health care industry. Health Care Manage Rev 2002, 27 (3): 21-31 16. Lonial SC, Tarim M, Tatoglu E, Zaim S, Zaim H. The impact of market orientation on NSD and financial performance of hospital industry. Ind Manag Data Syst 2008, 108 (6): 794-811. 17. Malhotra, N. K. (2007). Marketing Research (5th edition). New Jersey: Prentice Hall 18. Mugglestone M, Maher L, Manson N, Baxter H. Accelerating the improvenment process. Clin Govern Int J 2008, 13(1): 19-25. 19. Palant, J. (2005). SPSS Survival manual: A step by step guide to data analysis using SPSS for Windows V.12 (2nd edition). Berkshire: Open University. 20. Samat N, Ramayah T, Saad NM. TQM practices, service quality, and market orientation – Some empirical evidence from a developing countries. Manag Res News 2006, 29(11): 713-728. 21. Scotti, D, Driscoll,A, Harmon,J and Behson, S., Links among High Performance Work Environment, Service Quality and Customer Satisfaction: An Extension to the Health Care Sector, J Healthc Manag, 2007, 52(2): 109-124. 22. Willcocks S. Clinical leadership in UK health care: exploring a marketing perspective. Leader Health Serv 2008, 21(3):158-167 23. Wise K. Why public health needs relationship management. J Health Hum Serv Admin, 2008; 31 (3): 309-331. Corresponding author Vesna Damnjanovic, Faculty of Organizational Sciences, University of Belgrade, Serbia, E-mail: damvesna@fon.bg.ac.rs
Journal of Society for development in new net environment in B&H
2213
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Analysis of the status of the functional abilities of young football players using Conconi test
Miroslav Smajic1, Dusan Maric2, Dejan Madic1, Franja Fratric3, Slavko Molnar1, Jan Varga2
1 2 3
University of Novi Sad, Faculty of Sport and Physical Education, Serbia, University of Novi Sad, Faculty of Medicine, Serbia, University EDUCONS, Novi Sad, Serbia.
Abstract Sport training is a complex and controlled process of the development of all those characteristics and abilities which are important for the Specification Equation for the sport given. In such a process it is utterly important to have a continuous insight in the most significant indicators of the state of physical fitness in order to enable the training control and the correct use of the intensity, means and methods. As a part of the training process it is necessary to undergo tests which are the means to isolate the parameter that is considered to have an important influence on the sport result from the whole competitive activity and to make certain correction if indicated by the results. Diagnosis of physical fitness of the football players represents the first step in creating, managing and controlling the process of the sport training. Based on the data gathered it is possible to set the aims and the tasks of the training process. Functional diagnosis represents a highly important segment of the training technology. By testing the functional abilities of the sportsman one can obtain the information considering specific physiological and biochemical reactions in the organism during the competitive activity, and the insight in the capacities and the values of those abilities eases and improves the selection of the candidates for the sport given, as well as determination of the effects of the applied training process. The issues treated in this study are precisely functional abilities and more specifically abilities of the young football players, i.e. contestants who, 2214
due to the structure of the competitive activity itself, face demanding requirements in a series of anthropological characteristics, where the functional abilities play an important role. Key words: functional status, young football players. Introduction Contemporary football is characterized by the enhanced intensity of the game, universalization of the players, technical-tactical rationality, which consequently leads to higher level of the physical work ability. In order to be successful in the competitive activity players ought to possess several `physical qualities` (Bangsbo, 1993): - ability of long-lasting performance of the intermittent type, - ability to endure high intensity, - ability to achieve great running speed and - ability to produce high strength level in situations like kick, jump and tackling. The activity of the football player in such conditions is often characterized with the maximal and sub-maximal intensity and it lasts from 3 to 20 seconds. This activity is performed in completely anaerobic conditions, in other words the muscles are in a state of ischaemia, without oxygen. The energy reserves which are spent in this manner are substituted during the break or during the period of the activity of the smaller intensity. An immediate energy resource in such muscle activity is decomposition of adenosine triphosphate and creati-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
ne phosphate, the substances rich in energy which have the power of releasing the energy per time unit. This source of energy is activated in all kinds of muscle activity in football considering that the great part of the competitive activity is played in anaerobic and aerobic-anaerobic conditions. ATP reserves are not large and they are sufficient only for several contraction of the maximal intensity. ATP reserves should be replaced immediately because otherwise the muscles lose the ability to contract. Renewal or resynthesis is done thanks to the processes which are different in their biochemical nature (anaerobic without the oxygen and aerobic with the oxygen). In anaerobic conditions there are two mechanisms for supplying the energy, creatine phosphate and glycolytic mechanism. Creatine phosphate mechanism represents the exclusive energy storage at the beginning of each muscle work and at the beginning of any maximum intensity work. It is characterized by high power and low capacity and resynthesis of the energy in this manner does not cause the disturbance of the homeostasis in the organism. After the depletion of this energy source, glycolytic mechanisms for resynthesis of ATP become engaged. This type of energy release is characterized by slower energy release and bigger capacity comparing to creatine phosphate and it is in charge of resynthesis of ATP in maximum intensity activities which last from 45 seconds to 2 minutes. Glycolytic abilities of the organism depend on the amount of the carbohydrates in the form of glycogen which is located in the muscles, liver and as free glycolysis in blood. Aerobic mechanisms of energy release are in charge of completing above mentioned energy resources in the periods of short rest or in case of lower intensity work. Considering the competitive activity where the biggest scope of work is reached exactly in the zones of the medium intensity, it is clear that aerobic mechanisms of the resynthesis of ATP have great impact on the competitive efficiency. Determination of the competitive activity mainly refers to the determination of total distance covered which would represent the amount of work done. Studies conducted in the early 1960s (Winterbootom, 1952) led to the conclusion on the example of the English Premier League that the average distance covered was 3361 meters per match, where the total distance covered consisted
of 2347 meters of the low-speed running and 1015 meters of high-speed running. On the example of football players from Sweden, form the first and the second league, it was determined that the average distance covered by side backs was 11,7 km per match (Whitehead, 1975). On the example of players from Belgium and Danish first league it was determined that the average distance covered was 10, 2 km (Van Gool,1988) which is nearly close to the value of 10,8 km which was determined on the example of English first league players (Bangsbo and Johansen, 1993). The authors stated that the results depended on the methodology of the determination and on the size of the sample. Also, the given distance covered depended on the position of the controlling players. Apart from the determination of the distance covered, it is important to determine various intensities of the competitive activities and their correlation. Therefore, according to a study conducted using the subjects from the top-class Danish players (Bangsbo, 1993) who were observed for at least two matches and who were grouped so that there was an equal number of the defence players, midfielders and strikers, it was determined that standing, walking and low intensity running represented 17,1% ,40,4% and 35,1% of the total match time. The medium high-speed running could be noticed in 5,3% of the game, high-speed running in 2,1% and sprint in 0,7% of the game. The average sprint lasted 2 seconds or 17 meters and on average there were 19 sprints per a match, i.e. there was one sprint in every 4-5 minutes. When the high-speed running is added to this result, one can see that a football player is engaged in an activity of a high intensity every 70 seconds. The first league English football players were engaged in sprint every 90 seconds (Thomas and Railey, 1976). Defined competitive activity has a substantial influence on the functional parameters of the football players. On the example of Czech football players (Seliger, 1968) it was determined that the average heart rate during the match was 165 beats per minute. Later on, it was noted that the average heart rate of a football player of Sweden first league was 175 heart beats per minute (Agnevik, 1970). An average heart rate of the Russian football players was 85% of the maximal heart rate during the 57% of the time of the match (Smod2215
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
laka, 1978). The results obtained by monitoring 6 players of the Danish first league showed that the heart rate was under 73% of the maximal heart rate for 10 minutes or 11% of the total time, between 73% and 92% for 57minutes or 63% of the total time and more than 92% for 26 minutes or 26% of the total time (Rhode & Espersen, 1988). By determining the relationship heart rate – maximal oxygen consumption, which is different for each individual, it is possible to evaluate the need of the organism for the oxygen for the time of the match. This evaluation showed that the average oxygen consumption during the match was about 75% of the maximal oxygen consumption (Railey and Thomas, 1979). Lactate concentration is often used as a parameter of the anaerobic-glycolytic energy production. In the late 1960`s it was calculated that that average lactate concentration at the end of the match was 10 mmol/l (Agnevik, 1970). Ekblom also got similar results using Swedish first league football players. The concentration was 9.5 mmol/l at the end of the first half and 7,2 mmol/l at the end of the match. Determination of the lactate concentration depending on the level of the football game itself showed that as the level of the game increased, the lactate concentration increased as well, during the first half and at the end of the match. Considerable overload of the functional systems in football consequently leads to the necessity of monitoring and controlling aerobic and anaerobic abilities of the players in order to optimize intensity. It is particularly important to conduct the control of the younger football players in order to increase the intensity of the training in the correct manner. Due to the fact that children are characterized by lower level of anaerobic abilities, the priority of the determination of the functional status ought to be determination of the aerobic abilities. Testing of the functional abilities most commonly means testing in laboratory settings with the complete set of different apparatuses (gas analyser, treadmill, lactate analysers, software for data processing etc.). Since there is a small number of those laboratories in our country, football coaches face the problem: how to determine functional status of a sportsmen if they are not able to put the whole team in a specialized institution. The idea for this study was generated by the necessity to 2216
quickly obtain the parameters of the functional status which would be valid enough to determine the current state of each individual and to determine the possible heterogeneity inside the team. Conconi test was chosen since it is a test which can be extremely well applied and based on the earlier research (Fratric (unpublished results), 2000) and the structure of the test itself, it is assumed that the test can evaluate the whole spectrum of the functional status of the sportsmen (in this particular case football players). In 1982, Conconi et al found out, as many before them, using 210 trained runners, that as the running speed increased, the heart rate increased as well. This relationship was almost absolutely linear, up to the point of the sub-maximal intensity. However, with further increase of intensity the linear dependencies of these two parameters decreased with the heart rate starting to `fall behind` the intensity of the running which can be plotted in the graph by the curve to the right. Conconi named the point where the linear relationship of the two parameters stopped `deflection point` (velocity deflection point). Velocity deflection point in fact represents anaerobic threshold, i.e. the critical intensity when aerobic mechanisms of releasing energy become insufficient and anaerobic mechanisms of resynthesis of ATP become involved and the lactate starts to accumulate in muscles and in blood. Based on the given principle, Conconi constructed the test of continuous-progressive workload which later got its name after its creator. The test consists of continuous running with the gradual increase in the running speed at every 200 m. The test starts with the low intensity, e.g. 9 km/h and at each 200 m it speeds up for 0.5 km/h. During the test heart rate monitor records and stores the heart rate and the sportsman presses certain key at every 200m which enables the recording of the heat rate at that precise moment which, later on, represents one step. The test ends when the participant cannot keep up with the given rate. At least 8 steps are needed to estimate anaerobic threshold whereas 20 steps ensure obtaining very precise data. It is of an outmost importance that during the test there should not be any sudden changes of the running speed but the speed should be accelerated at every 50 m and by the end of 200
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
m it must be constant. To obtain the realistic data the sportsmen should not be tired on the day of the test and the day before the test they should sustain from any gruelling training. Sportsmen who are very well trained on average have the deflection point at 10,6 (from 5 to 20) beats from maximal heart rate, whereas the sportsman who are not very well trained have deflection point at 20 to 27 beats from the maximal heart rate. Conconi test fulfills all the metrical characteristics and it gives good results, but the only requirement is that the participants should be in a good shape, so that they could endure the test without stopping and without possible harmful effects on their health condition.
Graph 1. Conconi test The subject of the study is the functional abilities of young football players assessed by Conconi running test. The aim of the study is to determine anaerobic threshold and anaerobic capacity of young football players. Partial aims: - To determine which parameter correlates the most with the length of distance covered, - To determine which parameter correlates the most with the recovery speed and - To determine relationships among all applied variables. Methods 20 football players, aged 14±0.5, participated in the study, all of whom are members in team members of the Football Association of Vojvo-
dina. All the participants have been active football players for at least two football seasons. For the purposes of this study, parameters used were the parameters of the heart rate and the lactate concentration obtained on the test as well as the total distance covered. The following variables were defined: 1. Maximal heart rate (MASF); 2. Total distance covered (PRDE); 3. Maximal lactate concentration (MAKL); 4. Lactate concentration in the fifth minute of the recovery period (KL5O); 5. Heart rate at the anaerobic threshold (FSAP); 6. Percentage of the maximal heart rate at ANP (PMSF); 7. The drop of the heart rate after 1 minute of the recovery period (FS1O); 8. The anaerobic threshold was estimated by running speed (ANPB). During the test the heart rate was recorded using the heart rate monitor ACCUREX PLUS which had as an option to store the heart rates in every five seconds. Each heart monitor had coded signal transmission from the unit into the memory card, which means that the data could not be mixed. The lactate concentration was measured from the blood sampled from the earlobe using the ACCUSPORT device. The testing was performed before the preparation period for the season 2010/2011. The testing was conducted on the running track on the stadium `Vojvodina` in Novi Sad in the morning hours in the period from 10th to 20th August in 2010. Before the test, all the participants were explained the procedure and the point of the test and all the players voluntarily agreed to be tested. None of the participants had been taking any kind of medication the week before and the day before the test none of them was involved in a gruelling physical activity. Before the test, the participants did warm up exercises. Afterwards they put heart rate monitors on. They were told that the test consisted of progressive increase of the workload at each 200 m. The speed rate was dictated by an assistant who was riding a bicycle and who was controlling the speed using the speedometer. At each 200 meters players could hear the acoustic signal to press the red key on the heart rate monitor so that the referential points could be obtained for the determination of the anaerobic threshold. The running lasted until the players could not run any more. In the end of the test blood samples were taken in or2217
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
der to measure the lactate concentration, and the players continued to walk quite slowly until they stopped moving at all, and during the recovery period the heart rate was also recorded and in the fifth minute of the recovery period additional blood sample was taken for the analysis of the lactate concentration. Graphs 1 and 2 and Table 1 show how the Training Advisor programme processes the obtained data. After the test has been finished, all the results which are stored in the heart rate monitor are transmitted onto the computer using the interface and afterwards they are processed by the software. The programme is designed in such a manner that it shows the curve representing the heart rate during the memorised period. The next option is to define the number of meters when the running speed increased and after that the programme automatically shows fitting line which connects in the most ideal way all the steps and it also marks the point where linear dependency between heart rate and the running speed stops. The marked point represents anaerobic threshold and software also shows the data concerning the maximum running speed as well as the speed where the anaerobic and aerobic thresholds are broken. Arithmetic mean, standard deviation, minimal and maximal results are the examples of central and dispersed parameters which are shown. By the means of the correlation analysis, mutual connection among treated variables is also shown. Table 1. Training Advisor
Person Exercise Date Time Note Heart rate Speed (m/s) Speed (km/h) Speed (mph) Time/km Time/mile Length of lap Total time Number of Int. times Degree of speed 10/08/2010 10:00:00 AM CONCONI Maximum limit 198 4.78 17.22 10.70 0:03:29 0:05:36 200 m 0:23:40.5 22 1
Graph 2. Training Advisor
Graph 3. Training Advisor Results and discussion Our research provided the relevant data for this study i.e. the data obtained by Conconi test, as well as certain central and dispersed parameters upon which it is possible to define homogeneity and heterogeneity within the group of the participants. (Table 2).
Anaerobic limit 184 3.47 12.50 7.77 0:04:48 0:07:43
Aerobic limit 164 2.88 10.37 6.44 0:05:47 0:09:18
2218
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 2. Test results with main central and dispersed parameters
N 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Average SD Min Max PRDE 3300 3550 3150 3150 3400 3520 2300 3250 3200 3230 3000 3210 2700 3600 3500 3450 3400 3500 3250 2700 3218 330.2 2300 3600 MAKL 7.20 13.90 6.30 10.40 9.50 9.40 10.20 9.30 10.70 9.70 11.50 9.50 9.80 15.70 13.50 10.90 12.80 9.80 7.40 9.50 10.35 2.28 6.3 15.7 KL5O 5.70 13.50 5.70 8.30 6.90 9.20 8.90 8.30 8.90 6.70 10.30 8.70 7.30 13.60 9.10 7.20 9.00 6.30 6.60 6.30 8.32 2.31 5.70 13.60 MASF 196 211 182 209 205 214 208 195 200 205 215 210 203 200 205 202 191 220 200 205 203.80 8.76 182 220 FS1O 68 26 62 45 62 31 50 45 50 44 32 55 30 40 38 60 52 55 52 48 47.25 11.73 26 68 FSAP 181 193 169 186 190 192 192 172 182 182 180 190 180 182 184 185 170 195 184 190 183.95 7.47 169 195 PMSF .93 .92 .93 .89 .93 .90 .93 .89 .91 .89 .84 .91 .89 .91 .90 .92 .89 .89 .92 .93 .90 .02 .84 .93 ANPB 12.41 12.72 12.63 11.84 13.60 11.45 10.75 11.02 11.72 11.92 12.77 12.18 10.79 11.40 11.80 12.20 10.88 12.64 12.04 11.92 11.93 .75 10.75 13.60
Based on the given data (Table 2) it is easy to conclude that there are great differences among football players. According to almost any variable the results are quite different among the participants. The first (general) criterion was the length of the distance covered since the participant who got better result in this variable surely possessed either remarkable anaerobic or aerobic ability or he possessed such a relationship between these two areas which enabled him to achieve better results on the test. We did not intend to include certain complex statistical procedures (which very often make it more difficult to interpret the results since the functional space of men is already too complex from the cause-effect point of view and unexplained and one should not overload it with the pompous statistical observations) and certain basic descriptive parameters are included for the sake of better interpretation of the results. Hence, according the minimal and maximal value of the given variable, it is noticeable that the dispersion of the results is very high and that the participants
could be divided into several categories: the first category would include the players who ran more than 3400 meters, second category would include football players who ran between 3000 and 3400 and the third category would include those players who ran below 3000 meters. However, the length of the distance covered depends on the whole series of factors which influence the final result. Bearing in mind that the participants were explained clearly that the test would last until they could not run anymore and keeping in mind the fact that the best participants were offered a small prize, we consider that all the participants did their best so we exclude the possible influence of the psychological factors on the results. In other words, we think that the result of running depended only on the functional abilities of the organism, i.e. from the complex mutual relationships of the aerobic and anaerobic abilities, aerobic efficiency, mechanical efficiency, etc. Since it is possible to evaluate each of these parameters separately based on the system of the chosen variables, more attention 2219
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
was focused on the heterogeneity of the results within other variables which either assess the ability of a certain area of the functional status (anaerobic threshold) or represent one of the parameters that has been the main parameter for monitoring and controlling the state of physical fitness over the years (heart rate, lactate concentration, etc.) The maximal heart rate varies from participant to participant from 182 to 220 beat in a minute. This indicates the necessity to regularly monitor the whole series of parameters regarding heart rate (heart rate in the stand-still state, morning heart rate and the heart rate in early and late phase of the recovery period) since it is not possible to have an insight in the degree of the workload just based on the value of the heart rate during the running. It is obvious that the same heart rate result for two different football players does not mean the same degree of the workload. Maximal lactate concentration varies in a range from 6.3 mmol/l to 15.7 mmol/l. This information indicates that the participants show different abilities regarding anaerobic energy release and tolerance to high lactate concentration. Furthermore, it is possible to assume that even though all the participants were of the same age, their age was different from the biological point of view. If we keep in mind that all the participants put the maximal effort, it is clear that the lactate concentration is an indicator of the stronger anaerobic capacity for the resynthesis of ANP. At the same time, maximal reached concentration shows that the participants differ even regarding aerobic abilities, in maximal oxygen consumption, which enables the work to continue in mostly anaerobic conditions for a longer period. High lactate concentrations in activities over longer period represent clear indicator of high level of the aerobic abilities, primarily maximal oxygen consumption (Olbreht, 2000). According to this, it is clear that the analysis of the lactate concentration in the end of the test can be used to determine aerobic ability of the participants. Lactate concentration in the recovery period is often control parameter for testing functional status of the sportsmen and in fact it represents the quality of an organism to quickly regain the state of homeostasis. The drop of the lactate concentration in a certain moment of the recovery period 2220
indicates the ability of aerobic system to `spend` accumulated metabolites in the blood. This parameter assesses the early phase of the recovery period. The results obtained in this study point out that the participants were quite different regarding this parameter which is another confirmation of the necessity to monitor the functional workload of the organism during the training process. The following two parameters actually represent the same phenomenon, anaerobic threshold, i.e. aerobic efficiency, but defined differently. The first parameter actually represents heart rate when the anaerobic threshold is broken, but it reveals relatively small pieces of information since the high heterogeneity of the maximal heart rate within the group of the participants makes it impossible to determine the actual level of the workload when the anaerobic threshold is reached. That is why we used another parameter, which represents the percentage of the maximal heart rate where the anaerobic threshold is reached, to represent the anaerobic threshold (ANP). It is a much better parameter since it reveals much more information and it shows that the group of the participants is quite homogenous according to this parameter. This indicates that the sportsmen have been training for a long time, since according to Conconi himself, trained sportsmen have the deflection point at 5-15 heart beats of the maximal heart rate. This arises many questions and it confirms the necessity for further study of the significance of the anaerobic threshold in sport games. The third parameter of the anaerobic threshold (ANPB) is in fact indicator of the motor efficiency of the organism. According to the analysis of the results, it is possible to notice that even though the participants achieve anaerobic threshold at the almost identical heart rate values comparing to the maximal achieved heart rate, anaerobic threshold assessed by using the running speed differs significantly. The values of this parameter range from 10.75 to 13.16 km/h. This information points out at two things. Firstly, there is a great heterogeneity in mechanical efficiency of the participants, which means that the running technique is very different. Secondly, the participants as a group are characterized with the relatively low mechanical efficiency comparing to the results of other grown up sportsmen engaged in athletics. These results match the
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
results of the earlier studies which stated that the mechanical efficiency improved with the development and the growth of the organism. Monitoring of the heart rate in the recovery period also quite often represents control parameter in sport. Most authors who studied this subject state that in order to evaluate the physical condition of a sportsman it is more important to determine the time interval when the heart rate returns to the starting values. However, there are studies which state that this parameter evaluates the ability of the cardiovascular system to regain normality and that by using this, one can determine physical condition of the whole organism. The results obtained in this study show that the participants differ considerably regarding this parameter, with the minimal value of 26 ot/min and maximal value 68 ot/min. It is important to point out that the value of this parameter depends on the series of other parameters, and it is necessary to say that this parameter falls down as the lactate concentration in blood drops in the same interval and it gives quite good indicators of the ability of the organism to regain homeostasis. A brief overview of the results of the test represented by the given parameters showed that the group was quite heterogeneous, which meant that in almost each segment of the functional status there were big differences within the team. These results exactly confirm the tendency of the individual approach to the group training that has become predominant in recent years. According the given parameters it is possible to make great number of the combinations of the subsamples or subgroups, but only those parameters which in the sport activity carry the most predictable value such as lactate endurance ought to be chosen and only then the group can be homogenised. Other parameters such
VARIABLES PRDE MAKL KL5O MASF FS1O FSAP PMSF ANPB PRDE 1.000 .319 .270 .000 .020 -.016 -.056 .366 MAKL .319 1.000 .843 .250 -.541 .119 -.274 -.198 KL5O .270 .843 1.000 .248 -.651 .134 -.227 -.164
as the heart rate may serve as the auxiliary parameter according to which each participant is monitored separately and it is possible to carry out subtle correction according to the obtain information. It is especially interesting to see the relationships among the chosen parameters and if the possible relationships can be explained in a logical and physiological way based on the earlier investigations which dealt with the similar topics. For that purpose cross correlative matrix was used (Table 3). By the analysis of the results (Table 3), it can be concluded that the total distance covered on the test does not correlate significantly with any of the variables. This indicates complex relationship between variables of the functional status and the distance covered on the test. Furthermore, it can be stated that these participants are characterized by too much heterogeneous characteristics in functional status and in mechanical efficiency which makes any connection between the obtained result and tested parameters impossible. Maximal lactate concentration from the statistic point of view correlates significantly with the lactate concentration in the recovery period and with the heart rate in the recovery period. Statistic connection with both parameters can be explained logically. The participant who reaches higher lactate concentration in the end of the test will have the higher lactate concentration in the recovery period, i.e. the participants who have higher lactate concentration on the test will have smaller drop of the heart rate in the recovery period. This indirectly indicates that the participants are characterized with the similar aerobic power but this should be carefully analysed since aerobic ability in this study was not estimated by any means of direct or indirect method.
MASF .000 .250 .248 1.000 -.434 .824 -.362 .200 FS1O .020 -.541 -.651 -.434 1.000 -.146 .524 .315 FSAP -.016 .119 .134 .824 -.146 1.000 .226 .278 PMSF -.056 -.274 -.227 -.362 .524 .226 1.000 .133 ANPB .366 -.198 -.164 .200 .315 .278 .133 1.000
Table 3. Intercorrelative matrix of the system of the applied variables
* Marked correlations are statistically important at the level from 0.05.
Journal of Society for development in new net environment in B&H
2221
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Using the data (table 3) we can see that the maximal heart rate in a system of the chosen parameters statistically correlates significantly with the parameter of anaerobic threshold and with the absolute value of the heart rate at the anaerobic threshold. Bearing in mind earlier mentioned fact that the participants are quite homogeneous regarding anaerobic threshold represented in the percentage of the maximal heart rate, it is clear that the participants with the higher maximal heart beat will have higher anaerobic threshold represented by absolute values of the heart rate. Statistically significant connection between Fmax and anaerobic threshold can be explained by the generation heterogeneity of the participants. Namely, the development of the aerobic efficiency requires years of training on the regular basis. Since all the participants who have high maximal rate belong to the younger group of the football players, we conclude that they are still in the phase of the developing the aerobic efficiency on the one hand and they have not yet reached the effect of the bradykardia in contrast to their older teammates on the other, and this causes mentioned relationship of the two parameters. The drop of the heart rate in the first minute of the recovery period correlates negatively, in the statistic point of view, with the lactate concentration during the recovery period and anaerobic threshold represented by the percentage of the maximal reached heart rate. All the correlations represent the connections which can be easily physiologically explained. The higher lactate concentration, the smaller drop of the heart rate. The same physiological principal underlies the connection with the second parameter whereas the connection with the last parameter in fact indicates that the higher level of aerobic efficiency can be connected to the speed of the recovery in the early phase of the recovery period. In other words, participants with better anaerobic threshold have the ability of faster recovery which is in accordance with the accepted principles of the sport training as well as with the results of the numerous studies. Variable of the anaerobic threshold represented as the running speed from the statistic point of view is not significantly connected to any of the variables which indicates the huge difference in the mechanical efficiency of the participants. 2222
It is interesting to notice that the variables of the lactate concentration correlate statistically only with themselves and with just one parameter of the heart rate. This should not come as a surprise. The phenomenon of the lactate in blood is by its nature quite complex and saturated with the abundance of the factors which are not explained enough. The concentration of the lactate in blood also depends on the difference between the production and elimination of the lactate in blood, and these two processes are extremely complex. What is still unknown is the rate of the diffusion of the lactate in blood, the speed of the delivery of the lactate in the organism, the percentage which oxidizes and the percentage which turns into glycogen which influence the stabile lactate state etc. These problems make it impossible to create some kind of universal model which could be used to define the relation of the lactate concentration and the intensity of the workload which would make possible to `copy` the recipes for the training. However, this does not mean that the lactate cannot be used as a parameter in monitoring the state of physical fitness. Quite opposite, nowadays it is considered as s scientific fact that the monitoring of the lactate represents equally good, if not even better parameter for monitoring and controlling state of physical fitness (Weltman, 1995) than the maximal oxygen consumption. This requires continuous and individual monitoring of the values of the lactate during the training and during the competitive activity itself. The second parameter which does not have statistically significant correlation with any parameter in the system of the chosen parameters is recovery, in other words the drop of the heart rate in 1 minute. This only confirms that the recovery period is just a set of numerous factors mutually connected and that it is necessary to monitor the series of the factors in order to objectively assess the ability of the fast recovery, which is of a great importance in football. Using the results of the test it is possible to assess the ability of each individual in the series of parameters connected to the functional status. The aim of this study is not classification of the participants in some more homogeneous groups based on certain parameters, even though it is clear that this could be accomplished, but the aim is to anal-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
yse the relation among the parameters in the space of variables and to, based on such determined relations, perform possible condensation and to compress the parameters on the optimal level. Maximal lactate concentration is a parameter which we could not connect with any parameter, so it is recommended to take the lactate samples several times during the test. Obviously all used parameters are relevant only in longitudinal studies when the differences in the reached values between two or more test yield good quality data about the effects of the training and about the improvements in certain areas of the functional status. The analysis of each separate case can provide very useful information about the spectrum of the functional abilities and to indicate stronger and weaker aspects of the functional abilities of each individual. Conclusion Concnoni test proved out to be a good mean for assessing the functional status of the football players. Among the results of this test it is possible to isolate a few parameters which we consider to be of an important influence on the success of the match, i.e. realisation of the competitive activity. It is easy to use, quite cheap and simple and therefore it gives a possibility to quickly assess the functional status of a football player. The results of the test showed that the group of the football players was quite heterogeneous. The results are similar to those result obtained in earlier studies (Brdaric at all. 1997), as well as the level of the anaerobic threshold (Haimer, 1997). However, anaerobic abilities belong to the zone of the high results for the given age which partially confirm the general hypothesis. The distance covered in Conconi test statistically does not correlate with any parameter so it can be said that the first partial hypothesis is rejected. Anaerobic threshold represented in percentage of the maximal reached heart rate on Conconi test statistically correlates significantly with the drop of the heart rate in recovery period. This confirms the importance of aerobic abilities in recovery after anaerobic work and at the same time the second partial hypothesis is confirmed. In the system of variables statistically impor-
tant correlations are determined which confirms the third partial hypothesis. Results of the test give insights into functional status of each football player which enables the division of the team into two or three subsample with homogeneous characteristics which creates preconditions for the optimal training process. Namely, division of the team into subgroups and the use of different training stimuli make it possible to have the situation where similar players are trained in similar way, which is exactly what football players need. They should not be trained as a heterogeneous group under the same conditions with uncertain effects. References
1. Agnevik, G. (1970). Fotball: Indrottsfysiologi. Stockholm: Trygg- Hansa. 2. Bangsbo, J. (1993). The physiology of soccer. Denmark: University of Copenhagen. 3. Brdaric, I. i Ugarkovic,D. (1997). Određivanje anaerobnog praga kod kosarkasa. Beograd: Fakultet fizickog vaspitanja. 4. Conconi F, Ferrari M, Zioglio P, Droghetti P, Codeca. (1982). Determination of the anaerobic threshold by a noninvasive field test in runners. Journal of Applied Physiology, 52:869-837. 5. Fratric, F. (1996). Modelovanje metoda treninga za razvoj anaerobne i aerobne izdrzljivosti na bazi treniranosti sportiste. Novi Sad: Fakultet fizicke kulture. 6. Fratric, F. (1998). Fiziolosko-biohemijski profil i specificnosti treninga u triatlonu. Savetovanje sa međunarodnim ucescem. Novi Sad: “Dijetetski proizvodi i trenazni process”. 7. Fratric, F., Malacko, J. (1997). Relacije između nekih kriterijuma kardio-respiratorne i bioenergetske sposobnosti sportista. Zrenjanin – Melenci: Jugoslovenski simpozijum sa me|unarodnim ucescem “Kardiovaskularni sistem i fizicki napor”. 8. Fratric, F., Malacko, J. (1998). Neki problemi kod interpretacije i aplikacije maksimalne potrosnje kiseonika, povisene koncentracije laktata u krvi i frenkvencije srce kod sportskog opterecenja. Zrenjanin: Jugoslovenski simpozijum sa međunarodnim ucescem. Da li je atletsko (sportsko) srce zdravo?.
Journal of Society for development in new net environment in B&H
2223
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
9. Jakonic, D., i Bajic, M. (1996). Fiziologija sa biohemijom i higijenom. Novi Sad: Fakultet fizicke kulture. 10. Koprivica, V. (1998). Osnovi sportskog treninga. Beograd: Samostalno izdanje autora. 11. Nikolic, Z. (1995). Fiziologija fizicke aktivnosti. Beograd: Fakultet fizickog vaspitanja. 12. Olbrecht, J. (2000). The Science of Winning: Planning, Periodizing and Optimizing Swim Training. J. Olbrecht. pp 203-241. 13. Radosav, R., Molnar, S., Smajic, M. (1997). Nivo motorickih sposobnosti decaka uztasta 7-11 godina koji se bave i koji se ne bave sportom. Novi Sad: Prvi međunarodni simpozijum FFK. 14. Radosav, R., Molnar, S. i Smajic, M. (2003). Teorija i metodika fudbala. Novi Sad: Fakultet fizicke kulture. 15. Reilly, T. and Thomas, V. (1976). A motion analysis of work-rate in different positional roles in professional football match-play. Journal of Human Movement Studies, 2: 87–97. 16. Rohde HC, Espersen T (1988) Work intensity during soccer training and match-play. In: Reilly T, Lees A, Davids K, Murphy WJ (eds) Science and football. Spon, London, pp 68–75. 17. Smodlaka, V.N. (1978). Cardiovascular aspects of soocer. The Physician and sportsmedicine, 6: 66-70. 18. Van Gool, D., Van Gerven, D. and Boutmans, J. (1988). The physiological load imposed on soccer players during real match-play. In Science and Football (edited by T. Reilly, A. Lees, K. Davids and W.J. Murphy), pp. 51–59. London: E & FN Spon. 19. Weltman, A. (1995). The blood lactate response to exercise. New York: Human kinetics. 20. Whitehead, E.N.L. (1975). Conditioning for Sport. Yorkshire: E.P. Publishing. Corresponding author Miroslav Smajic, University of Novi Sad, Faculty of Sport and Physical Education, Novi Sad, Serbia, E-mail: miroslav.smajic@gmail.com
2224
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Assessing the differences in quality of life in patients after acute neuroinfection
Radoslava Doder1, Ksenija Boskovic2, Sandra Stefan Mikic1, Matilda Vojnovic3, Dragan Doder4, Sinisa Sevic1
1 2 3 4
Medical Faculty University of Novi Sad, Clinical Center of Vojvodina, The Clinic for Infectious Diseases, Serbia, Medical Faculty University of Novi Sad, Clinical Center of Vojvodina, The Clinic for Medical Rehabilitation, Serbia, Health Centre Novi Sad, Serbia, Regional Institute of Sport, Novi Sad, Serbia.
Abstract Introduction: The main objective of this study was to determine the difference in assessing the quality of life of patients with acute neuroinfection in relation to the outcome of the disease. Method: Retrospective-prospective clinical study was performed on 122 patients diagnosed with acute neuroinfection (meningitis / encephalitis) and meningism, who have been treated at the Clinic for Infectious Diseases in Novi Sad. Results: Of the total of 122 patients, average age 28, 56 years (from 5 to 73 years), 70 were male (57.4%) and 52 were female (42.6%). The initial measurement, showed the following results: In the FR group 32.2% of respondents perceived their health as very good / excellent, 72.7% have no physical problems and more than half have no limitations in their physical functioning. 78.0% do not have any emotional problems, 88.2% have preserved their social functioning, and 69.5% were calm and happy. In the RC group, only 14.3% of the respondents were completely satisfied with their health. 25.7% had no physical problems, while 14.3% had no limitations in their physical functioning. 34.3% of the respondents do not have emotional problems, 74.2% have preserved their social functioning, and 65.7% feel calm and happy. At the end of the study 94.9% of people in the FR group denies pain, for 83.1% their own health is very good / excellent, and 94.9% have no limitation in physical functioning. There are significantly more people with no limitations in physical functioning compared to the RC gro-
up (p<0.05). 94.9% of the respondents are calm and happy, 77.9% have preserved their social functioning, and 89.8% do not have any emotional problems. In the FR group, 85.7% of respondents deny pain, 77.1% perceived their health as very good / excellent, and 80 % have no limitations in physical functioning. 91.4% people are happy, 80.0% have preserved their social functioning, and 88.6% have no emotional problems Conclusion: The results of this study show the importance of analyzing the physical and mental health and the health self-assessment of quality of life in patients with neuroinfection in relation to the outcome of disease. Key words: meningitis, encephalitis, outcome, quality of life, SF-36 Introduction Meningitis is an inflammation of the soft membranes of the brain that can be caused by various infectious (usually viruses) and non-infectious causes; it is usually of short-term clinical course and good prognosis. Acute bacterial meningitis is a severe illness caused by bacteria, which leads to the accumulation of purulent exudate in subarachnoid space. Encephalitis is a potentially fatal, viral, inflammatory disease of the brain that has a high risk for the disorder of vital functions and uncertain outcome with the possible severe consequences. The clinical manifestations of infections in the central nervous system (CNS) are characterized by the appearance of meningeal signs and symptoms. 2225
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Clinical features of bacterial meningitis depend on the age of patients, types of agents and predisposing factors. Usually it starts suddenly, with fever, headache, vomiting, stiff neck, drowsiness and photophobia. Rapid progression is possible with the development of disturbance of consciousness and focal neurological signs. Further course of the disease and prognosis depend on the time of initial diagnosis and antibiotic therapy. Acute viral encephalitis (AVE) is known for its dramatic beginning with frequent seizures and a lesion of cranial nerves as well as severe complications that increase the risk for adverse outcomes that prolong and increase the cost of treatment. The diagnosis of meningitis / encephalitis requires a lumbar puncture. Changes in cerebrospinal fluid resulting from inflammation are very specific and can help in identifying the cause and determining the nature of the infection. Effective antibiotic therapy with anti inflammatory agents (Dexamethasone) eradicates pathogens from CSF, improves the outcome of bacterial meningitis and reduces the number of sequelae. The treatment of AVE is very complex and involves primarily causal and antiedemous, immunomodulatory and other symptomatic therapy. It is known that damaged brain functions can be restored in the post-acute stage of illness. The duration of the restoration process in the CNS is indefinite, and therefore the estimate of the final outcome of residual damage must be dynamic and longitudinal (1,2,3,4,5,6). The instruments of measuring quality of life related to health, measure the changes in the physical, psychological and social domain of health caused by illness or disability, taking into account the self-assessment of health (7). Up to now a questionnaire for examining the influence of acute neuroinfection on quality of life has not been developed. The starting point of this paper is the hypothesis that there are significant differences in the assessment of physical and mental health between different groups of patients according to the outcome of acute neuroinfection. In accordance with the set hypothesis, the main aim was to determine the difference in assessing the quality of life of the patients with acute neuroinfection in relation to the outcome. Specific goals were to estimate the components of health 2226
and quality of life for each of the three groups of patients and the difference between the groups in relation to the date of the assessment. Method The survey was conducted for four years, as a retrospective-prospective clinical study, at The Clinic for Infectious Diseases in Novi Sad, Clinical Center of Vojvodina. The sample consisted of 122 patients diagnosed with acute meningitis / encephalitis, viral or bacterial etiology, and patients who had inflammation of the CNS, but did not clinically manifest meningeal signs and symptoms. In relation to the outcome, patients were divided into 3 groups: The (FR) group, fully recovered, that consisted of 59 patients who were discharged as cured; The (RC) group, recovered with the consequences, which consisted of 35 patients who were discharged with the consequences of the disease. The (C) group , control group that consisted of 28 patients in whom CSF analysis showed a normal number of cellular elements, normal sugar and protein levels and the absence of bacteria in directoscopy preparation of CSF. These patients had clinically manifested symptoms of meningeal or lateralization of the neurological findings on admission to the treatment. The study excluded the patients who suffered from another disease that significantly impairs quality of life, regardless of neuroinfection. The diagnosis was based on clinical features, epidemiological survey, objective clinical and neurological findings. It was confirmed by the appropriate analysis of CSF (morphological, biochemical cytology, directoscopy and culture) as well as by serological tests of blood / CSF (complement fixation (CF), immunoenzyme test (ELISA)). In patients with acute bacterial meningits a lumbar puncture (LP) was performed on admission (diagnostic), then 48-72 hours after the beginning of the treatment (control) and at the end of the treatment, 10-14 days after the beginning of hospitalization. In patients with viral meningitis / encephalitis we performed diagnostic and, if necessary, control LP. The control group patients underwent only diagnostic LP. All the patients underwent routine hematological and biochemical blood tests, bacteriological (nasal
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
and throat swabs, urine culture, blood culture), viral and other tests (electroencephalography (EEG), radiography X-ray of lungs, heart and / or paranasal cavities, fundus examination, ENT examination). To detect structural brain lesions we used computed tomography (CT) and, if necessary, magnetic resonance imaging (MRI). All data on sociodemographic characteristics of patients, clinical and laboratory findings, disease course, the applied treatment and outcome, were entered in a specially designed questionnaire. This provided data for the further computer processing. As an instrument for assessing quality of life we used general health questionnaire, SF-36 (The MOS 36-Item Short-Form Health Survey) which was given 6 and 24 months after an acute neuroinfection. The questionnaire was composed of 36 questions-assessment related to 8 scales: physical functioning (PF), physical role (PR), bodily pain (BP), self-assessment of general health (AH), mental health (MH), emotional role (ER), social functioning (SF), vitality, energy or exhaustion (V). Summary scales of physical health components included PF, PR, BP and AH and the scale of mental health included MH, ER, SF and V. The questionnaire was translated from English and used in direct contact with the respondents. For the school children the questionnaire was filled in by a parent. All participants in the study gave us their written consent. For statistical analysis, we used the multivariate analysis of variance (MANOVA), discriminant analysis, Roy’s test, followed by t-test for proportions and Student’s t-test for proportions. The first test indicates the existence of similarities or differences. The second indicates the biggest differences found in some categories / features. Using a discrimination coefficient we eliminated the features that determine the specificity of groups and characteristics that needed to be excluded from further processing. Based on the assessment of homogeneity and the distance between the groups (Mahalanobis) it is easy to see which groups of patients are similar, and which are different on the basis of selected characteristics. The working hypothesis was accepted at a critical value of p = 0.100. For 0.10>p>0.05, we accepted the working hypothesis with an increased risk of deduction. If p<0.05 we accepted the working hypothesis and
noted the significant differences. The study results are presented in tables and graphs. Results In the sample of 122 patients, average age of 28,56 years (age 5 to 73), there were 70 (57.4%) males and 52 (42.6%) females. As an instument to assess the quality of life we used SF-36 questionnaire. It was applied in direct contact with subjects 6 and 24 months after the acute neuroinfection. General characteristics, some of the clinical characteristics and outcomes in groups, are shown in Table 1. Analysis of the physical components of the initial check showed that it in the FR group 32.2% of respondents perceived their health as very good / excellent, unlike the RC group, where only 14.3% of patients were satisfied with their health. In the C group, no individual was satisfied with their health. There is a statistically significant difference in self-perception of general health between the groups FR and RC (p = 0.057). In the FR group, 72.7% of patients have no problems related to physical health, and more than a half have no limitations in their physical functioning. In the RC group 25.7% of patients have no physical problems, while 14.3% have no limitations in physical functioning. In the C group, 67.9% have no problems related to physical health, while 42.9% have no limitation in physical functioning. In the RC group the frequency of with no physical problem is considerably less than the others (p<0.05). We found a statistically significant difference in the assessment of physical functioning between the 3 groups (p<0.05). Based on analysis of MANOVA and discriminant analysis for the examined features of the physical components, it can be said that the greatest contribution to the difference between the groups is in: self-assessment of general health (0.191), physical role (0.043), physical functioning (0.041) and bodily pain (0.039). Based on the defined characteristics of groups in relation to the assessment of the physical components, it may be concluded that the highest homogeneity is in the groups RC 77.1% and FR 76.3%, and then in the group C 60.7%. Based on the presented dendro2227
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 1. General characteristics of causes, some of the clinical characteristics and outcomes, by group
General characteristics Age (y) 5-14 15 -30 31-40 41-50 51-60 >60 Group FR (%) (n=59) 42,4 39,0 11,9 1,7 1,7* 3,4 62,7 37,3 20,3 1,7 0 79,7 3,4 8,5 11,9 5,1* 37,3† 7,1* 0 0 0 0 Group RC (%) (n=35) 8,6 25,7 11,4 20,0 20,0 14,3 62,9 37,1 11,4 22,9 11,4 60,0 11,4 11,4 25,7 37,1 65,7 62,9 17,1 17,1 11,4 8,6
Sex (%)
FR- Fully Recovered; RC Recovered with Consequences; * p=0.00; †p=0.01
Male Female Underlying diseases / conditions as a risk factor pharngitis / sinusitis head trauma alcoholism / cirrhosis Localization of inflammatory processes in the CNS meningitis encephalitis Positive cultures blood CSF Focal neurological findings Pathological EEG Neuroinfection consequences, at discharge hearing disorders neurosis sleep disorders EPI
gram it can be seen that the nearest groups are FR and C with a distance of 1.16 and that there is the biggest difference between the groups FR and RC at a distance of 1.41 (Figure 1).
FR group fully recovered (1); RC group recovered with the consequences (2); C control group (3).
Figure 1. The closeness of certain groups of patients according to estimates of physical components of quality of life at the initial check 2228
Final measurements show that 94.9% of people in the group FR have no pain, unlike the RC group and group C where there is the equal number of respondents denying pain (85.7%). There was no statistically significant difference in the assessment of bodily pain between the three groups (p>0.1). For 83.1% of the patients in the FR group, their health is very good / excellent, 94.9% have no limitation in physical functioning. In the RC group, 77.1% of the patients perceived their health as very good / excellent, while 80.0% have no limitation in physical functioning. In the C group, 71.4% perceived their health as very good / excellent, while 78.6% are without limitations in physical functioning. In the self-assessment of general health there is no statistically significant difference. In the FR group there is a significantly higher number of patients without limitation in physical functioning as opposed to the other two groups (p<0.05).
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The analysis of the differences between the groups in relation to the assessment of physical components at the final check shows that the biggest differences between the groups are in the following: bodily pain and general health self-assessment (0.041), followed by physical functioning (0.027) and physical role (0.002). Based on the defined characteristics of the groups, it can be said that the homogeneity of the group FR (96.61%) and RC (91.43%) was almost equal, while in group C it decreased (46.43%). By calculating the distance between the groups in relation to the assessment of the physical components at the final measurement, it can be said that there is moderate distance (0.5), between the groups RC and FR, while between the groups RC and C the distance, and thus the difference, is greater. (0.95) (Figure 2).
assessment of mental health between the three groups. In the group RC, the assessment without emotional problems was significantly smaller than the other two groups (p> 0.05). In relation to social functioning there was no significant difference between the groups (p>0.1). The analysis of the differences between the groups in relation to the assessment of mental components of the respondents shows that the biggest difference between the groups is in: emotional roles (0.086), social functioning (0.077), mental health (0.017) and vitality (0.004). On the basis of defined characters, the highest homogeneity is found in the C group 82.14%, then in the FR group 76.27%, and the lowest is in the RC group 65.71%. By calculating the distance between the groups in relation to the assessment of mental components, it can be noted that there is the minimum distance between the groups FR and C with the distance of 0.45, and that the farthest are the FR and RC groups with the distance of 1.29 (Figure 3).
FR group fully recovered (1); RC group recovered with the consequences (2); C control group (3).
FR group fully recovered (1); RC group recovered with the consequences (2); C control group (3).
Figure 2. The closeness of certain groups of patients according to estimates of physical components of quality of life at the final measurement
Figure 3. The closeness of certain groups of patients according to estimates of mental components of quality of life at the initial check
Based on analysis of mental components of the respondents at the initial measurement, 78.0% of patients in the FR group have no emotional problems, 88.2% have preserved their social functioning, and 69.5% feel calm and happy. In the RC group 34.3% have no emotional problems, 74.2% have preserved their social functioning, and 65.7% feel calm and happy. In the C group, 71.4% have no emotional problems, 92.8% have preserved their social functioning, and 89.3% were happy. There is a statistically significant difference in the
The final measurement in the group FR shows that 94.9% of the patients are calm and happy, 77.9% have preserved their social functioning, and 89.8% have no emotional problems. In the RC group 91.4% of patients are happy, 80.0% have preserved social functioning, and 88.6% have no emotional problems. In the C group, 85.7% people were happy, 50.0% had good social functioning, and 82.1% have no emotional problems. On a scale that measures mental health, there is no statistically significant difference between the 3 groups. Good social functioning was significantly lower in 2229
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
the control group (p<0.05). There is no significant difference between the 3 groups in relation to the limitation of activity due to emotional problems. The analysis of the discrimination coefficient shows that the greatest contribution to the difference between the three groups in relation to the evaluation of mental components at the final measurement give: mental health (0.027), social functioning (0.018), emotional role (0.003) and vitality (0.000). Based on the defined characteristics of the groups in relation to the assessment of mental components, it can be concluded that the highest homogeneity is found in the RC group 85.71%, followed by the FR group 79.66% and the lowest is in the C group 46.43%. By calculating the distance between the groups it can be said that the nearest groups are the RC and FR group at a distance of only 0.14, and the furthest are the C and the RC group at a distance of 1.0 (Figure 4).
FR group fully recovered (1); RC group recovered with the consequences (2); C control group (3).
Figure 4. The closeness of certain groups of patients according to estimates of mental components of quality of life at the final measurement Discussion
The outcome of the disease was favorable in 83 patients (68%), while the 39 (32%) of the patients were released with consequences. The most common sequelae in our patients were: headache 62.9%, followed by neurosis and hearing problems 17.1%, sleep disturbances and dizziness 11.4%, benign fasciculation, epilepsy and imbalance 8.6%, vision problems and decreased concentration 5.7%. A number of years after bacterial meningitis Čanak 2230
et al. found headache in 31.65% of patients, mild neurological injuries 25.32%, hearing loss 27.91%, and deafness 4.65%. Interference in cognitive functioning had 31.25% of patients. Gofferey et al. studied the complications of purulent meningitis in the group of adult patients age 50-90. It turned out that the most common complication was pneumonia in 41% of patients, neurological impairments 28%, motor weakness 30%, hydrocephalus 9%, urinary tract infections 17%. In the age group 15-49 years the same authors have found neurological injuries in 19% and pneumonia in 5% of the patients. 56% of patients were fully recovered with no complications. Keliman et al. found hemi paresis in 17%, seizures in 12%, cranial nerve deficiency in 7% and loss of cognitive function in 5% of patients. Šašić found epilepsy as a sequela in 9 (5.3%) of 163 patients with bacterial meningitis Akpede et al. found that the relative risk of adverse outcome in bacterial meningitis is linked to at least three of the ten characteristics: age < 2, duration of illness > 7 days, outpatient antibiotic treatment, focal neurological deficit, difficult general condition, hypo / hyper tonus muscle, negative meningeal signs, shock, coma and convulsions. The first six features were in the particular relation to consequences, and shock and coma with death. Filipovic found statistically significant difference in the frequency of seizures by etiology of different groups of patients (34.7% with purulent compared to 4.72% with viral meningitis). Edwards found significantly more complications in children with meningococcal meningitis when the number of cells in CSF at diagnosis was >10,000 mm3. Bohr found severe neurological sequelae in patients with pleocytosis >5000/mm3. Valmar has shown that a bad outcome commensurate with low values of sugar in the CSF. In patients with bacterial meningitis Nadol found a positive correlation between hearing loss in the acute stage of disease and low blood sugar and pleocytosis, and a negative correlation with the protein in CSF. Nelson et al. reported that the level of lactate in the cerebrospinal fluid and cerebrospinal fluid cytological analysis are more specific and sensitive methods of determining sugar in the liquor (or the relationship of sugar in CSF / blood sugar). Bohr found the sequelae of 10.54% of 94 patients with pneumococcal meningitis: neurological and neurophysiological in 42% and 25% otological, while the fatal outcome
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
was noted for 18.9%. The same study revealed that the permanent sequelae were more frequent in females aged 16-50 years, if they had not previously received antibiotic therapy in case of a positive blood culture in blood and cerebrospinal fluid. Šašić found neurological sequelae in 71% of controlled patients with AVE: lesion of cranial nerves, 57.7%, then tremor 28.8%, the central motor neuron lesion 26.6%, nystagmus 25.5%, headache 23.3%, involuntary movements 20.0%. Exploring different pathological manifestations in people who have recovered from AVE, the same author found different neurotic states in 24.4%, anxious-depressive neurosis in 6.6% and neurasthenia in 3.3%. Mental retardation was found in 10%. Trouble concentrating, increased fatigue, difficulties in adapting and polysomatic disorder, could be found practically in every adult patient (4,5,6,8,9,10,11,12,13,14). An assessment of behavior level and abstract thinking is the most important for the diagnosis of cortical lesions. Abstract skills are developmentally the youngest and also the least resistful to destructive influence (hyperpyrexia, endotoxins, cerebral edema, infections, circulatory disorders, micro thrombosis). The probability that the various subjective symptoms (headache, trouble concentrating, increased fatigue, difficulties in the adaptation) that resulted from organic brain lesions is higher than in patients with similar disorders that have not suffered from encephalitis. The above problems are usually not insulated; they are usually accompanied by signs of neurological lesions (changes in the EEG, abnormal CT, etc.). It is generally accepted that the mental functions after cerebral trauma in the greatest degree recover within 6 months. After that stage there is delayed recovery of mental function that can last for years. The most important cognitive deficit after cerebral trauma occurs in an area of memory as a dysfunction in learning and speed of information processing. The deficit is formed in the first 6-9 months after trauma and, by a certain dynamic, it resumes for many years. The results of many studies point to the importance of cognitive deficits as the main determinants of outcome in terms of lasting consequence of closed craniocerebral trauma (15, 16, 17, 18,19). As a research instrument for assessing quality of life, we used a general health questionnaire SF36. Psychometric performance and clinical validi-
ty of the questionnaire was tested in many studies. Our results showed that the outcome of acute neuroinfection has a significant impact on the quality of life of all respondents. In addition, we pointed to the importance of self-perception of health in the assessment of individual components of quality of life and the need for long-term testing and monitoring the effects of therapy and treatment on the health of this population group. Conclusion At the end of the research, among the patients who were discharged as fully recovered there was significantly more of those who were satisfied with their health, with no physical problems, and with preserved social functioning. Among respondents who were dismissed with the consequences, significantly more people were satisfied with their health, without physical health problems, limitation in physical functioning, without pain and emotional problems. We believe that a further research in this area is essential for better and more complex assessment of the impact of acute neuroinfection on health issues in relation to the quality of life. Reference
1. Nau R, Bruck W. Neuronal Injury in Bacterial Meningitis: Mechanisms and Implications for Therapy. Trends Neurosci 2002; 25: 38-45. 2. Beaman M, Wesselingh S. Acute Community-Acquired Meningitis and Encephalitis, Medical Journal of Australia 2002; 176: 389-396. 3. Namani S, Koci R, Dedush K. The Outcome of Bacterial Meningitis in Children is related to the Initial Antimicrobial Therapy. The Turkish Journal of Pediatrics 2010; 52: 354-359. 4. Čanak G. The Influence of Complications during Bacterial Meningitis in Mental and Physical Development (Doctoral dissertation). Medical Faculty; 1993 (In Serbian) 5. Doder R. The Role of Corticosteroids in the Treatment of Bacterial Meningitis (Thesis). Novi Sad: Medical Faculty; 1999 (In Serbian)
Journal of Society for development in new net environment in B&H
2231
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
6. Šašić M. The Consequences of Acute Viral Encephalitis in Childhood and Early Adulthood (Doctoral dissertation). Belgrade: School of Medicine; 1986 (In Serbian). 7. Feinsten A. Problems in Defining Quality of Life. In: Levy J, Claude J, Bez G. (Eds) Cancer, AIDS and Quality of Life. New York, London: Plenum Press; 1997.pp.11-17. 8. Weisfelt M, van de Beek D, Hoogman M, Hardeman C, de Gans J, Schmand B. Cognitive Outcome in Adults with Moderate Disability After Pnumococcal Menngitis. Journal of Infection 2006; 52: 433439. 9. Berg S, Trollfors B, Hugosson S, Fernell E, Svensson E. Long-term Follow-up of Children with Bacterial Meningitis with Emphasis on Behavioural Characteristics, Eur J Pediatr 2002; 161: 330-336. 10. Oostenbrink R, Maas M, Moons K, Mol H. Sequelae after Bacterial Meningitis in Childhood. Scand J Infect Dis 2002; 34, 379-382. 11. Raschilars F, Wolff M, Delatour F. Outcome of and Prognostic Factors for Herpes Simplex Encephalitis in Adult Patients: Results of a Multicenter study. Clin Infect Dis 2002; 35(3):254-260. 12. Hoogman M, van de Beek D, Weisfelt M, de Gans J, Schmand B. Cognitive Outcome in Adults after Bacterial Meningitis. J Neurol Neurosurg Psychiatry 2007; 78:1092-1096. 13. Legood R, Coen P, Knox K, Viner R, El Bashir H, Christie D et al. Health Related Quality of Life in Survivors of Pneumococcal Meningitis. Acta Peadiatrica 2009; 543-547. 14. Borg J, Christie D, Coen P, Booy R, Viner R. Outcomes of Meningococcal Disease in Adolescence: prospective, matched – cohort study. Pediatrics 2009; 123(3): 502-509 15. Gustaw K, Beltowska K, Makara Studzinska M. Neurological and Psychological Symptoms after the Severe Acute Neuroborreliosis. Ann Agric Environ Med 2001; 8, 91-94. 16. Wang SJ, Fuh JL, Lu SR, Juang KD. Quality of Life Differs Amnog Headache Diagnosis: analysis of SF-36 survery in 901 headache patients. Pain 2001; 89: 285-292.
17. Schmand B, de Bruin E, de Gans J, van de Beek. Cognitive Functioning and Quality of Life Nine Years after Bacterial Meningitis. Journal of Infection 2010; 61: 330-334. 18. Fazekas C, Enziger C, Wallner M, Kischka U, Greimel E, Kapller P et al. Depressive Symptoms Following Herpes Simplex Encephalitis- an Underestimated Phenomenon? General Hospital Psychiatry 2006; 28: 403-407. 19. Zdanwicz N, Lepicee B, Tordeurs D, Jacques D, Janne P, Reynaert Ch. Predictobilithy of levels of physical and mental haelth: a 6 months longitudinal study. HealthMED 2010; 4 (1): 972-77. Corresponding author Radoslava Doder, Medical Faculty, University of Novi Sad, Clinical Center of Vojvodina, The Clinic for Infectious Diseases, Novi Sad, Serbia, E-mail: radoslavadoder@yahoo.com
2232
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Polymorphism of Genes TNFα and LTα in First-Degree Relatives Suffering from Sarcoidosis-Case report
Tatjana Radjenovic Petkovic1, Tatjana Pejcic1, Tatjana Jevtovic Stoimenov2, Desa Nastasijevic Borovac1
1 2
Clinic for lung disease, Clinical Center Nis, Serbia, Laboratory for genomic and proteomic research, Medical faculty Nis, Serbia.
Abstract Introduction: Sarcoidosis is a multisystemic disease of unknown etiology. Genetic factors play a considerable role in the onset of the disease. The tumor necrosis factor α (TNFα) and lymphotoxin α (LTα) are proinflamatory cytokines which play an important part in the formation of granuloma by regulating cellular proliferation and apoptosis. The TNFα-308 and LTα+250 polymorphisms are allied with the hyperproduction of TNFα. Case report: We examine distribution of polymorphism on TNFα-308G/A and LTα+250G/A genes in mother and daughter with pulmonary sarcoidosis. Polymorphism were examined by the PCR-RFLP method on DNA isolated from the blood by the commercial kit. The examination of polymorphism on TNF and LT genes showed the presence of the polymorphous A allele in TNFα gene (heterozygot G/A) and the polymorphous LTα gene (homozygote A/A) in both patients. Conclusion: Our results show the presence of polymorphisms of genes for proinflammatory cytokines. Further research on a greater number of patients will certainly additionally exlore the importance of this type of polymorphism for the development and the clinical presentation of the disease. Key words: sarcoidosis, polymorphism, TNFα, LTα Introduction Sarcoidosis is a multisystemic disease of unknown etiology, characterized by the formation of granuloma in the affected organs. The changes
are most often localized in the lungs. However, all organs within the body can be affected (1,2). Although the etiology of the disease is unknown, it is generally considered that the genetic factors play an important role in the onset of the disease. The more frequent occurence of the disease within certain races and ethnic groups, as well as the described cases of family sarcoidosis confirm this presupposition. The tumor necrosis factor (TNFα) and lymphotoxin α (LTα) are proinflammatory cytokines which play an essentioal role in the appearance of granuloma by regulating cell proliferation and apoptosis (3). Given the fact that an increased production of TNFa during a long period od time can result in an uncontrolled inflammation and have considerable negative side effects on the body, it is necessary to control the production of this cytokine. The regulation is mostly performed on the level of transcription. TNFα and LTα genes are located on the most variable part of DNA, on the chromosomal region 6p21.3-21.1, within the highly polymorphous HLA region. Given the location, the TNFα and LTα genes themselves are associated with numerous instances of polymorphism. Depending on the location, polymorphism can result in an increased or a decreased production of TNFα in the body. Polymorphism of TNFα -308 genes occurs in two variants: -308G (TNF1) and -308A (TNF2) allele. TNF2 allele is present in the population to a much lesser extent, and it is associated with an increased production of TNF in the body. Moreover, it is often connected to numerous autoimmune and inflammatory diseases such as systemic lupus erythematosus, insulin-dependent diabetes mellitus, inflammatory bowel diseases, rheumatoid arthritis (4). The polymorphism of for LTα +250 G/A gene is inherited 2233
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
connected to the previously described polymorphism and is associated with the bad prognosis for patients with sepsis, severe types of pneumonia and other infections (5). Case report Patient M.D. (51 years of age) was admitted to our facility exhibiting the following symptoms: a persistent dry cough, joint pain and erythema nodosum. Chest radiograph showed bilateral hilar lymphadenopathy. After suspecting that the condition could be pulmonary sarcoidosis, a bronchoscopy was performed with the bronchoalveolar lavage (BAL). The BAL analysis of the cell contents showed an increased number of lymphocytes. The pathohystological results of the transbronchial biopsy showed the presence of non-caseous granuloma. Lab test results, ophtalmological test results and abdominal ultrasound were normal. The diagnosis was then confirmed. It was sarcoidosis – I radiological stage according to Scadding’s scale (6). The treatment was started with corticosteroid therapy, with the initial dosage of 0.5 mg/kg. The control check-up showed an excellent response with the both clinical improvement and radiological regression. Six months later, patient P.J. (34), the daughter of the aforementioned patient M.D. was admitted to our hospital with the following symptoms: tiredness, dyspnea, chest pain and erythema nodosum. Chest radiograph showed not only bihilar lymphadenopathy, but also bilateral reticular patterns in the lungs. A decreased capacity of diffusion (TLCO 66,3%) was registered by the functional examinations of the pulmonary function. Pulmonary sarcoidosis was suspected, and later confirmed by bronchoscopy and bronchoalveolar lavage. Lab test results, ophtalmological test results, and the abdominal ultrasound were normal. Diagnosis of sarcoidosis, radiological stage II, was confirmed. The treatment was started with corticosteroids (0.5 mg/kg). Genetic examinations: Study was approved by the ethics committee of Medical faculty, Nis (decission number 01/206/5 from 18.01.2010) and obtained written consent of the patients. Genetic tests were performed using the the patients’ perip2234
heral blood. Instances of polymorphism were examined by PCR-RFLP (polymorphism detection based on the restriction fragment length) on the DNA isolated from the blood by the commercial kit (Fermentas). By employing the correspoding primers for TNF-308 and LT +250, a part of the genes was replicated by the PCR method. The presence of PCR amplificants was checked on the agarose gel, by ethidium bromide staining. After that, the PCR amplificant was exposed to the restrictive enzyme NcoI. RFLP was detected on the vertical electrophoresis PAGE. In both patients, the examination showed the presence of the polymorphous allele A in TNFα gene (heterozygous genotype G/A) by the detection of three fragments 117, 97 i 20 bp. The examination of LTα genes showed the homozygous A/A genotype in both patients with the detection of one fragment, 782 bp long on the agarose gel. Discussion The first findings about the genetic predisposition for the development of sarcoidosis were obtained in case reports of familial sarcoidosis. First such case was described in twin sisters in 1923. Familial sarcoidosis is present in 10.3% diseased in the Netherlands (7), 7.5% in Germany (8), 5.9% in Great Britain (9) 4.7% in Finland (10), and 0,8% in Spain (11). According to the widest existing prospective epidemiological study of sarcoidosis, the ACCESS study, which included 10,862 first-degree relatives and 17,047 seconddegree relatives, 736 patients suffering from sarcoidosis in 10 medical centers in America, it was proven that there is an increased risk of having the disease in siblings of the diseased (odds ratio – 5.8, 95% relevance interval), whereas that risk is four times higher in offspring and parents of the diseased (12). According to the study by Harrington et. al., the distribution of the disease is 3.7% in Caucasian and 17% in African Americans (13). The cases of familial sarcoidosis most frequently describe a similar clinical presentation of the disease. In our case, both patients had the pulmonary sarcoidosis with erythema nodosum without spreading to other organs, with a good response to corticosteroid treatment.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
TNFα plays several important roles in the body. The production of this cytokine can result both in cell proliferation and cell destruction. In the experimantal models of granulomatous inflammation, TNFα has a key role in granuloma formation. It is maintained that TNFα has a double role in the development of sarcoidosis. On the one hand, it maintains the chronic inflammation with the clustering of the inflammed cells; on the other hand, it reduces apoptosis of T lymphocytes, which contributes to the maintenance of the granuloma. Increased values of TNFα were detected in the patients’ lavage samples (14). This is the reason why it is generally believed that this cytokine has an important role in the appearance of lymphocytic alveolitis. Polymorphism of the promoter region -308 G/A is the most commonly explored polymorphism in sarcoidosis. This polymorphism is associated with the hyperproduction of TNF (15). For this reason, it is considered to be important for the disease pathogenesis. Studies show a more frequent presence of TNFA2 variant in the patients with Löffgren syndrome and erythema nodosum (16, 17, 18), which our research has also proven. Kieszko et al. describe the connection between this type of polymorphism and a better prognosis and faster resolution, which was confirmed in the study by Wijenen et al. (19). Polymorphism of the lymphotoxin gene in the position +250 G/A has been described as a risk factor for a variety of inflammatory diseases. This type of polymorphism is inherited most commonly together with the polymorphism of the TNF gene -380 G/A and leads to the hyperproduction of TNFα, both in in vitro (20) and in vivo conditions (5), although the precise mechanism of this effect remains unknown. The patients with the polymorphous LT + 250A variant run a double risk of developing sepsis after surgical interventions (21), severe pneumonias (22) and non-Hodgin lymphoma (23). No research has been conducted to examine this type of polymorphism in sarcoidosis so far. Given the fact that data available in literature suggest that these types of polymorphism are associated with the hyperproduction of TNFα, our result could point out the important role of AA haplotype in the development of the disease.
Conclusion Research results have shown that the polymorphism of the proinflammatory cytokines TNFα and LTα gene has been detected in first-degree relatives suffering from sarcoidosis, with the homozygous variant of the LTα gene in both patients. This could highlight the role of this, otherwise rare genic variant in the disease pathogenesis. To sum up, further research on a greater number of patients will certainly additionally exlore the importance of this type of polymorphism for the development and the clinical presentation of the disease. References
1. Pejcić T, Stanković I, Rancić M, Ristić L.Bronchoalveolar lavage and pulmonary sarcoidosis. Med Pregl 2005; 58(1):11-5. 2. Pejcic T, Stankovic I, Videnovic J, et al. Sarcoidosis of breast and lung: a case report. J dis hum dev 2008; 7:111-114. 3. Liz-Graña M, Gómez-Reino J. Tumour Necrosis Factor. Genetics, cell action mechanism and involvement in inflammation. Alergol Inmunol Clin 2001; 16:140-149. 4. Kollias G, Douni E, Kassiotis G, Kontoyiannis D. The function of tumour necrosis factor and receptors in models of multi-organ inflammation, rheumatoid arthritis, multiple sclerosis and inflammatory bowel disease. Ann Rheum Dis 1999; 8:32-39. 5. Majetschak M, Flohe S, Obertacke et al: Relation of a TNF gene polymorphism to severe sepsis in trauma patients. Ann Surg 1999; 230:207-214. 6. Scadding J. Prognosis of intrathoracic sarcoidosis in England: a review of 136 cases after five years observation. BMJ 1961; 2:1165–1172. 7. Wirnsberger RM, de Vries J, Wouters EF, Drent M. Clinical presentation of sarcoidosis in The Netherlands an epidemiological study. Neth J Med 1998; 53(2):53–60. 8. Kirsten D. Sarcoidosis in Germany. Analysis of a questionnaire survey in 1992 of patients of the German Sarcoidosis Group. Pneumologie 1995; 49(6):378–382.
Journal of Society for development in new net environment in B&H
2235
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
9. McGrath DS, Daniil Z, Foley P, et al. Epidemiology of familial sarcoidosis in the UK. Thorax 2000; 55(9):751–754. 10. Pietinalho A, Ohmichi M, Hirasawa M, Hiraga Y, Lofroos AB, Selroos O. Familial sarcoidosis in Finland and Hokkaido, Japan—a comparative study. Respir Med 1999; 93(6):408–412. 11. Fite E, Alsina JM, Anto JM, Morera J. Sarcoidosis: family contact study. Respiration 1998; 65(1):34–39.
20. Messer G, Spengler U, Jung MC, et al. Polymorphic structure of the tumor necrosis factor (TNF) locus: an NcoI polymorphism in the first intron of the human TNF-beta gene correlates with a variant amino acid in position 26 and a reduced level of TNF-beta production. J Exp Med 1991; 173:209-219. 21. Stuber F: A genomic polymorphism within the tumor necrosis factor locus influences plasma tumor necrosis factor-α α concentrations and outcome of patients with severe sepsis. Crit Care Med 1996; 24:381-384. 22. Waterer GW, Quasney MW, Cantor RM, Wunderink RG: Septic shock and respiratory failure in community-acquired pneumonia have different TNF polymorphism associations. Am J Resp Crit Care Med 2001; 163:1599-1604. 23. Jevtovic-Stoimenov T, Kocic G, Pavlovic D et al. Polymorphisms of tumor-necrosis factor-alpha 308 and lymphotoxin-alpha + 250: possible modulation of susceptibility to apoptosis in chronic lymphocytic leukemia and non-Hodgkin lymphoma mononuclear cells.Leuk Lymphoma 2008; 49(11):2163-9. Corresponding autor Tatjana Radjenovic Petkovic, Clinic for lung disease, Clinical Center Nis, Serbia, E-mail: tatjanarp@gmail.com
12. Rybicki B. Familial Aggregation of Sarcoidosis. A case control etiologic study of sarcoidosis (ACCESS). Am J Resp Crit Care 2001; 164 (11):20852091. 13. Harrington D, Major M, Rybicki B, Popovich J Jr, Maliarik M, Iannuzzi MC. Familial analysis of 91 families. Sarcoidosis 1994; 11:240–243. 14. Losa Garcia JE, Rodriguez FM, Martin de Cabo MR, et al. Evaluation of inflammatory cytokine secretion by human alveolar macrophages. Mediators Inflamm 1999; 8(1):43–51. 15. Wilson AG, Symons JA, McDowell TL, McDevitt HO, Duff GW. Effects of polymorphism in the human tumor necrosis factor alpha promoter on transcriptional activation. Proc Natl Acad Sci USA 1997; 94(7):3195–3199. 16. Seitzer U, Swider C, Stuber F, et al. Tumour necrosis factor alpha promoter gene polymorphism in sarcoidosis. Cytokine 1997; 9:787–790. 17. Kieszko R, Krawczyk P, Chocholska S, Dmoszyńska A, Milanowski J. TNF-alpha and TNFbeta gene polymorphisms in Polish patients with sarcoidosis. Connection with the susceptibility and prognosis. Sarcoidosis Vasc Diffuse Lung Dis 2010; 27:131-137. 18. McDougal K, Fallin D, Moller D, et al.and the ACCESS Research Group. Variation in the Lymphotoxin-a/Tumor Necrosis Factor Locus Modifies Risk of Erythema Nodosum in Sarcoidosis. Journal of Investigative Dermatology 2009; 129:1921–1926. 19. Wijnen PA, Nelemans PJ, Verschakelen JA, Bekers O, Voorter CE, Drent M. The role of tumor necrosis factor alpha G-308A polymorphisms in the course of pulmonary sarcoidosis. Tissue Antigens 2010; 75(3):262-8.
2236
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Effects of swimming training on body composition and bone mineral density of prepubertal boys
Dejan Madic1, Dusan Maric2, Borislav Obradovic1, Jelena Obradovic1, Franja Fratric3, Veselin Buncic3, Boris Popovic1, Dusanka Tumin1, Jan Varga2, Milan Pantovic1
1 2 3
University of Novi Sad, Faculty of Sport and Physical Education, Serbia, University of Novi Sad, Faculty of Medicine, Serbia, University EDUCONS, Novi Sad, Serbia.
Abstract Introduction: It is widely recognised that physical activity has an anabolic effect on bone tissue. However, due to the insufficient information, the exact effect of intensive physical activity in childhood, especially in the prepubescent stage, still remains obscure. It is, therefore, necessary to determine the factors that best produce desired increases in mass and strength of human bones, such as the type, frequency, intensity and duration of the activity. Methods: A group of prepubertal boys was observed in order to examine the effects of swimming training to body composition and bone mineral density. These boys were at the starting point of the peak phase of bone mass developement. The group consisted of 58 healthy prepubecent boys, 28 of whom were swimmers (aged 10.8±0.8) and had been practising for 1 year. This was a high level sport training of 10 - 12 hours per week. The other 30 boys were the control group (aged 11.2±0.7) who performed 1.5 hours per week of physical activity at school. Body Fat Analyser “BES 200 Z” was used in order to evaluate body composition and an ultrasound densitometer “Sahara” was used to measure bone mineral density of the left and right calcaneus. Results: The findings indicate a significant difference between the two groups in respect of the fat mass (p<.03). However, the differences in bone mineral density were not so apparent (p<.67). Conclusion: Kinesiological treatment in swimming, as the results of the study show, is not ef-
fective in terms of indecreased bone mineral density parameters. Key words: body composition, bone mineral density, prepubescent boys, swimmers. Introduction It is a fact that physical activity contributes to building tissue, even though it is still relatively obscure. Even a moderate physical activity in everyday life produces a significant anabolic stimulus (Eliakim & Beyth, 2003). Since muscular contractions produce the highest loads on the skeleton,the bone accommodates to these loads in order to preserve its structural and functional role in the skeleton and eventually prevent injuries and fractures (Frost, 1987, 2000). Therefore, it is not only the persons who practice sports seriously, i.e. persons who increase their muscular power and functional endurance by means of training, that experience these anabolic effects. Any kind of change in activity has an effect on bone tissue. A complete immobilization of extremities or lack of mechanical load, i.e. gravity force (i.e. weightlessness) (Anderson & Cohn, 1985) results in the loss of the bone tissue. However, as soon as exercises are continued the number of new bone cells rises considerably (Marcus, 1996). This fact supports a popular conclusion that the production of new cells, and subsequently bone density, is directly related to physical activity. Reaching maximal bone mass in childhood and adolescence is a key determinant of a healthy skeleton in adult age (Rizzoli 2237
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
& Bonjour, 1999). Unfortunately, the sedentary life that has become increasingly present with the youth and inappropriate attitudes towards training and practicing of physical activities are typical prerequisites for obesity (Pampakas, Mszros, Kirly, Szmodis, Szakly, Zsidegh, 2008; Madic, Mikalacki, Popovic, 2008 and Obradovic, Milosevic, Srdic, 2007). Children are nowadays much more devoted to activities such as watching television or sitting in front of a computer at the expense of physical activity (Andersen, Crespo, Bartle, Cheskin & Pratt, 1998). Such lifestyle may lead to a decrease in bone mass with the final consequence of reduced maximal bone mass which is a significant risk factor of involutive osteoporosis (Javaid & Cooper, 2002). Therefore, bone mass obtained in childhood is a key determinant of healthy bones during the latter age. Determining the moment of the bone mass development, hence proves to be an important step in prevention of osteoporosis. Though there is no consensus regarding the age when maximal bone mass is developed (Nguyen, Maynard, Towne, Roche, Wisemandle; Recker, Davies, Hinders, Heaney, Stegman, Kimmel, 1992; Matkovic, Jelic, Wardlaw, Ilich, Goel; Wright, et al., 1994), a significant amount of bone minerals is accumulated during adolescence (Bailey, McKay, Mirwald, Crocker & Faulkner, 1999). According to a number of research works, physical activity is an important factor in the struggle against osteoporosis, especially in certain sensitive stages of the human biological development. One of the most sensitive periods during which properly executed physical exercises, in addition to other factors related to occurrence and development of osteoporosis can reduce the risk of the disease in the latter age is definitely prepubertal age. Character, type, scope, intensity and topological determination of physical activities being applied are very important, and govern efficiency of physical exercises on bone density. Accordingly, the following analysis deals with differences in bone mass of prepubertal boys being engaged in physical activity (swimming) for a number of years and those not engaged in any sport. Physical activities can differ according to many aspects such as: - Functional aspect – presence of aerobic and anaerobic loads during performance of physical activities; 2238
-
-
Motor aspect – kinds, actional and topological determination of motor abilities in manifestation of specific motion activities for a particular activity; Biomechanical – fluid in which particular motion activities are performed as well as mechanical stress to which skeleton and musculature of an exerciser are subjected.
In order to provide more information on subjects and specific effects of physical activity (swimming training) on their anthropological status, certain parameters of their body composition are also assessed; accordingly this analysis might provide additional arguments for eventual differences in bone density. The aim of this study was to determine the effects of swimming training, as a non-weight bearing activity, on body composition and bone mineral density among prepubertal boys. Recent studies indicate different findings concerning beneficial effects of this kind of physical activity to bone mineral density. Material and methods Testing included 58 subjects as follows: 1) boys subjected to a specific kinesiological treatment in swimming (28 subjects) and 2) boys not engaged in any physical activity in an organized or systematic manner (30 subjects). The group of swimmers consists of 28 boys at the age of 10.8±0.8, Tanner stage II1, who were engaged in a selected physical activity for at least one year (Tanner & Taylor, 1965). The group of swimmers had trainings of 10-12 hours on weekly basis.
1 Puberty is divided into five stages, called Tanner Stages (numbered 1-5). Tanner stage II is prepubertal stage which defines following physical measurement of development: small amount of long, downy hair with slight pigmentation at the base of the penis and scrotum, testicular volume between 1.6 and 6 ml, skin on scrotum thins, reddens and enlarges. This age is not characterized by hormone changes due to puberty, while sex hormones are at puberty level. It is assumed that sex hormones at this age do not have a significant role in forming bone tissue, thus the conditions are the same for all tested children.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
The group of non-sportsmen consists of 30 boys at the age of 11.2±0.7, Tanner stage II, who were not engaged in active sport. The principal criteria for including a subject to this study were: 1) age, 2) sex, 3) sport history (minimum one year of active sports occupation, i.e. training) and 4) absence of diseases and states yielding secondary effects on metabolism of bones. The study was approved by the Faculty of sports and physical education at the University of Novi Sad. The trainers/coaches and players parents received verbal and written information about the study and gave their acceptance before the investigation. Assessment of body composition is carried out by measuring bioelectrical impedance (BI). Body composition is assessed by Body Fat Analyser “BES 200 Z” (Bioelectrical Sciences, Inc., La Jolla, CA, USA). BI measuring is carried out by placing four small electrodes on hand and foot of the subject lying on his back. The instrument for testing bioelectrical impedance, which is connected to the two pairs of electrodes, measures resistive and reactive resistance of the subject from his/her hands to ankles, at 50 KHz. These values are converted to a parallel resistance and reactance in order to be used for calculating parameters of body composition in conjunction with body height, mass and sex. Rather weak electric current passes through the right side of the subject, including his/her arm, trunk, and leg. The voltage of this current is very low (less than 800 μA). BI test can be performed whenever necessary without any adverse consequences. Measurement values of resistance and reactance are used for calculating total water amount in the body, lean body mass and total body mass. In order to get the most possible precise and valid data, this testing is carried out according to proper standards for determination of body composition, i.e. for measurement of the above variables. Measurement is performed in the early morning hours prior to taking any liquid or food. Mineral bone density is tested by clinical sonometer “Sahara” (Hologic, Inc., MA, USA). During measurement, the subject is sitting on the fixed chair with a back and arm rests at the height of 41 to 46 cm from the floor. The distance between the subject and scanner should be 30 to 46 cm. The
measured foot must be fully free of any footwear and socks. The subject puts his/her foot on the proper place. Middle line of his/her heel must be positioned exactly on the centre of the heel rest. Foot must be positioned properly such that the control line overlaps the distance between the second and third toe. Lower leg (shank) of the subject is placed at the same angle as the auxiliary part. The auxiliary part is placed in such a way that it is not fully connected with the leg, but at the two-finger distance away. The position of the lower leg is adjusted according to the angle of the auxiliary part by moving the whole apparatus (scanner and the lower leg must be in contact). The lower leg of the subject must be positioned straight (in relation to the auxiliary piece), after which the auxiliary part is moved in such a manner that it is in tight contact with the lower leg. When the auxiliary part is in the tight contact with the lower leg, it is additionally fixed by a strap placed around the lower leg. Check whether the subject is sitting straight, leaning against the back of the chair with his/her hands on upper legs (thighs). The subject must feel comfortable, and he/she must keep still during the measurement. Prior to measurement, double check whether the heels are positioned properly on the heel rest. After the measurement, lasting for about ten seconds, the foot of the subject is released. Body composition and bone density in this research are represented by seven characteristics as follows: three measures for evaluation of body composition and four measures for evaluation of skeletal status, i.e. bone density. Measures for evaluation of body composition include: 1) total body water (TBW) [l], 2) lean body mass (LBM) [kg] and 3) fat mass (FAT) [kg]. Bone density of subjects is evaluated on the basis of the following measures: 1) broadband ultrasound attenuation of left calcaneus (BuaL) [dB/ MHz], 2) broadband ultrasound attenuation of right calcaneus (BuaR) [dB/MHz], 3) speed of sound - left calcaneus (SosL) [m/s] and 4) speed of a sound - right calcaneus (SosR) [m/s]. The statistical procedures were calculated using SPSS (SPSS Inc., Chicago, USA, version 10.0) for personal computer. Differences in the applied variables of bone density and body composition between swimmers which engaged in se2239
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
veral-year-long activities and those who were not engaged in physical activities, were analyzed by multivariant analysis of variance and t-test. In addition, parameters of the data distribution were also calculated (skewness and kurtosis) as well as normality by Kolmogorov-Smirnov’s test (KS). Results According to the values of the central and dispersion statistical parameters, as well as normality parameters of data distribution curve presented in Table 1, it may be observed that the data distribution of all applied variables in this research do not show statistically significant deviation from the normal distribution, at the significance level of 0.01. A slightly higher asymmetry of data distribution curve was observed in distribution of the variable for evaluation of body fat (FAT), so that a higher number of subjects had lower values of this body composition component in relation to the mean value of the whole sample. The mentioned groups of subjects showed statistically significant multivariate differences in the applied system of variables at the significance level of 0.02 (Wilks' Lambda = 0.728). Table 2 shows that applied kinesiological treatment in swimming had a statistically significant effect on reduction of body mass in terms of decreased total fat content. On the other hand, the above kinesiological treatment did not statistically affect increase of the total quantity of lean body mass and increase of bone density.
Table 2. Effects of kinesiological treatment in swimming on parameters of body composition and bone mineral density (t-test)
t TBW LBM FAT BuaL BuaR SosL SosR .56 1.231 -2.240 1.793 .513 1.867 .970 p .256 .224 .029 .078 .610 .067 .336
Discussion and conclusions Kinesiological treatment (swimming training) had a significant effect on reduction of body fat while there were no differences of lean body mass and total body water among subjects. Similar results were reported by other researcher where individuals engaged in high-intensity chronic training for swimming do not have augmented bone mineral even though they have a more favorable body composition, with increased lean mass and decreased fat mass, compared to their peers (Taaffee24). Swimming is considered as a repetitive, nonweight bearing sport. The activity pattern of swimmers training comprises a lot of pulley workouts with small weights and high number of repetitions. Yet it has been proposed to provide skeletal benefits, at least in men. Swimming might be an osteogenic mode of exercise in men (Orwoll21). Results of our study indicate that kinesiological treatment in swimming is not effective in terms of indecreased bone mineral density parameters. Although the differences concerning bone mineral density parameters (BuaL, SosL) were not
SD 25.2037 5.98624 3.85815 13.31324 13.34206 28.03196 29.87497 Skewness 4.03595 .512 0.560 .956 1.499 .864 .763 Kurtosis 1.380 -.358 -1.189 1.992 3.711 1.284 .889 KS .612 .362 .054 .485 .078 .736 .609
Table 1. Principal descriptive statistical data and normality distribution of the applied variables
TBW LBM FAT BuaL BuaR SosL SosR Min 22.50 25.50 2.00 31.10 31.00 1515.60 1521.90 Max 18.40 50.90 13.60 104.10 108.40 1671.70 1675.30 Mean 40.90 35.1467 6.6090 53.8867 54.8633 1572.496 1574.632
2240
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
significant (.078, .067), these results could derive due to elasticity and microstructure that could be detected by quantitative ultrasound method (Falk, Bronshtein, Zigel, Constantini & Eliakim, 2004). Although some studies explain the negative effect of doing high volumes of swimming on bone mineral density (7, 11, 19) we did not determine any deleterious effects on bone for the swimmers group. It has been determined that kinesiological treatment in swimming had specific efficiency on one parameter of body composition. Conversely, bone mineral density parameters were not affected by the treatment. It is obvious that kinesiological treatment in swimming plays a very important role for obtaining favorable body composition instead for bone mineral density of prepubertal boys. This research, dealing with one of the most sensitive stages of biological development (prepubertal age), provides contribution to the study of effects of swimming training in the meaning of positive transformation of anthropological status and achieving better health and life quality of mature age. Results of this research are important as they confirm that swimming as a non-weight bearing activity had no effect on bone density. Yet, it is a good instrument against obesity. Acknowledgements We wish to thank all the people who voluntarily took part in the research without whom this study and its finding would not be possible.
References
1. Andersen, R.E., Crespo, C.J., Bartle, S.J., Cheskin, L.J., & Pratt, M. (1998). Relationship of physical activity and television watching with body weight and level of fatness among children: results from the Third National Health and Nutrition Examination Survey. JAMA, 12, 938 – 942. 2. Anderson, S.A, & Cohn, S.H. (1985). Bone demineralization during space flight. Physiologist, 28, 212. 3. Bailey, D.A., McKay, H.A., Mirwald, R.L., Crocker, P.R., & Faulkner, R.A. (1999). A six-year longitudinal study of the relationship of physical activity to bone mineral accrual in growing children: the university of Saskatchewan bone mineral accrual study. J Bone Miner Res, 14, 1672–1679. 4. Eliakim, A., & Beyth, Y. (2003). Exercise training, menstrual irregularities and bone development in children and adolescents. J. Pediatr Adolesc Gynecol, 16, 201–206. 5. Falk, B., Bronshtein, Z., Zigel, L., Constantini, N., & Eliakim, A. (2004). Higher tibial quantitative ultrasound in young female swimmers. Br J Sports Med, 38, 461-465. 6. Fehling, P.C., Alekel, L., Clasey, J., Rector, A., & Stillman, R.J. (1995). A comparison of bone mineral densities among female athletes in impact loading and active loading sports. Bone, 17, 205-210. 7. Frost, H. (1987). Bone ‘‘mass’’ and the ‘‘mechanostat’’: a proposal. Anat Rec, 219, 1–9. 8. Frost, H. (2000). Muscle, bone, and the Utah paradigm: a 1999 overview. Med Sci Sports Exer, 32, 911–917. 9. Grimston, S.K., Willows, N.D., & Hanley, D.A. (1993). Mechanical loading regime and its relationship to bone mineral density in children. Med Sci Sports Exerc, 25, 1203-1210. 10. Javaid, M.K., & Cooper, C. (2002). Prenatal and childhood influences on osteoporosis. Best Pract Res Clin Endocrinol Metab, 16, 349–367. 11. Madic, D., Mikalacki, M., & Popovic, B. (2008). Effects of the traditional and modern approach to physical education on obesity of girls at younger school age. International Symposium Research and Education in Innovation Era 2008 (pp. 577582). Arad: University “Aurel Vlaicu”.
Journal of Society for development in new net environment in B&H
2241
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
12. Marcus, R. (1996). Mechanisms of exercise effects on bone. In J.P. Bilezikian, L.G. Raisz & G.A. Rodan (Eds), Principles of Bone Biology (1st ed.) (pp. 1135–1146). San Diego, CA: Academic Press. 13. Matkovic, V., Jelic, T., Wardlaw, G.M., Ilich, J.Z., Goel, P.K., & Wright, J.K. (1994). Timing of peak bone mass in Caucasian females and its implication for the prevention of osteoporosis. Inference from a cross-sectional model. J Clin Invest, 93, 799–808. 14. Nguyen, T.V., Maynard, L.M., Towne, B., Roche, A.F., & Wisemandle, W. (2001). Sex differences in bone mass acquisition during growth: the Fels Longitudinal Study. J Clin Densitom, 4, 147–157. 15. Nichols, J.F., Spindler, A.A., LaFave, K.L., & Sartoris, D.J. (1995). A comparison of bone mineral density and hormone status of periadolescent gymnasts, swimmers, and controls. Med Exerc Nutr Health, 4, 101-106. 16. Obradovic, B., Milosevic, Z., & Srdic, B. (2007). Status uhranjenosti decaka starijeg skolskog uzrasta. [Nutritional status of boys in older school age] In G. Bala (Ed), Antropological status and physical activity of children, youth and elderly.pp. 89-95) Novi Sad: Facylty of sport and physical education. 17. Orwoll, E.S., Ferar, J., Oviatt, S.K., McClung, M.R., & Huntington, K. (1989). The relationship of swimming exercise to bone mass in men and women. Arch Intern Med, 149, 2197-2200. 18. Pampakas, P., Mszros, Z., Kirly, T., Szmodis, M. B., Szakly, Z. & Zsidegh, M. (2008). Longitudinal differences and trends in body fat and running endurance in Hungarian primary schoolboys. Anthropologischer Anzeiger, 66 (3), 317-326. 19. Recker, R.R., Davies, K.M., Hinders, S.M., Heaney, R.P., Stegman, M.R., & Kimmel D.B. (1992). Bone gain in young adult women. JAMA, 268, 2403–2408. 20. Rizzoli, R., & Bonjour, J.P. (1999). Determinants of peak bone mass and mechanisms of bone loss. Osteoporos Int Suppl, 2, 17–23. 21. Taaffe, D.R., & Marcus, R. (1999). Regional and total body bone mineral density in elite collegiate male swimmers. J Sports Med Phys Fitness, 39, 154-159. 22. Tanner, J.M. & Taylor, G.R. (1965). Growth. Austin: The University of Texas at Austin - Life Science Library.
23. Muftić, O., Kudumović, Dž., Kudumović, L., Biomedical engineering: principles and Challenges, HealthMED – vol. 3, no. 4, 2009, pp. 420 – 427. 24. Radjo I, Mahmutovic I, Manic G, Mahmutovic I. Structure of the ontogeny of the morphological indicators of boy aged from 11 to 14, HealthMED – vol. 5, no. 4, 2011, pp. 942 – 949. 25. 25. Stojisavljevic D, Jusupovic F, Mirilov J, Danojevic D, Jandric LJ, Kristoforovic –llic M, Kudumovic M. Environment impact to the health behavior of schoolchildren. HealthMED 2009;3:149154 Corresponding author Dejan Madic, University of Novi Sad, Faculty of Sport and Physical Education, Serbia, E-mail: dekimadic@yahoo.com
2242
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Recommended INR Values for Performing Oral-surgical Interventions
Naida Hadziabdic1, Halid Sulejmanagic2, Midhat Haracic3, Rifka Rizvanbegovic3, Vesna Basic3, Nedim Sulejmanagic2, Ziba Ljutovic1
1 2 3
Department of Oral Surgery, Faculty of Dental Medicine, University of Sarajevo Bosnia and Herzegovina, Private Dental Practice “Sulejmanagić“, Sarajevo, Bosnia and Herzegovina, Federal Institute for Transfusion Medicine Bosnia and Herzegovina.
Abstract Introduction: Patients on oral anticoagulant therapy must be under continuous laboratory control including INR value. If INR values are under therapeutic, there is increased risk of thrombosis, and if higher, prolonged bleeding can occur after oral-surgical intervention. Objectives: Establishing INR value range safe for oral-surgical interventions find evidence whether modification1* of anticoagulant therapy, can enable a successful surgical intervention. Study Design: The control sample comprises 101 patients on oral anticoagulant therapy. On basis of the calibrated INR value, and in agreement with transfusiologist a decision was brought whether anticoagulant therapy was to be continued with the same dosage, reduced or even excluded one day prior to the intervention. Results and conclusion: Clinical results and statistical analyses showed that in case INR values range between 2,5-3,5 the oral anticoagulant therapy is not to be discontinued prior to the bloodprovoking dental intervention. Key words: INR, oral anticoagulants, oral surgery Introduction Currently, modern medicine recognizes INR – International normalised ratio as the sole valid la1 Modification of anticoagulant therapy means reduction or discontinuation of the medication dose one day prior to the intervention.
*
boratory value in monitoring the effects of anticoagulant therapy. All patients who receive oral anticoagulant therapy must have their INR tested, at least on a monthly basis. On the basis of the obtained values, the doctor must bring a decision on the daily medication dose for each day, respectively. The obtained values of Prothrombin Time in procentages ( %) and INR are recorded in special medical cards along with the recommended medication dose for each consecutive day in week. The patient must heed the recommended therapy until the next check-up when the medication therapy is altered in accordance with the newly obtained INR values. The aim of the medication therapy is to keep the INR values within the acceptable bounds, and thus prevent any thromboembolic complications. Simultaneously, although anticoagulant therapy prevents blood clotting there is an increased risk of bleeding, particularly after blood-provoking surgical interventions. The question being raised at this point is how to treat patients on anticoagulant therapy who must undergo an oral-surgical intervention.1 The traditional approach to the above question implied the discontinuation of anticoagulant therapy prior to any oral- surgical intervention, including tooth extraction. Nevertheless, in the relevant literature on this issue there is no evidence that severe bleeding in patients on anticoagulants such as warfarin, is a result of oral- surgical intervention. On the other hand, several cases have been described registering embolic complications in patients who had warfarin therapy discontinued prior to the oralsurgical intervention. 2243
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
In Wahl's study 2 it is emphasized that continual warfarin therapy is beneficial in preventing various medical complications, including thromboembolia. Therefore, it is necessary to bring a decision whether to continue or discontinue anticoagulant therapy in patients who must undergo an oral -surgical intervention. Out of 526 who had anticoagulant therapy discontinued, five patients suffered serious tromboembolic complications, while four patients died. Finally, we may conclude that serious thromboembolic complications, including death, are three times more common in patients whose anticoagulant therapy had been discontinued than bleeding which occurs in patients who continue to be on anticoagulant therapy.2 Many dentists are scared of performing minor surgical intervention in such patients because of bleeding risk. The current scientific findings indicate that the risk of tromboembolia is three to five times higher in patients who have their anticoagulant therapy discontinued than the risk of bleeding which, by contrast, cannot be treated by applying local therapeutic measures.3 Anticoagulant therapy has been administered for half a century in order to reduce tromboembolia risk and prolong life of thousands of patients. Many doctors recommend discontinuation of anticoagulant therapy prior to the oral-surgical intervention in order to prevent haemorrhage. Nevertheless, there appears to be no evidence of severe bleeding after the oral-surgical intervention in patients who are on continuous warfarin sodium therapy, but serious embolic complications have been registered in patients when warfarin sodium therapy has been discontinued during the oral surgical intervention.1 The aim of the study conducted by Darens and his associates4 was to establish the Protocol for tooth extraction in patients who receive vitamin K antagonists without correction of the therapy in case INR value apperas to be below 2,8. Out of 96 patients who receive vitamin K antagonists 1004 extractions have been performed in the nine-month period. The extractions were performed as long as the INR value did not exceed 2,8. By contrast, the therapy was altered until the desired INR value was obtained.The extractions were performed by applying the local anaesthetic and resorbable hemostatic gauze.4 2244
The findings of the above study have also shown three cases of post-operative bleeding. In one case the revision of alveolus with local application of tranexamic acid had to be performed, while in the other case the biological glue was to be applied. In the research conducted by Scully and Wolf, it is emphasized that in recent years several approaches to treatment of such patients have been adopted: in most cases anticoagulant therapy is not discontinued while oral-surgical interventions are performed regardless of the fact that the laboratory values indicate to considerable proneness to bleeding, but new efficient local measures are applied in prevention of bleeding. The patients who run a serious risk of post-operative complications are recommended for hospital treatment.5 In their conclusions they stated that several factors should be taken into consideration in the oral-surgical treatment of patients on anticoagulant therapy, and these factors are as follows: scope and urgency of oral-surgical intervention, laboratory values, available means, the dentist's experience and oral/medical status of a patient.5 According to Webster and Wilde 6 there are variations in the treatment of patients with the artificial valves on anticoagulant therapy who must undergo an oral-surgical or maxillofacial intervention. In their study the said authors have proposed a pragmatic, practical approach with regard to adapting the anticoagulant therapy depending on the degree of surgical trauma or the thromboembolia risk. For minor surgical interventions there is no need for alteration of the anticoagulant therapy, provided the INR value is lower than 4,0 and in case tranexamic acid is applied for mouth rinsing as a measure of local hemostasis. In most surgical interventions, warfarin is discontinued prior to intervention and replaced by low-molecular heparins. In urgent surgical interventions anticoagulants are partly discontinued, while low dose K vitamin is administered parenterally.6 On the basis of data provided by different sources, Schardt and Sacco believe that there appears to be disagreement on methods of treating patients on anticoagulant therapy such as coumadin prior to oral- surgical intervention. Some authors are in favour of continuation of coumadin therapy, along with the application of local measures in bleeding control, while others are in favour of
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
discontinuing the coumadin therapy prior to intervention. The third group of authors are in favour of substituting coumadin by heparin therapy.7 There are no available references in the literature to support either of the aforementioned attitudes nor a sufficient number of case studies with clearly measureable results.7 Jeske and Suchko 8 point to the fact of an increasing need for education of dentists in this particular area apart from practising doctors who, most commonly, administer anticoagulant therapy. The experience has taught us that practising doctors very often decide on discontinuing the anticoagulant therapy prior to oral-surgical interventions without good reason, applying the same rationale as in typical surgical, orthopedic or other interventions. Added to this, is the fact that dentists are not familiar with the latest findings in the relevant literature on this particular problem. There also appears reluctance on part of dentists to consult general practioners in respect of the said problem. Of course, some patients voluntarily get off the anticoagulant therapy even before non-invasive dental interventions, such as radiographic scanning, for fear of severe bleeding. The question, we need to raise at this point, is why we should run a risk by discontinuing anticoagulant therapy when this decision can prove life-threatening?! Is there a way of reaching a compromise solution instead of opting either for discontinuation of anticoagulant therapy or its continuation during the oral-surgical interventions? What is the most appropriate timing for INR control (should it be on the day of the intervention?) What are the so-called «safe» values of INR which remove a thromboembolia risk by simultaneously providing the appropriate conditions for prevention of severe bleeding ? These are the issues which need to be addressed and, consequently, we should establish a unique doctrine in treating patients on anticoagulant therapy. Aims Establish the INR value range which is safe for successful performance of oral- surgical interventions without fear of excessive haemorrhage and without danger of thromboembolia.
Find evidence whether modification of anticoagulant therapy one day prior to the intervention can enable a successful surgical intervention such as the tooth extraction. Patients and methods This study was approved by the local ethics Institutional Review Board, and each patient provided written informed consent to participate. Also, in this study principles of Helsinki Declaration were followed. The control sample used in this study comprises 101 patients. The majority of patients in the sample have the artificial valves built in. All patients were on oral anticoagulant therapy (etilbiscumacetat, acenocumarol, warfarin). Each patient who came to the Institute of Transfusiology for a routine control of INR was sent to the Oral Surgery department of the Faculty of Dental Medicine in Sarajevo where he was submitted to a comprehensive dental examination. At the same time, it was established whether there was any need for tooth extraction or ultrasonic scaling. The Questionnaire list was filled in after the examination. In cases when a need for blood-provoking intervention was established (such as the tooth extraction, minor operation or ultrasonic scaling) it would be suggested to the patient to undergo such an operation. Each patient, who agreed with the suggested proposal, was sent to the Institute for Transfusiology where he had his/her INR calibrated. After obtaining the INR value the patient would return to the Oral Surgery Department where a decision was brought whether there was a pressing need to modify the anticoagulant therapy prior to the blood-provoking intervention, after consultations with the transfusiologist. At this, three options were considered: - Anticoagulant therapy was to be continued with the same dosage - Anticoagulant therapy was reduced one day prior to the blood-provoking intervention - Anticoagulant therapy was excluded one day prior to the blood-provoking intervention 2245
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Local hemostasis was implemented by applying a biological agent for stopping bleeding, or by the surgical suture. The hemostasis control was undertaken 30 minutes after the intervention. Digital camera was used to take shots in cases of prolonged bleeding. Venues of research: The Institute of Transfusiology of the Federation of Bosnia&Herzegovina and the Oral Surgery Clinic of the Faculty of Dental Medicine in Sarajevo. Results Clinical examination was undertaken to establish if there were any indications for tooth extraction.In this way the state of oral health of the examined patients was assessed. Consequently, out of the total number of the examined patients we made a diagnosis in 76 patients (75%) that extraction of one or more teeth was indispensable. In the remaining 25 patients (25%) we did not diagnose a need for extraction (Table 1. and Figure 1.). Table 1. Need for tooth extraction
Tooth extraction Absence of tooth extraction Number of patients 76 25 % 75% 25%
our standards it implies to have more than 3 teeth extracted. Table 2. Need for tooth extraction with regard to their respective number
1 tooth 2 teeth 3 teeth More than 3 teeth Number of patients 29 10 5 32 % 38% 13% 7% 42%
Figure 2. Need for tooth extraction with regard to their respective number The INR values in blood-provoking interventions, most commonly, tooth extraction or ultrasonic scaling, ranged from 0,96-3,99. At this, prolonged bleeding was registered in some patients as an unwelcome outcome of the said dental interventions.
Figure 1. Need for tooth extraction The total number of 76 patients diagnosed to have tooth extraction, were categorized into groups according to a number of teeth ( 1,2,3 or more) ( Table 2. and Figure 2.). The tabelar and graphic surveys clearly indicate that the greatest number of patients, i.e. 32 (42%) were diagnosed to have several teeth extracted.By 2246
Figure 3. INR values in blood-provoking interventions without any complications with regard to prolonged bleeding Hence, the so called „sensitive“ INR values were 3,99; 3,45 and 2,3, respectively. Figure 4. shows the so called „ safe INR values “ wherein dental intervention was performed free of any complications.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Figure 5. Peroral hematome
Figure 4. Pathological coagulum What comes next is a descriptive and graphical account of two cases when bleeding occurred after blood-provoking dental intervention: Patient Z.B., born in 1947, came to have the remaining tooth root ( No 33) extracted. From the case history we found that he had the mitral and aortal valves built in. He had been on anticoagulant therapy (4mg acenocumarol) for 13 years. The INR value on the day prior to the extraction was calibrated as 2,40. An hour preceding the intervention we applied 600mg Clyndamicin and extracted the root with local anaesthesia.The INR value was calibrated again, but this time it amounted to 3,40. In hemostasis control we applied the biological agent for stopping bleeding and sent the patient home. The next day the said patient came to us complaining of bleeding from the extraction wound which occurred in the evening hours on the day of extraction. By clinical examination we established the pathological coagulum with peroral haematoma by the side of extraction (Figure 4. and Figure 5).With local anaesthesia the wound was cleansed, sown and protected by the iodoform gauze bag (Figure 6.) Anticoagulant therapy was discontinued for one day. Next days the patient was to come for regular check-ups to monitor the wound healing.
Figure 6. Iodoform gauze bag The example of the next patient shows that prolonged bleeding may occur after ultrasonic scaling intervention as well.The patient M.B.,born in 1945, who was on anticoagulant therapy for 24 years after he had had the mitral valves built in, underwent the ultrasonic scaling. At this, the calibrated INR value amounted to 3,99. The next day the patient returned complaining of excessive bleeding from gingiva, which was later confirmed by clinical examination (Figure 7 and Figure 8). Again, we attempted to stop bleeding by applying the iodoform gauze, but this time it proved to be inefficient ( Figure 9 ). After that, we applied Coe Pack paste which also proved to be impractical (Figure 10). Finally, bleeding was successfully stopped by applying thermocoagulation (Figure 11).
Journal of Society for development in new net environment in B&H
2247
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
in a great number of patients, but also that their respective INR values ranged either below or around therapeutically acceptable values.
Figure 7. Bleeding from gingiva ( mouth open)
Figure 10. Coe pac paste application
Figure 8. Bleeding from gingiva (mouth closed)
Figure 11. Day after thermocoagulation Most authors agree that therapeutically acceptable INR values in patients with heart valves built in, amount to 2,5-3 or 2,5-3,5., respectively. Due to the aforementioned reasons all patients within the examined sample were cathegorized into 2 groups: - Anticoagulant therapy was continued with the same dosage (77 patients) - Anticoagulant therapy was either discontinued or reduced one day prior to the intervention (24 patients). In respect of prolonged bleeding after bloodprovoking intervention, by statistically analysing the two examined groups we established that in statistical terms there was no considerable difference: p>0,05, χ2 = 0,29 (Figure 12.).
Figure 9. Attempt of iodoform gauze application One of the aims of this research was to ascertain whether a successful oral-surgical intervention such as tooth extraction, can be performed by modifying anticoagulant therapy one day prior to the intervention. In the process of sample collection we observed hypodosage of anticoagulant therapy 2248
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Figure 12. Emergence of prolonged bleeding after blood-provoking intervention In practical terms it would imply that very often there is no need for modification of anticoagulant therapy prior to dental, blood-provoking interventions since possible prolonged bleeding does not occur more often compared with the group of patients who have had the anticoagulant therapy altered modified. One of the aims of the present research was to ascertain to what extent the modification of anticoagulant therapy, in the sense of its discontinuation or reduction one day prior to the intervention, can affect the INR value. Hence, out of the total number of 101 patients we modified the therapy in 24 patients.Out of the latter number, we discontinued therapy in 20 patients, while in 4 patients we reduced it one day prior to the intervention. By statistical analysis of the data we established a significant statistical difference between the INR values one day prior to the intervention and those after the modification of therapy, resulting in the following: p < 0,01; Correlation Coefficient = 0,058; p = 0,00702 (Figure 13 and Figure 14). This means that modification of anticoagulant therapy results in a significant decrease of INR value which, in turn, can trigger off a propensity for thrombotic complications.
Figure 14. Average INR values one day prior to blood-provoking intervention and after modification of therapy Discussion Patients with artificial valves built in, represent a high-risk group for developing thromboembolia and, as such, they are prescribed anticoagulant therapy on a life-long basis.9,10 In our study 50% of the total number of subjects were patients with the artificial valves built in, either with the mitral valve or aortal valve or the combination of the two. Although medical regulations make it imperative for each patient to undergo a comprehensive dental examination and treatment prior to the artificial valve implantation or heart surgery, unfortunately, this has not been proved in practice.On the other hand, on account of fear of bleeding following the tooth extraction, such patients tend to avoid dental appointments. On the basis of the Questionnaire findings we confirmed that 69% of such patients had problems with their teeth. After dental examination we discovered that 75% of such patients needed to have a tooth extraction. As a result, on the basis of individual personal assessment of patients and the objective dental examination, we could unquestionably establish a need for a dental intervention. The fact that in 42% of patients there was a need for extraction of more than 3 teeth, clearly substantiates our original claim. It is the very problem of post-extraction bleeding which makes this subject matter interesting for a great number of authors who are concerned with the problem itself. It has always been a dilemma how to prepare a patient on anticoagulant therapy for an oral-surgical intervention. The fundamental question is whether to continue or discontinue anticoagulant therapy.11,12 2249
Figure 13. Ratio of INR values after modification of therapy
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Wahl 1 is against discontinuation of anticoagulant therapy. He believes that discontinuation of warfarin therapy does not necessarily reduce the risk of bleeding but, on the other hand, it can cause hypercoagulability. Discontinuation of warfarin therapy prior to surgical intervention can cause rebound thrombosis which, in turn, can damage the artificial valves with a lethal outcome in some dental patients after blood-provoking interventions.The same author emphasizes that warfarin therapy is not to be discontinued unless severe bleeding is expected.1 Other authors hold similar views on this problem. Thus, Sacco7 states that anticoagulant therapy must never be discontinued without agreement of the practising doctor in charge, while Devani and his associates 13 consider that oral-surgical interventions can be performed without discontinuation of anticoagulant therapy provided that INR values do not exceed 3,5. Ball 14 classifies patients on anticoagulant therapy into three groups:1. lowrisk interventions which do not require discontinuation of anticoagulant therapy; 2. medium-risk interventions in which coumadin therapy is discontinued two days prior to the intervention but with the calibration of the INR value on the day of intervention; 3. high-risk interventions which imply administration of heparin therapy .14 In the research conducted by Wahl and Howe15 ll it was found that 70% of the examined therapists suggested discontinuation of anticoagulant therapy even for the smallest dental intervention. Since warfarin, as the most commonly administered anticoagulant, has a life span of 36 hours, its administration is typically discontinued two days prior to the surgical intervention in order to bring the coagulation process to a normal level. Some practicioners,who are in favour of discontinuation of warfarin therapy, suggest that heparin should be administered in its place. In our research we established that in a great number of patients the INR values range below or around therapeutically acceptable levels. For this reason we believe that it would be very unethical to discontinue anticoagulant therapy to hypodosed patients one day prior to intervention and, thus, make them vulnerable to thrombotic complications.This also accounts for the fact that in our sample we modified the anticoagulant therapy 2250
only in 24 patients while the group of 77 patients had the anticoagulant therapy continued with the same dosage. In respect of prolonged post-extraction bleeding, no statistically significant difference between the two groups was found (p > 0,05 χ2 = 0,29). Therefore, the statistical interpretation of data supports the view that anticoagulant therapy should not be discontinued. At this, we must emphasize that this refers to patients whose INR values range between 2,5-3,5 at the moment of oral-surgical performance. Many dentists believe that the solution to the problem with regard to anticoagulant therapy discontinuation is in extensive consultations with the practising doctor. However, many practising doctors are not familiar with the nature of dental interventions, and it should not come as a surprise that they more often than not suggest discontinuation of anticoagualant therapy in patients who must undergo endodontic treatment rather than in patients who must have teeth ultrasonic scaling 2 The findings of our research support the views of those authors who disagree with routine discontinuation of anticoagulant therapy.Our belief is that in some cases it does not suffice to allow the practising doctor to decide on discontinuation of anticoagulant therapy on his own.We believe that the dentist, in particular the oral surgeon, who is familiar with the nature of blood-provoking intervention a patient must be submitted to, should actively participate in decision making in respect of a need for continuation or discontinuation of anticoagulant therapy. We have often witnessed random decisions on part of practicing doctors who suggested discontinuation of anticoagulant therapy for a couple of days prior to any dental intervention. It also appears that patients themselves are afraid of bleeding more often than of any contingent thrombolic complications. In our research we paid attention to regular control of INR values prior to performing any blood-provoking dental intervention. In other words, each patient had his/her INR value calibrated in the appropriate laboratory one day prior to the intervention. On the basis of the obtained value a decision was made whether to modify oral anticoagulant therapy or not. A small number of patients had voluntarily discontinued the anticoagulant therapy one day prior to the intervention for fear of
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
bleeding. The INR values, in which blood-provoking interventions were performed, ranged from 0,96-3,99. At the values in the range of 3,99; 3,45 and 2,3, respectively, post-extraction bleeding occurred. In patient with the INR value of 3,99 we took into consideration the latest value from the patient's medical card for INR which amounted to 1,71. This approach proved to be wrong since the value in question was far lower than the real value of 3,99. Hence, on the basis of our own experience we believe that the best approach is to determine the INR value one day prior to the intervention since this is the best procedure to obtain the most reliable value of the level of anticoagulation. Conclusions If the INR values are in the range of 2,5-3,5 oral anticoagulant therapy should not be discontinued prior to dental intervention. The INR value range of 2,5-3,5 is safe for a successful performance of oral-surgical or other blood-provoking dental interventions. If the INR value is higher than 3,5 a decision on modification of anticoagulant therapy should be made as a team after consultations of the dentist with the practising doctor. Acknowledgments Special thanks to Professor Drita Mustagrudić for her useful advices during clinical investigation in this study. This study was financially supported by Goverment and Ministry of Education Canton Sarajevo - Federation of Bosnia and Herzegovina and Faculty of Dental Medicine University of Sarajevo, Bosnia and Herzegovina. References
1. Wahl MJ. Dental surgery in anticoagulated patients. Arch Intern Med. 1998; 24;158(15):1610-1616. 2. Wahl MJ. Myths of dental surgery in patients receiving anticoagulant therapy. J Am Dent Assoc. 2000;131(1):77-81.
3. Alexander R, Ferretti AC, Sorensen JR. Stop the nonsense not the anticoagulants: a matter of life and death. NY State Dent J. 2002;68(9):24-26. 4. Garcia-Darennes F, Darennes J, Freidel M, Breton P. Protocol for adapting treatment with vitamin K antagonists before dental extraction. Rev Stomatol Chir Maxillofac. 2003;104(2):69-72. 5. Scully C, Wolff A. Oral surgery in patients on anticoagulant therapy. Oral Surg Oral. Med Oral Pathol Oral Radiol Endond. 2002;94(1):57-64. 6. Webster K, Wilde J. Management of anticoagulation in patients with prosthetic heart valves undergoing oral and maxillofacial operations. Br J Oral and Maxillofac Surg. 2000;38(2);124-126. 7. Schardt-Sacco D. Update on coagulopathies. Oral Surg Oral Med Oral Pathol Oral Radiol Endond. 2000;90(5):559-563. 8. Jeske AH, Suchko GD. Lack of a scientific basis for routine discontinuation of oral anticoagulation therapy before dental treatment. J Am Dent Assoc. 2004;135(1):28. 9. Brigden ML. When bleeding complicates oral anticoagulant therapy: how to anticipate, investigate, and treat. Postgrad Med. 1995;98(3):153-168. 10. Petitti DB, Strom BL, Melmon KL. Duration of warfarin anticoagulant therapy and the probabilities of recurent thromboembolism and hemorrhage.Am J Med. 1986;81(2):255-259. 11. Scully C, Cawson RA. Medical Problems in dentistry. 4th ed. London, Wright. 1997. 12. Little JW, Fallace DA, Miller CS, Rhodus NL. Dental management of the medically compromised patients. 5th ed. St Louis: Mosby;1997. 13. Devani P, Lavery KM, Howell CJ. Dental extractions in patients on warfarin: is alteration of anticoagulated regime necessary? Br J Oral Maxillofac Surg. 1998;36(2):107-111. 14. Ball JH. Management of the anticoagulated dental patient. Compend Contin Educ Dent. 1996;17(11):1100-1102,1104,1106. 15. Wahl MJ, Howell J. Altering anticoagulation therapy: survey physicians. J Am Dent Assoc. 1996;127(5):625-638. Corresponding author Naida Hadžiabdic, Faculty of Dental Medicine, University of Sarajevo, Bosnia and Herzegovina, E-mail: nsulejma@yahoo.com
Journal of Society for development in new net environment in B&H
2251
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Antioxidant capacity in some medicinal plants and fruits extracts
Majda Srabovic1, Melita Poljakovic1, Zorica Hodzic1, Bozo Banjanin1, Mirzeta Saletovic1, Cazim Salimovic2, Ekrem Pehlic3
1 2 3
University of Tuzla, Faculty of Science, Department of Chemistry, Bosnia and Herzegovina, University of Travnik, Faculty of Health, Bosnia and Herzegovina, University of Bihac, Biotechnical faculty, Bosnia and Herzegovina.
Abstract Significant reduce of the harmful effects of free radicals on normal physiological functions is achieved by consuming the antioxidants through food. Therefore, antioxidants are an important factor in health care. Determination of total antioxidant capacity of medicinal plants from the families: Laminaceae (Melissa officinalis, Salvia officinalis, Teucrium montanum, Achillea millefolium), Betulaceae (Betula pendula), Asteraceae (Calendula officinalis), Tiliaceae (Tilia cordata), Rosaceae (Rosa canina), Sambucaceae (Sambucus nigra), Malaceae (Crataegus monogyna) and berries from the families Vaccinium (Vaccinium myrtillus L.) Rosaceae (Fragaria ananassa.) was conducted by indirect FRAP method. The method is based on the reduction of iron from Fe III to Fe II form with the presence of antioxidants using low pH (pH=3,6). Formed Fe (II) ions in the presence of reagents TPTZ create a colored complex, which reaches a maximum absorption at 593 nm. Test results of total antioxidants in the extracts of medicinal plants show significant differences and their range from 1 538.20 - 21 070,00 µmolFeII/L of extract, and in extracts of berries values range from 3003,94 – 12258,00 µmolFeII/L. The highest value of total antioxidants was measured in the extract of Melissa officinalis. Key words: Antioxidant capacity, extraction, FRAP method Introduction A large number of clinical and epidemiological studies show a correlation between the antioxidant substances present in the diet and prevention of 2252
diseases such as cardiovascular disease, neurological diseases and carcinogenesis (1,2,3,4). In the modern world, the activity of free radicals from external sources is rising, and natural body defense against free radicals is not always sufficient. Dietary intake of antioxidants plays an important role in protecting the body from free radicals. Antioxidants imply compounds that protect biological systems from the potentially harmful effects, processes or reactions caused by the excess of oxidants (free radicals). Oxidation process is one of the most important ways for the production of free radicals in food, medicines, and even living systems. Free radicals emerge from thermolysis, electromagnetic radiation, redox reactions, enzymatic processes and chemical processes (5). As a result of the abating of antioxidant defense, and disturbing the balance in the system of oxidant / antioxidant, oxidative stress emerges. Oxidative stress has a distinctive role in the pathogenesis of many chronic diseases. Oxidative stress affects the changes of biological macromolecules such as lipids, proteins, nucleic acids. It is believed that some illnesses are a direct result of inadequate intake of antioxidant nutrients from food. The application of synthetic antioxidants such as butyl-hidroxyanizol (BHA), butyl-hydroxytoluene (BHT) and tert-butylhydrohinon (TBHQ) shows some limitations as these have low solubility and moderate antioxidant activity (6,7). Fruits, vegetables, grains, tea, wines, and some types of spices are natural sources of antioxidants (8). Food of plant origin not only contains the important antioxidant vitamins (eg. vitamin C, vitamin E and provitamin A), but also a mixture of other natural substances, which makes the antioxidant capacity. The essential oil of Mentha species shows the antioxidant activity.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Although the action of mechanism has not yet been determined, it is believed that antioxidant activity is associated with monoterpenic ketones and aldehydes, or phenolic substances (9). Polyphenolic antioxidant compounds as components of various plant species are present in teas, fruits, vegetables, wine, extra virgin olive oil, chocolate, etc., have at least one aromatic ring and more hydroxyl groups where a majority of products present derivations and / or isomers of flavone, isoflavones, catechins, phenolic acids. Polyphenols are attributed to a much greater antioxidant effect than vitamins. Thanks to the rich composition of flavone, anthocyanin, flavonoid and terpene, blueberry occupies the first place by the content of antioxidants. Darkblue color of blueberry berries comes from flavonoid anthocyanin, which thanks to its protective effects enables the curative effect (10). Strawberry fruit are widely consumed, both fresh and in processed forms such as juices, which may further be stored. These attractive fruits are favored for their excellent taste, and can be considered a very rich source of bioactive phenolic compounds including: hydroxycinnamic acids, ellagic acid, ellagitannins, xavan-3-ols, xavonols, and anthocyanins (11). A strong antioxidant activity is found in aqueous extracts of birch, which are associated with a high content of phenolic compounds from the class: quercetin 3-rutinoside (rutin), quercetin 3-galactoside (hyperin), quercetin 3-glucuronide, quercetin 3 - arabinopyranozide, quercetin 3 -arabinofuranoside, quercetin 3-ramnozida and myricetin 3 – galactoside (12). In sage active compounds that have antioxidant properties are phenolic acids, flavonoids, natural pigments and terpenes (13). Antioxidant capacity is the total effect of all antioxidant components as inhibitors of oxidation processes in a biological system. It is believed that antioxidant substances act synergistically, and in this sense, the value of antioxidant capacity gives a true picture of the antioxidant activity of certain plant species, and different types of the same species. It is important to choose conditions for extraction, which correspond to the conditions in which the bioavailability of antioxidant supstances from medicinal plants and fruits in the body is maximum. The aim of the paper was to determine the value of total antioxidants in the extracts of dif-
ferent species of medicinal plants and berries, as well as to examine the effect of the localities and various kinds on the value of total antioxidants in the samples, and their importance in phytotherapy. Studies of total antioxidant substances, berries and medicinal plants represent a contribution to researches of biologically active compounds in certain plant species. We have also studied the effect of suitable solvent on the extraction process of antioxidant compounds. Materials and methods For determination of total antioxidant capacity of aqueous extracts of medicinal plants and berries was used FRAP (Ferric Reducing Antioxidant Power) method. FRAP method was developed by Benzie and Strain in 1996 and modified in 1999. It is quick and simple method used for measuring the total antioxidant capacity which is based on the reduction of iron from Fe (III) to Fe (II) form in the presence of antioxidants at low pH (pH = 3.6). Formed Fe (II) ions in the presence of TPTZ reagent (2,4,6-Tris (2-pyridyl-s-triazine) create colored complex, which reaches a maximum absorption at 593 nm (14).
Picture 1. Reduction of Fe (III)TPTZ in colored complex Fe (II)TPTZ In the reasearch are used medicinal plants collected from the area of Tuzla Canton and Brcko District. A total of ten medicinal plants and two types of berries are collected and analyzed by UV/ VIS spectrophotometer “Perkin-Elmer lambda 25” (Table 1). Medicinal plants were dried at 105 ˚ C and chopped to size of 2-8 mm. 1 g sample was transferred into a 100 mL flask and supplemented with distilled water at a temperature of 95 º C. Filtration was conducted after extraction. Aliquot was taken from the 10 mL solution and diluted in the flask of 100 ml. 2253
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 1. Medicinal plants and berries
Medicinal plants Milfoil - (Achillea millefolium) Pot marigold - (Calendula officinalis) Lemon blam - (Mellisa officinalis) Sage - (Salvia officinalis) Elder - (Sambucus nigra) Silver birch - (Betula pendula) Hawthorn - (Crataegus monogyna) Small leaved lime - (Tilia cordata) Dog rose - (Rosa canina) Mountain Germander - (Teucrium montanum) Berries Blueberry - (Vaccinium myrtillus L). Strawberry - (Fragaria ananassa.) Locality TC and BD TC and BD TC and BD TC and BD TC and BD TC and BD TC and BD TC and BD TC and BD TC and BD The Drina River valley TC
Picture 2. Calibrated line for determination of antioxidant capacity Results Table 2 shows the values of antioxidant capacity of aqueous extracts of medicinal plants, from two localities: Tuzla Canton (TC) and Brcko District (BD). Table 3 shows values of antioxidant capacity of aqueous and alcoholic extracts of two types of berries, from locality The Drina River valley and Tuzla Canton (TC). Table 2. Results of antioxidant capacity in aqeous extracts of medicinal plants
Medicinal plants (Achillea millefolium) Milfoil (Calendula officinalis)Pot marigold (Mellisa officinalis) Lemon blam (Salvia officinalis) Sage (Sambucus nigra) Elder (Betula pendula) Silver birch (Crataegus monogyna) Hawthorn (Tilia cordata) Small leaved lime (Rosa canina) Dog-rose (Teucrium montanum) Mountain Germander Antioxidant capacity µmol FeII/L extract Locality I Locality II (Tc) (BD) 6179,10 2097,30 21070,00 17520,00 14733,60 8247,30 14124,50 2538,20 16783,60 3960,90 5397,30 1538,20 20442,70 16751,80 8906,40 5897,20 7233,60 4629,00 16760,90 10974,50
TC-Tuzla Canton; The Drina River valley; BD-Brcko District
Crude extracts from two berries cultivars were prepared by weighing fresh fruits (100 g), mixed with 100 ml of distilled water or appropriate solvent and then milled using a commercial mini-processor. The crushed berries were put in centrifuge tubes. Tubes were centrifuged (3000g, 15 min) and the clear supernatant fluid was collected and used either within 1 h of collection. The working FRAP reagent was prepared by mixing 10 volumes of 300 mmol/L acetate buffer, pH 3.6, with 1 volume of 10 mmol/L TPTZ (2,4,6-tripyridylstriazine) in 40 mmol/L hydrochloric acid and 1 volume of 20 mmol/L ferric chloride. Freshly prepared FRAP reagent (3 mL) was warmed to 37 °C and then 100 μL of extract and 300 μL of deionised water (or solvent) was added to the FRAP reagent. Absorbance readings were taken after 30 min at 593 nm. Aqueous solutions of the FeSO4 x 7H2O concentrations, in the range of 100–1000 μmol/L, were used for calibration (picture 2.). The results were corrected for dilution and expressed in μmol Fe(II)/L. All solutions were used on the day of preparation and all determinations were performed in duplicate and the mean of the results of two experiments are presented.
2254
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 3. The results of antioxidant capacity in aqueous and alcoholic extracts of berries from The Drina River valley and Tuzla Canton laocality
Antioxidant capacity µmol FeII/L solvent extraction berries (Vaccinium myrtillus L) blueberry 4788 3003,94 4792,8 5380,4 10810,4 12258 (Fragaria ananassa.) strawberry 4705,2 4249,2 5545,2 5580,2 5670,4 10063,2
water 10% ethanol 30% ethanol 50% ethanol 70% ethanol 96% ethanol
Discussion Dietary intake of antioxidants plays an important role in protecting the body from free radicals. Fruits and plants can be a good source of natural antioxidants. Antioxidants are secondary metabolites and their content in plants depends on a variety of vegetation stress conditions (15). Given the importance of consuming medicinal herbs, the paper examines the antioxidant capacity in extracts of medicinal plants from Tuzla Canton and Brcko District localities. Test results of antioxidant capacity of medicinal plants (extraction at temperature of 95 ºC) determine values ranging from 1538,20 to 21070,00 µmolFeII/L of extract (picture 3). The highest value of total antioxidants was measured in the extract of Melissa officinalis which is consistent with the results of research of Katalinic and associates. From 70 medicinal plants, the highest value of antioxidant capacity was found in the same plant. David and Williams examined the effect of time and temperature on the concentration of phenolic and antioxidant capacity in extracts of Mellissa officinalis in time from 10 to 30 minutes. In the first minute, more than 40% in water-soluble phenols were extracted in water (98°C). About 10 minutes was enough for the extraction of almost all (94%) of water soluble phenols. FRAP in the balm, in linear terms followed an increase in phenols. Also, the process of preparing hot (98°C) and cold (20°C) water indicates that the extracts prepa-
red in hot water have the antioxidant capacity two times bigger (17). Many authors have found a good antioxidant activity of Lamiaceae (18, 19, 20, 21, 22) which is consistent with our research. In our study we observed a significant antioxidant value of the Rosa canina from the family Rosaceae. Researches show that herbs are an important source of antioxidant substances. Recently, a research interest is increased in testing and use of food products that contain natural antioxidants. Some studies have shown that grain products have equal or bigger antioxidant capacity than many fruits and vegetables. Observed by localities for Calendulu officinalis, Sambucus nigra, Tilia cordata i Teucrium montanum the difference between two localities is spotted. Calendula officinalis and Sambucus nigra show the gigger antioxidant capacity at Tuzla Canton locality, while Tilia cordata and Teucrium montanum show bigger antioxidant values at Brcko District (picture 4). For remainig medicinal plants values of antioxidant capacitiy are approximately equal.
Picture 3. Antioxidant capacity of aqueous extracts of medicinal plants
Picture 4. Antioxidant capacity of aqueous extracts of medicinal plants from different localities 2255
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Optimization of extraction conditions of total antioxidants enables maximum isolation and identification of the same. Organic molecules can be mechanically embedded within the solid phase or it may be associated with intermolecular forces. To free molecules the intermolecular forces are needed to be overcome with a stronger or more numerous drawings. Freeing molecules from the inside of solid phase is possible with the assumption that solvent enters near the wanted molecules. Using the 70% and 96% ethanol in the process of extraction of berries (blueberry and strawberry) the highest values of antioxidant capacity are obtained (picture 5). Values of antioxidant capacity are not expressed to a significant extent, unless during the extraction process as solvents are used 10% ethanol. From previously mentioned follows that the synergistic effect of binary mixture ethanol-water (70%) as suitable solvent in the process of extraction of berries.
Suitable solvent for extraction of fresh berries ( blueberry and strawberry) is (70%) binary mixture of ethanol and water or pure ethanol. References
1. Lindsay D.G. Astley S.B. European research on the functional effects of dietary antioxidants. Molecular Aspects of Medicine, 23: 1–38. 2002. 2. Bolck G A role of antioxidants in reducing cancer risks. Nutr Rev 50:207-213. 1992. 3. Hughes D.A. Dietary antioxidants and humanimmunite function. Nutrition Bulletin, 25: 35–41. 2000. 4. Kris-Etherton P.M. Hecker K.D. Bonanome A. Coval S.M. Binkoski A.E. Hilpert K.F. Griel A.E. Etherton T.D. Bioactive compounds in food: Their role in the prevention of cardiovascula disease and cancer. American Journal of Medicine, 133: 71–88. 2002. 5. Acworth, I.N. The Handbook of Redox Biochemistry. Eds. ESA, Inc.,Chelmsford, USA. 2003. 6. Barlow SM Toxicological aspects of antioxidants used as food additives. In Food Antioxidants, Hudson BJF (ed.) Elsevier, London, pp 253-307. 1990. 7. Branen AL Toxicology and biochemistry of butylated hydroxyanisol and butylated hydroxytoluene. J. American Oil Chemists Society 5: 59- 63. 1975.
Picture 5. Antioxidant capacity of aqueous extract and alcoholic extract of berries Conclusions Synthetic preparations of antioxidants as immunostimulants are not even nearly effictive as antioxidants from natural products. The results of researches of total antioxidants in extracts of medicinal plants show signifficant differences and range from 1 538,20 to 21 070,00 µmolFeII/L of extract. The highes value of total antioxidant capacity is measured in balm. Balm contains: flavones ( quercetin, ramnocitrin, glycosides of luteolin, apigenin and kaempherola), triterpenes (ursolic and oleanolic acid), glycosides and phenolic acids, which explains extremely highest value of total antioxidants. 2256
8. Rice-Evans C., Miller N.J., Paganga G. Structureantioxidant activity relationships of flavonoids and phenolic acids. Free Radical Biology & Medicine, 20: 933–956. 1996. 9. Bozin B. Mimica-Dukic N. Simin N. Anackov G. Characterization of the volatile composition of essential oils of some Lamiaceae spices and the antimicrobial and antioxidant activities of the entire oils. J. Agric. Food Chem. 54;1822-1828, 2006. 10. Cook NC.Samman S. Flavonoids-chemistry, metabolism, cardioprotective effects, and dietary sources. Nutritional Biochemistry, 66- 76, 1996. 11. Maatta-Röhinen KR, Kamal-Eldin A, Törrönen AR Identification and Quantification of Phenolic Compounds in Berries of Fragaria and Rubus Species (Family Rosaceae) 2004, J Agric.Food Chem 52:6178–6187
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
12. Trouillas P. Calliste C.A. Allais D.P. Simon A. Marfak A. Delage C. Duroux J.L. Antioxidant anti-inflammatory and antiproliferative properties of sixteen water plant extracts used in the Limousin countryside as herbal teas. Food Chem. 80(3), 399-407. 13. Cuvelier M.E. Berset C. and Richard H. 1994. Separation of major antioxidants in sage by high performance liquid chromatography. Sci. Aliment. 14: 811-815. 2003. 14. Benzie I.F. Strain J.J. The ferric reducing ability ofplasma (FRAP) as ameasure of “antioxidant power” The FRAP assay, Anal. Biochem. 239: 70–76, 1996. 15. Verpoorte R. Van der Heijden R. Ten Hoopen H.J.G. Memelink J. Metabolic engineering of plant secondary metabolite pathways for the production of fine chemicals. Biotechnology Letters. 21: 467-479, 1999. 16. Katalinic V. Milos M. Kulisic T. Jukic M. Sreening of 70 medicinal plant extracts antioxidant capacity and total phenols. University of Split, Croatia. 550-557, 2004. 17. Matsuura H. Hokura A. Katsuki F. Itoh A. Haraguchi H. Multielement determination and speciation of major-to-trace elements in black tea leaves by ICP-AES and ICP-MS with the aid of size exclusion chromatography. Analytical Science. 17: 391–398, 2001 18. Zandi P. Ahmadi L. Antioxidant effect of plant extracts of Labiatae family. Journal of Food Science and Technology, 37: 436–439. 2000. 19. Capecka E. Mareczek A. Leja M. Antioxidant activity of fresh and dry herbs of some Lamiaceae species. Food Chemistry, 93: 223–226. 2005. 20. Dorman H.J. Bachmayer O. Kosar M. Hiltunen R. Antioxidant properties of aqueous extracts from selected Lamiaceae species grown in Turkey. Journal of Agricultural and Food Chemistry, 52: 762–770. 2004. 21. Miler EH. Rigelhof F. Marquart L. Prakash A. Kanter M. Antioxidant content of whole grain breakfast cereals, fruits and vegetables. Journal of the American College of Nutrition; Published by the American College of Nutrition. Minneapolis; Minnesota. 3125-3195, 2000.
22. Bozin B. Mimica-Dukic N. Samojlik I. Jovin E. Antimicrobial and antioxidant properties of rosemary and sage (Rosmarinus officinalis L. and Salvia officinalis L. Lamiaceae) essential oils. J. Agric. Food Chem. 55; 7879–7885, 2007. 23. Mirzeta S., Zorica H., Božo B., Aldina K., Bioavailability of microelements (Cu, Zn, Mn) in medicinal plants. Health Med, vol 6, 2011. Corresponding author Majda Srabovic, University of Tuzla, Faculty of Science, Department of Chemistry, Bosnia and Herzegovina E-mail: majda.srabovic@untz.ba
Journal of Society for development in new net environment in B&H
2257
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Idiopathic venous thromboembolism and lung cancer
Selma Arslanagic1, Rusmir Arslanagic2, Naima Arslanagic3
1 2 3
Plastic and reconstructive Clinic, University Clinical Center of Sarajevo, Bosnia and Herzegovina ORL Clinic, University Clinical Center of Sarajevo, Bosnia and Herzegovina Dermatovenerologic Clinic, University Clinical Center of Sarajevo, Bosnia and Herzegovina
Abstract Introduction: Numerous studies has shown that venous thromboembolism is commmon complication in patients who present with carcinoma and it may be first manifestation of malignancy. The incidence of cancer is highest within the first 6 months, and approximately 40% of the cases alredy have metastatic disease at the time of diagnosis. Aim of this study: The aim of our study was to determine the venous thromboembolism in patients with clinicaly and histologicaly confirmed lung cancer , before any kind therapeutic procedures are performed. Patients and methods: The study comprised 239 consecutive patients, 183 male and 56 female, admited at Department of Pulmonary Medicine in Sarajevo with histologicaly confirmed lung carcinoma, before therapeutic procedures , in period between from january 1. 2005 – decembre 31. 2007. Results: Median age of all patients with lung carcinoma was 63,4. The jungest patients was 24yrs. , and the oldest patients 86 yrs. The male/ female ratio was 3,2:1. Venous thrombosis was present in 2,1% of total number lung cancer patients , total numer 5 , from total 239 lung cancer patients. Lung adenocarcinom were present in 3 and sguamous cell lung carcinoma in two patients. There was elevated platelet count ,>400x 10 9 /l, lukocytosis and higly elevated erythrocyte sedimentation rate by all lung cancer patients with venous thrombosis. Key words: Lung carcinoma, venous thromboembolism, thrombocytosis
Introduction Armand Trousseau in 1865. reported the association of migratory thrombophlebitis with occult malignancy( Trousseau syndrome). Venous thrombosis can be first manifestation of an occult malignancy. In some patients , venous thromboembolism may precede the diagnosis of malignancy by many months. Numerous studies has shown that venous thromboembolism is commmon complication in patients who present with carcinoma and it may be first manifestation of malignancy(1). Evidence from cohort series was shown that approximately 10% of patients who present with unpropriated or idiopathic thrombosis are diagnosed with cancer within fw years after their throbmotic event(2-4). The incidence of cancer is highest within the first 6 months, and approximately 40% of the cases alredy have metastatic disease at the time of diagnosis. In patients with cancer ,the capability of tumor cells and their procoagulant products to interact with platelets ,clotting and fibrinolytic proteins contributes to the development of venous thrombosis(5,6). Aim of this study The aim of our study was to determine the venous thromboembolism in patients with clinicaly and histologicaly confirmed lung cancer , before any kind therapeutic procedures are performed. Patients and methods The study comprised 239 consecutive patients, 183 male and 56 female, admited at Depar-
2258
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
tment of Pulmonary Medicine in Sarajevo with histologicaly confirmed lung carcinoma, before therapeutic procedures, in period between from january 1. 2005 – decembre 31. 2007.. Each patients was staged according to the tumour ,node, metastasis. Clinical staging included chest radiography, a computed tomographic scan of the thorax and, in some cases, of the upper abdomen , fibreoptic bronchoscopy, with endobronchial or transbronchial biopsies and bronchial washing, cytological examination of sputum and pleural fluid, percutaneous transthoracic needle biopsy and /or mediastinoscopy. The histopathological tumour diagnoses werw obtained from the local Department of Pathology Medical Faculty in Sarajevo. The histopathological classificatio of the tumours was performed according to World Health Organisation( 7). Results Median age of all patients with lung carcinoma was 63,4. The jungest patients was 24 yrs. , and the oldest patients 86yrs. The male/female ratio was 3,2:1. The total number of lung carcinoma patients, sex and age distribution are summarised
in Table 1. The most lung cancer patients was between 51yrs. and 60 yrs. The age and sex structure lung cancer patients according of types lung carcinoma, is shown on Table 2. The number of lung cancer non small cell carcinoma was 4,7 time more than small cell lung carcinoma. Statistical analisys hi squere test did not confirm statistically significance diffrences between non small cell lunag carcinoma and small cell lung carcinoma according the age , p-value below 0,05; (X²=1,0; X² limes =5,9, number of grades n=2). Histopatholigical analysis of lunag carcinoma, acording sex and age are shown on Table 3. The most frequent was adenocarcinoma, N=115; (43,8%). The sguamous cell carcinoma of lung cancer patients were on the second place, (N= 62; 37,2%). Venous thrombosis was present in 2,1% of total number lung cancer patients, total number 5 , from total 239 lung cancer patients. Lung adenocarcinoma were present in 3 and sguamous cell lung carcinoma in two patients. There was elevated platelet count, thrombocytes >400x 10 9 /l, lukocytosis and higly elevated erythrocyte sedimentation rate by all lung cancer patients with venous thrombosis. Venous thromboembolism of lung cancer patients is shown on Table 4.
Table 1. Number of patients according by histological types of lung cancer
Sex Age <50 51-60 61-70 >70 Total Number of patients 23
92 70 54 239
Percent Number
9,6 38,5 29,3 22,6 100,0 16 70 58 39 183
Male Percent
6,6 29,3 24,3 16,4 76,6 7 22 12 15 56
Female Number Percent
2,9 9,3 5,0 6,2 23,4
Table 2. Number of patients according primary lung carcinoma
Lung cancer Age <50 51-60 61-70 >70 Total Number of patients 23 92 70 54 239 Percent 9,6 38,5 29,3 22,6 100,0 Non small cell carcinoma Number 22 75 58 42 197 Percent 9,2 31,4 24,3 17,6 82,4 Smal cell carcinoma Number 1 17 12 12 42 Percent 0,3 7,1 5,1 5,1 17,6
Journal of Society for development in new net environment in B&H
2259
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Table 3. Number of patients according by sex and histological types of lung cancer
Histological Types Carcinoma adenocarcinoma Ca. squamocell. Ca macrocell Ca. microcell Total Total Number patient Number
105 89
Sex Male Number
85 62
Female Percent
35,6 25,9
Percent
43,8 37,2
Number
20 27 1 8 56
Percent
8,4 11,3 0,4 3,4 23,5
3
42 239
1,5
17,5 100,0
2
34 183
0,8
14,2 76,5
Table 4. Venous thromboembolisms of lung cancer patients
Localisation Thrombophlebitis Cruris sinistri Thrombophlebitis Cruris dextri Thrombophlebitis V. Saphena magna Thrombophlebitis Cruris sinistri Thromoembolio Pulmonum Sex M F M F M Age 59 70 53 74 45 Histologic types Ca. squamocellulare Adenocarcinoma Adenocarcinoma Adenocarcinoma Ca. squamocellulare Tnm Classification IIA IIIA IIIB IIIA
IIIB
Duration of symptoms 2 months 1 month 2 months 1 month
Discussion Today, well known scientific fact is that tumor cells and their procoagulant products interact with platelets, clotting and fibrinolytic proteins and contributes to development of venous thrombosis(8). Early stages of cancer development could predispose organism to blood hypercoagulation through mechanisms independent of those that are unles in advanced stages of cancer,where massive tissue damage can trigger hoemostatic catastrophe. The most common malignancies associated with thrombosis are derived from breast,colon and lung, and reflecting the prevalence of these tumors in general population. However,when adjusted for disease prevalence,the cancers most significantly associated with thrombotic disorders are derived from pancreas,ovary and brain(9). Thrombosis and thromboembolism are most frequent compication of cancer by numerous recent studies. Thromboembolic disease affects about 15% of cancer patients(6). Large cohort study of Sorens HT and al. (1) comprised 15 348 patients with deep thromboembolism. In 11 305 patient they 2260
found lung embilism and association with cancer was found among 1372 patients. Cancer of breast,vesica urinaria,rectum, and malignant melanoma, the most frequent tumours , are the most associated with deep venuos thrombosis and thromboembilism. Adenocarcinomas, particulary of pancreas,ovary and lung has the strongest association with venous thromboembilism. Renal cell carcinoma invade blood vassels,start coagulation cascade that leades to thrombosis and thromboembolism(5). Pederson LM and Milman N(10) in their research have not found association between thrombocytosis and deep venous thrombosis and thromboembolism. Bloom JV and al(11) in their study that comprised 537 patients found higher risk of venous thrombosis in patients with primary lung cancer. Freqwency of thromboembolism is three time higher in adenocarcinomas versus squamous cell carcinoma. Higher risk of thrombosis in their researchs was not link with surgical procedures. Wahrenbrock M et al (12) in his study found that mucin of adenocarcinoma cells in vitro acti-
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
vates thrombocyte toward activation of leucocyte L –selectin and thrombocyte P-selectin. That leads to thrombosis(12). The pathogenesis of prothrombotic state in cancer is complex and likely multifactorial. It is generally disscused that both,tumor through production of procoagulant factors and host,through its inflammatory response take part in the process (3,6). In our study that comprised 239 patients, in 5 of them(2,1%) thromboembolic events were found at the moment when diagnosis of lung cancer was established. Out five patients three were male,two of them were female. Average age among our patients with thromboembolic events was 60,2. The youngest patient was 45 yrs. of age,the oldest was 74 yrs. of age. Out of five,three had adenocarcinoma, and two were squamous cell carcinoma. Average durance of symptoms at three patients was one month,at two patients two months. Average durance of symptoms before making the diagnosis of cancer was 1,4 months. Four patients had advanced stage of cancer ,two of them were in stage IIIA,two in IIIB stage. One patient was in IIA stage. All of patients with thromboembolic events had thrombocytosis,leukocytosis and high erythrocyte sedimentation rate. Thromboembolism was present in advanced stages of carcinoma ,before any kind of therapy, at the moment when diagnosis of lung carcinoma was establich. Pederson LM and Milman N (9) in their study found that there is not a correlation between thrombocytosis and thromboembolism. In their study that was conducted on 1115 patients, thromboembolism was found in only five cases. Pederson LM and Milman N (10) in their study make conclusion that thrombocytosis is not a risk factor for thromboembolism and thromboembolic events in patients with lung carcinoma. Bloom JV and al. (11) in study on 537 patients found for twenty times higher incidence of deep venous thromboembolism in lung cancer patients to patients in control group. Adenocarcinoma had three times higher incidence of thromboembolic events to squamous cell carcinoma. Higher rate
of thromboembolism is not linked with surgery. Higher incidence of thromboembolic events in adenocarcinoma is due to mucin of adenocarcinoma cells. In vitro mucin activates thrombocyte through leucocyte L-selectin and thrombocyte P selectin(12). That leeds to thrombosis and thromboembolism of lung. Rickles FR and Levine MN(5) assumed that some patients of carcinoma have subclinical signs in activating coagulation cascade. Conclusion In our study thrombophlebitis and thromboembolism was found in five of our patients (2,1%). Thromboembolic events were freqent in adenocarcinoma (60%) versus squamous cell carcinoma (40%). Average of onset is 60,2 years of age. Thromboembolism was freqent in advanced stages of carcinoma at the moment when diagnosis of lung carcinoma were establich, before any kind of therapy. Early stages of carcinoma suggest that critical oncogenic events may also trigger activation of coagulation cascade, leading to prothrombotic events. These mechanisms are different in advanced stages of carcinoma. Massive tissue imparement due the present carcinoma , maybe is major trigger thrombotic mechanism. Patient with idiopathic thromboembolism have to be seriosly examened for occult malignancy. References
1. Sorens HF,Mellemkjer L Steffensen FH et al:The Risk of a Diagnosis of Cancer after Primary Deep Venous Thrombosis or Pulmonary Embolisms. NEJM 1998;338(17) :1169-1173 2. Murchison JT,Wylie L,Stockton DL. Excess risk of cancer in patients with primary venous thromboembolismus: a national, population based cohort study. Br J Cancer. 2004; 91:92-95 3. Lee AY, Levine MN. Venous thromboembolism and cancer: risks and outcomes. Circulation 2003;107:117-121
Journal of Society for development in new net environment in B&H
2261
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
4. Levine MN ,Lee AY ,Kakkar Ak. From Trousseau to targeted therapy : new insights and innovations in thrombosis and cancer. J Thromb Haemost 2003;1:1456-1463 5. Rickles FR, Levine MN. Epidemiology of thrombosis in cancer. Acta Haematol 2001;106:6-12 6. Dvorak HF. Tumors:wounds that do not heal. NEJM 1986;315:1650-1659 7. Kreyberg L,Liebow AA,Uehlinger EA. International Histologic Classification of Tumours:No. 1. Histological Typing og Lung Tumours. Geneva:World Health Organization,2nd ed. 1981. 8. Nijziel MR,Oerle R ,Hillen HFP et al: From Trousseau to angiogenesis:the link between the haemostatic system and cancer. The Journal of Medicine 2006;64(11):403-410 9. Pedersen LM and Milman N. Diagnostic significance of platelet count and other blood analyses in patients with lung cancer. Oncology Reports 2003,10: 213-216. 10. Pedersen LM, Milman N.: Prognostic significance of thrombocytosis in patients with primary lung cancer. Eur Respir J., 1996,9:1826-1830. 11. Blom JW,Osanto S and Rosendaal R:The risk of a venous thrombotic event in lung cancer patients: higher risk for adenocarcinoma than squamous cell carcinoma. J Thromb Haemost 2004;2:17601765. 12. David Feder, André Neves Alves, João Roberto Beltramo, Luana Ap. Beltramo, Maria Gabriela P. Coriolano, Fabio F. Perazzo, Fernando L. A. Fonseca, Effect of bee venom (Apis mellifera) on the phagocytosis of peritoneal macrophages and on the rise of life expectancy of Ehrlich tumor-bearing mice, HealthMED 2011;5(3):509-519 13. Wahrenbrock M,Borsing L,Le d. Varki N,Varki A. Selectin-mucin interactions as a probable molecular explanation for the association of Trousseau syndrome with mucinous adenocarcinomas. J. Clin Invest 2003; 112:853-862
Corresponding author Selma Arslanagic, Plastic and reconstructive Clinic, University Clinical Center of Sarajevo, Bosnia and Herzegovina, E-mail: healthmedjournal@gmail.com
2262
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Echocardiography prognostic parameters at dilatative cardiomyopathy - Case report
Omer Perva, Majla Cibo, Muhamed Spuzic
Center for heart, University Clinical Center of Sarajevo, Bosnia and Herzegovina.
Abstract The aim of this study is to monitor dilated cardiomyopathy (diagnosis, monitoring and prognosis). Dilating cardiomyopathy is the most common cardiomyopathy and its main characteristics of the extension of one or both heart chambers and systolic dysfunction. It is divided into idiopathic (> 50%), familial-genetic, viral-inflammatory, and toxic alcohol. Using different modes and their echocardiograph parameters, we conducted a case report with 19-year-old man, demonstrating several important prognostic echocardiograph parameters. The patient was followed at our clinic 8 months and two months earlier at another institution and the diagnosis of dilated cardiomyopathy. While presenting this work we have tried to show how monitoring of certain parameters by using different echo modes and their parameters can be reliably determined the prognosis of the disease. Key words: dilated cardiomyopathy, echocardiography, prognostic parameters Introduction Dilating cardiomyopathy is the most common cardiomyopathy and its main characteristics of the extension of one or both heart chambers and systolic dysfunction. It is divided into idiopathic (> 50%), familial-genetic, viral-inflammatory, and toxic alcohol. The basic criteria for LV dilatation as cardiothoracic ratio of greater than 0.55, and LV internal diastolic diameter greater than 2.7 cm / m² body surface area (BSA). Irreplaceable role of echocardiography in diagnosing, monitoring and prognostic assessment especially in dilated cardiomyopathy.
Objective The aim of our study is to demonstrate the role of echocardiography in diagnosing, monitoring and prognostic assessment especially in dilated cardiomyopathy. Using different modes and their echocardiography parameters-B + M (LVIDd, Ladi, RVOTdiam, LV shape, EF, ES distance, LV wall thickness), color (MR, TR), Doppler PW + CW + TDI (E / A, E -DT, E / E ', PAP, MPI (Tei index) - we'll show the example of 19-year-old man several important prognostic echocardiograph parameters. The patient was followed eight months through periodic examinations, and after two months earlier at another institution where it has been diagnosed severe idiopathic dilated cardiomyopathy and heart transplantation indicated. While working with him we have used the input value at the first examination in our institution, then after three and eight months. Discusion The above charts chronologically presents the resulting values of measured parameters: LVIDd 70 mm/74 mm/77 mm (Figure 1)., Ladi 58 mm/58 mm/60 mm (Figure 2), EF 25% / 20% / 10%, LV spherical shape, RVOTdiam 33 mm/34 mm/37 mm, ES distance 20 mm/23 mm/25 mm, 6 mm LVPWd, IVSd 9 mm, E / A 2.6 / 3.0 / 3.2, E / E '16/18/19, E-DT 130 ms ms/120 ms/120, MPI 0.36 / 0.34 / 0.33, MR +4 / +4 MR / MR +4, +2 TR / TR + 3/TR +3-4, mmHg/65 mmHg/70 PAP 50 mmHg (Figure 3). During this period leads to deterioration of the values of most measured parameters, which also was accompanied by worsening clinical condition of the patient, followed by lethal egzitus. 2263
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Figure 1.
Figure 2.
2264
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Figure 3. Conclusion Echocardiography is highly reliable, relatively cheap and widely available diagnostic tool in the diagnosis and follow-up status of patients with dilated cardiomyopathy, regardless of the etiology of dilated cardiomyopathy. By monitoring certain parameters of echocardiography prognosis of the disease modes can be reliably determined. The most important prognostic determinants are the parameters of reduced systolic function. Of particular importance are the parameters of the elevated diastolic pressure, and shape (spherical), LV, LA size (> 45 mm), restrictive disorder distal function (E / A> 2), TEI index, the deterioration of hemodynamic parameters, RV, MR, PHT. References
1. Sanjit SJ, Shoaib A, Martial H et al. Radial versus femoral access for coronary angiography or intervention and the impact on major bleeding and ischemic events: A systematic review and meta-analysis of randomized trials. Am Heart J 2009;157:132-400.
Journal of Society for development in new net environment in B&H
2. Pleho –Kapic A, Beslagic R, Pepic E, Fajkic A., Level of cholesterol anlipoprotein fractions in cardiovascular diseases, HealthMED, 2008; 2(3): 154-161 3. ZmagoTurk & EvaTurk (2009) Our experience with evaluation of communication among older patients and health workers HealthMED 3(3); 195-203. 4. Secic D, Ibrahimpasic E, Kapic-Pleho A, Tiro N, Korac F, Kurbasic I. Hypertriglyceridemia among workers exposed to noise. HealthMED 2010; 4(4): 934-939 at http://www.healthmedjournal.110mb. com/files/vol104-no4.pdf Corresponding author Perva Omer, Center for heart KCU Sarajevo, University Clinical Center of Sarajevo, Bosnia and Herzegovina, E-mail: centar.za.srce.sarajevo@gmail.com
2265
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Identification of propionic acid methyl derivate as non-steroidal antirheumatic drug by infrared spectroscopy
Ekrem Pehlic1, Djulsa Bajramovic2, Mirza Nuhanovic3, Aida Sapcanin4, Bozo Banjanin5, Husein Nanic1, Melita Poljakovic5, Majda Srabovic5, Cazim Salimovic6
1 2 3 4 5 6
University of Bihac, Biotechnical faculty , Bosnia and Herzegovina, University of Mostar, Faculty of pedagogy, Bosnia and Herzegovina, Bosnalijek d.d. Sarajevo, Laboratory for synthesis, Bosnia and Herzegovina, University of Sarajevo, Faculty of Pharmacy, Bosnia and Herzegovina, University of Tuzla, Faculty of Natural Sciences and Mathematics, Bosnia and Herzegovina, University of Travnik, Faculty of Health, Bosnia and Herzegovina.
Abstract Aim: Identification of 2-(4- benzoylphenyl)-2methylpropionic acid as cyclooxygenase blocker, a key enzyme in prostaglandin synthesis by infrared spectroscopy. Material and methods: Infrared spectrum is defined with instrument Perkin Elmer FTIR Spectrum 1000. Sample preparation: KBr pellet. Statistical calculations are made on computer. All used chemicals were proanalisy grade. First stage of this analysis was preparation of 4-methyl-benzophenone, second stage was preparation of 4-bromomethyl-benzophenone, third stage was obtaining 4-cianomethyl-benzophenone, fourth stage was preparation of compound 2-(4-benzoylphenyl)-2-methyl-propionitrile and fifth stage is preparation of compound 2-(4-benzoylphenyl)-2-methyl-propanoic acid. This is example of Friedel-Crafts reaction. Results: By analysis of IR spectrum of synthesized molecule [2-(4-benzoylphenyl)-2-methylpropanoic acid] it is oblivious, based on appearance of wide band in interval of 2500 cm-1 to 3600 cm-1, could be concluded that analyzed compound contains carboxyl group (-COOH). Also, presence of aromatic vibrations on 692 cm-1 and 774 cm-1 confirms presence of monosubstituted and disubstituted aromatic ring. Presence of two intensive and sharp bands on 1698 cm-1 and 1774 cm-1 shows presence of keto (>CO) functional group. High degree of spectrum overlapping indicates presence of iden2266
tical structures (monosubstituted and disubstituted benzene and keto functional group). Discussion: It is known that derivates of propionic acid have anti-inflammatory properties as ibuprofen, ketoprofen, naproxen, fenoprofen, flurbiprofen, loxoprofen, tiaprofenic acid etc., but especially methylated derivates of propionic acid have these properties. Because this molecule is methylated derivate of propionic acid, it is expected that it possess anti-inflammatory properties. By analysis of IR spectrum of synthesized molecule it is noticed appearance of particular bands in different intervals, suggesting that analyzed compound has carboxyl group (-COOH), methyl group (-CH3) and keto (>C=O) group. Conclusion: Presented results confirm the structure of synthesized compound, because [2-(4-benzoylphenyl)-2-methylpropionic acid] as new compound, compared with compound with very similar structural characteristics (ketoprofen), has over 80% similar IR spectrum. High degree of overlapping of spectrum indicates presence of similar structures (monosubstituted and disubstituted benzene and keto functional group). Key words: Infrared spectroscopy, synthesis, antirheumatics, IR-spectrum, functional groups. Introduction Rheumatoid arthritis is chronic, systematic and progressive disease of connective tissue. It
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
is inflammatory disorder which primary includes synovial membrane of joint and its characteristics include pain in joint, stiffness, reduced mobility and fatigue. The disease manifests differently in individual patients, so results may vary. Rheumatoid arthritis could be happened in any age and usually became more severe in older age. According to some researchers, first symptoms appeared in 2nd and 3rd decade of life, with most often appearance in 4th to 6th decade of life. Etiology remains unclear. It is believed that rheumatoid arthritis is immunologic answer for unknown antigens of internal and external origin. Stimulant for immunological reaction could be viral or bacterial or in some relation to change in normal production and function of collagen. Infrared spectroscopy is method for illuminating some molecules with infrared light and it absorbs particular energies depending on its structure. Absorption of IR light happens in those molecules where dipole moment is changed. That means diatom molecules, without dipole, as in hydrogen, nitrogen, oxygen and others, doesn’t adsorbs such light. At the same way, by the molecules whose are symmetric (as ethane) doesn’t adsorbs some energies on bonds which are center of molecule symmetry (in ethane there are missing adsorb bands characteristic for bonds stretching ("C-C stretching"). Because there are no two identical molecules, it is also impossible find two different things with identical IR spectrum, especially in area of energies i.e. fingerprint areas (1600-400 cm-1). In IR spectroscopy instead of wave lengths, area of adsorption is described with wave number. IR spectra are much more complex as UV spectra do. Some functional groups have characteristic areas of adsorption of IR light. So i.e. hydroxyl groups of phenols, alcohols etc. have characteristic bands of O-H stretching in area from 3700-2500 cm-1, energies of stretching of N-H in area 3500 cm-1 etc. On other side, array of adsorb peaks, is characteristics of molecule and cannot be property of any particular functional group. Knowing characteristic adsorb peaks, it could make some assumptions about structure of any compound. Source of radiance could be hot body heated on 1000oC (i.e. Opperman’s source). Instead of this source, laser radiance could be used. Radiance is passes through a monochromator by lens system and/or “splitter”, which is build on the
same principle as by UV- spectrophotometer, but from materials which don’t adsorb IR light. Such materials are alkali halides (i.e. sodium chloride). In adsorption of UV radiance, interferometer is much more often used instead of monochromator, and then speaks of Fourier transformed IR spectroscopy. Interferometer is device which made interferences with radiance where sample is exposed in it. Curiosity of this technique is that spectra could be recorded extremely fast (in milliseconds) so method is good applicable along with separation chromatographic procedures. Sample for IR spectroscopy is prepared in different way then by measuring adsorption in visible or UV part of spectrum. Limitations are the only materials whose don’t adsorb IR radiance can be used, but it is not recommended to use even a water solution because many reasons. One of the reasons is that water adsorbs IR light. An IR spectrum is recorded more often in solids then in solution. Solids for spectrum recording should be mixed with potassium bromide and from mixture by pressure disc (pellet) is prepared, through which IR light is passed. By Fourier transformed IR spectroscopy, appliance of computer for connection with IR spectrometer is required. Aim Identification of 2-(4 benzoylphenyl)-2-methylpropionic acid as cyclooxygenase blocker, a key enzyme in prostaglandin synthesis by infrared spectroscopy. Because there are no two identical molecules, it is also impossible find two different things with identical IR spectrum. As synthesized molecule has different functional groups, it also has characteristic areas of IR radiance adsorption. Material and methods: IR spectrum is defined with instrument Perkin Elmer FT-IR Spectrum 1000. Sample preparation: KBr pellet. Statistical calculations are made on computer. All used chemicals were proanalisy grade. First stage of this analysis was preparation of 4-methyl-benzophenone, second stage was preparation of 4-bromomethyl-benzophenone, 2267
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
third stage was obtaining 4-cianomethyl-benzophenone, fourth stage was preparation of compound 2-(4-benzoylphenyl)-2-methyl-propionitrile and fifth stage is preparation of compound 2-(4-benzoylphenyl)-2-methylpropanoic acid. This is example of Friedel-Crafts reaction. The method consists that absorption of energy from different areas of electromagnetic radiance reflect in different ways in molecule. Afterwards, atoms in molecule are vibrating but always on particular quant energetic levels. The energies of raising vibrations of organic molecules match infrared radiance with wave numbers between 1200 and 4000 cm-1. This part of infrared spectrum proofs presence of some functional groups. The IR-spectra of gaseous, liquid and solid samples could be recorded. Synthesized molecule is solid compound that as sample has been set in cuvette which is made from salt crystals, because glass doesn’t let infrared light through it. By this method it is very important that sample doesn’t contain even traces of water. Results IR spectra of synthesized molecule [2-(4-benzoylphenyl)-2-methylpropionic acid] (figure 1.) is visible that, based on appearance of
wide band in interval of 2500 cm-1 to 3600 cm-1 contains carboxylic group (-COOH). Also, presence of aromatic vibrations on 692 cm-1 and 774 cm-1 confirms presence of monosubstituted and disubstituted aromatic ring. Presence of two intensive and sharp bands on 1698 cm-1 and 1774 cm-1 is proof of presence of keto (>CO) functional group. Yielded compound contains methyl groups and has in area of “fingerprint” of IR band by 1350 cm-1 to 1450 cm-1. These bands are characteristics of bond deformations with methyl group. Structure of synthesized molecule as a new compound, compared with compound with very similar structural characteristics (ketoprofen), has more than 80% similar IR spectra (figure 2.). High degree of overlapping spectra with ketoprofen (because newly synthesized compound and ketoprofen on molecular level are different for only one -CH3 group) could be sign of identical structure (monosubstituted and disubstituted benzene and keto functional groups). The spectra of new molecule and ketoprofen are different in area of adsorption of carboxylic group. This is because of introduction of CH3 group in synthesized compound intramolecular hydrogen bonds appear. These bonds make band wider in selected area, but in ketoprofen absence of hydrogen bonds causes appearance of relatively sharp band by around 3500 cm-1 which is characteristic for –OH group.
Figure 1. IR spectrum of synthesized molecule [2-(4-benzoylphenyl)-2-methylpropanoic acid] 2268
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Figure 2. IR spectrum of ketoprofen and synthesized molecule [2-(4-benzoylphenyl)-2-methylpropanoic acid] Discussion Cause of rheumatoid arthritis is unknown. In etiology of disease, there are many factors. It could include infectious agents, metabolic disorders, emotional stresses, genetic and endocrinal factors and immunological actions. As sources of rheumatoid arthritis, some researchers include viruses, Diphtheroids, microplasma, Erysipelothrix and Proteus mirabilis, but real evidence for infectious etiology of disease still missing, because until now, by bacteriological research it is not found or proofed “clean” infectious agent in blood, synovial liquid or synovial tissue. Described cases of diseases by patients’ relatives in identical twins do not confirm clearly genetic base for rheumatoid arthritis. Immunologic system on antigens (bacteria, parts of its structures, lonely molecules or groups of molecules) reacts in way that it initiates lymphocytes B and lymphocytes T, which have different roles. Lymphocytes B are responsible for humoral immune response because they create antibodies and release them in blood. Lymphocytes T cause reaction of later irresponsiveness, as rheumatoid knots, and cooperate with lymphocytes B by creation of specific antibodies.The antibodies are attached to antigen creating immunocomplexes. Because this process is managed by antigen, immunologic reaction is on going until antigen is in the body in free form. In the base of immunological reaction is antibody or immunoglobulin, of them IgG, IgA, IgM, IgD and IgE are known, but IgG and IgM only are involved in rheumatoid arthritis pathogenesis. In case of IR spectra of organic molecules, it is known that energy adsorption of particular areas of electromagnetic radiance excites molecules in different ways. Radiance in infrared part of spectrum match to the energy which makes molecular vibrations (deformation-bending and stretching of bonds). Recording radiance adsorption (when sample is disposed to IR radiance) gets IR spectrum. Record of adsorption goes from left to right dependent on lowering frequency. The atoms in molecule vibrate in different ways but always on quant energetic levels. Energies of growing vibrations of organic molecules match infrared radiance with wave numbers between 1200 and 4000 cm-1. That part of spectrum is often called area of functional groups. Presence of particular adsorb bend in functional group area is 2269
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
almost certainly indication for presence some functional group in studied compound. Area below 1600 cm-1 contains usually many peaks (bends). They mostly match to the deformation vibrations of molecule. That part of spectrum is known as “fingerprint”, typical for every compound. By analysis of IR spectrum of synthesized molecule [2-(4-benzoylphenyl)-2-methyl-propanoic acid] it is remarkable that spectra are different in area of adsorption carboxylic group because after introduction of -CH3 group in synthesized compound there comes to the appearance of intramolecular hydrogen bonds. Conclusion By analysis of IR spectrum i.e. appearance of wide bend of 2-(4-benzoylphenyl)-2-methylpropanoic acid in interval of 2500 cm-1 to 3600 cm-1, concludes analyzed compound contains carboxylic group (-COOH). Presence of aromatic vibrations on 692 cm-1 and 774 cm-1 confirms presence of monosubstituted and disubstituted aromatic ring. Also, presence of two intense and sharp bends on 1698 cm-1 i 1774 cm-1 indicate presence of keto (>CO) functional group. Yielded compound has methyl groups and has IR bends in area of “fingerprint” by 1350 cm-1 to 1450 cm-1. These bends are feature of band deformation with methyl group. Results above confirm the structure of synthesized compound because the synthesized compound as newly created compound compared to the compound with very similar structural properties (ketoprofen) has more than 80% similar IR spectra. High degree of overlying spectra with ketoprofen (newly synthesized compound and ketoprofen differ only for one CH3 group on molecular level) shows presence of identical structure (monosubstituted and disubstituted benzene and keto functional groups). Spectra of [2-(4-benzoylphenyl)-2-methylpropanoic acid] and ketoprofen differ in area of adsorption of carboxylic group for the reason that introduction of CH3 group in synthesized compound intramolecular hydrogen bonds appear. These bonds extend bend in that area, but in ketoprofen hydrogen bonds are missing causing appearance of relatively sharp bend by approx. 3500 cm-1 which is characteristic for –OH group as a part of carboxylic group. 2270
References
1. Costa D., Moutinho L., Lima J.L, Fernandes E (2006) Antioxidant activity and inhibition of human neutrophil oxidative burst mediated by arylpropionic acid non-steroidal anti- inflammatory drugs. Biol Pharm ;29(8): 1659-1670. 2. Cram D.J., Hammond G.S, (1973) Sinteze, Organska kemija, Skolska knjiga Zagreb:264. 3. Cekovic Z, (1982) Aromaticne supstitucione reakcije, Principi Organske sinteze,Naucna knjiga Beograd: 252-278. 4. Davis N.M.,McLachlan A.J.,Day R.O., Williams K. M.,(2000) Clinical pharmaco-kinetics and pharmacodynamics of celecoxib, a selective cyclooxygenase-2-inhibitor. Clin. Pharmacokinet. 38:225-242. 5. Ebringer A., Wilson C., Ahmadi K., (1993) Rheumatoid arthritis as a reactive arthritis to proteus infection: prospect for therapy. in Machtey I: Progressin rheumatology V; 75. 6. Elton T.S, Simmons D.L, (2002) COX-3, a cyclooxygenase-1 variant inhibited by acetaminophen and other analgesic/antipyretic drugs: cloning,structure, and expression. Proc Natl Acad Sci U S A 99: 13926-13931. 7. Haricharan Raju C.M, Naga Lakshimi P, Srinivas Ch, Om. Reddy G, Acharyulu Palle VR (2005): A Green Chemistry Approach to Ibuprofen Piconol, Synthetic Communications, 35: 209-212. 8. Jajic I., Jajic Z., Jajic I., (1988) Neke epidemioloske karakteristike reumatoidnog artritisa. Zbornik plenarnih predavanja i rezimea radova X. kongresa reumatologa Jugoslavije, Beograd; 234. 9. Janjic I., (1995) Reumatoidni artritis, Reum-atologija, Medicinska knjiga Zagreb:10-13. 10. J. vet. Pharmacol. Therap. (2004) Modeling and allometric scaling of s(+)-ketoprofen pharmacokinetics and pharmacodynamics: Antiinflammatory drugs 27: 211–218. 11. Johnsen J, Magnus L, Frida P , Pettersen I, Elfman L, Orrego A, Sveinbjörnsson B, Kogner P (2006) Cyclooxygenase-2 Is Expressed in Neuroblastoma, and Nonsteroidal Anti-Inflammatory Drugs Induce Apoptosis and Inhibit Tumor Growth In vivo. American Association for Cancer Research 64: 7210-7215.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
12. Morrison RT, Boyd RN. (1974) Organska hemija, Mir, Moskva: 596. 13. Nesmejanov AH, Nesmejanov HA. (1974) principi organske hemije II, Himija, Moskva: 494. 14. Stuart B. (2004) Infrared Spectroscopy: Fundamentals and Applications John Wiley & Sons: Ltd ISBNs: 0-470-85427-8. 15. 15. Volmer M . (2001) Infrared spectroscopy in clinical chemistry, using chemometric calibration techniques, Proefschrift Groningen. ISBN 90367-1485. 16. Stanley H. Pine (1994) Friedel-Craftsovo aciliranje, IR spektroskopija Organska kemija, Skolska knjiga, Zagreb: 654-657,1096. 17. Sycha T, Gustorff B, Lehr S, Tanew A, Eichler HG, Schmetterer L (2003) A simple pain model for the evaluation of analgesic effects of NSAIDs in healthy subjects, Br J Clin Pharmacol,56: 165–172. 18. Pehlic E, ar all. Identification of synthesized 2-(4-benzoylphenyl)-2-methyl propionic acid by thin layer chromatography in the system ethylacetate-cyclohexane and benzene-cyclohexene.HealthMED 2010; 4: 867 – 878. 19. Pehlic E, ar all. Synthesis control of 2-(4-benzoylphenyl)-2-methyl propanoic acid by TLC in diethyl ether-cyclohexane and petroleumether – ethylacetate system. HealthMED 2011; 5: 413-418. 20. Straus B, Stavljnic –Rukavina A, Plavsic F (1997) Apsorpcija u Infracrvenom (IR) spektru, Analiticke tehnike u klinickom laboratoriju:61-63. Corresponding author Pehlic Ekrem, University of Bihac, Biotechnical Faculty, Bosnia and Herzegovina, E-mail; pehlic_ch@yahoo.com
Journal of Society for development in new net environment in B&H
2271
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Maxillary Tuberosity Fracture as a PostOperative Complication - Case study
Naida Hadziabdic1, Sanja Komsic2, Halid Sulejmanagic3
1 2 3
Department of Oral Surgery Faculty of Dental Medicine, University of Sarajevo Bosnia and Herzegovina, Faculty of Dental Medicine, University of Sarajevo Bosnia and Herzegovina, Private dental practice “Sulejmanagic” Sarajevo Bosnia and Herzegovina.
Abstract A maxillary tuberosity fracture is a rare complication which poses a serious surgical and prosthetic problem. The fracture is observed during extraction as the whole tuberosity is shifted together with forceps and the tooth. With regard to the size of the fractured bone fragment three degrees of fracture can be distinguished: mild fracture, moderate fracture and severe fracture. Maxillary tuberosity fracture can seriously affect both the complete and partial dentures because it disturbs the static of the prosthetic work, but it is equally important in terms of forensic medicine wherein it is considered as grave body injury. The aim of this paper is to present a case of maxillary tuberosity fracture from our own dental practice and report on the diagnostic-therapeutic protocol we applied. The paper is also focused on ways to prevent the emergence of tuberosity fracture in everyday practice of a general dental practicioner. This paper presents a case of the maxillary tuberosity fracture from our dental practice. The diagnostic and therapeutic protocol has been described in detail with a particular emphasis on the application of routine sutures as a means of immobilization. Three months after the fracture the extraction was carried our surgically without damaging the tuberosity. It was our primary objective and the desired outcome for the patient. In the final paragraph of the present paper we present a set of conclusions in regard of maxillary tuberosity fracture as a potential complication during the extraction of maxillary molars. It is possible to prevent such a complication if a dentist exercises high caution.Once the fracture has occurred it is 2272
necessary to consider all immobilization options in order to enable its healing. If a fracture occurs, the patient should be immediately informed, given first aid and referred to a specialist unit. Key words: tuberosity fracture, complication, immobilization 1. Introduction Maxillary tuberosity fracture is a rare complication which poses a serious surgical and prothetic problem. The tuberosity fracture may occur due to inadequate application of elevator (luxation of the wisdom tooth distally), deep thrust of forceps and utilization of rough force, extraction of the isolated upper molars with the pneumatized alveolar process (second and third molar), but also during the extraction of impacted teeth, and in cases of ankylosis of a first and second molar with the bone, anomalies of roots of the upper molars, in gemination, conscrescence, multiple traumas of the face and jaws etc. Diagnosis of tuberosity fracture. The tuberosity fracture can be obserevd during the extraction as the whole tuberosity is shifted together with forceps and the tooth.The diagnosis is made on the basis of clinical examination and x-ray film. The deformity can be observed on further inspection. The fracture line can be palpated from the buccal or palatinal side, but it is also seen on the x-ray film. The soft tissue can be lacerated. Also, due to the injury of blood vessels, the emergence of haematoma on the palatinal side is also possible. Ordinarily, in case of tuberosity fracture the sinus is opened so that all signs common for this specific complication are also noticeable.
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
With regard to the size of the fractured bone fragment three degrees of fracture can be distinguished: 1. Mild/small tuberosity fracture (along the extracted molar a small portion of the adherent bone fragment of the tuberosity adjacent to the root is attached). 2. Moderate/medium tuberosity fracture (along the extracted molar a greater part of the adherent tuberosity is attached, covering the area adjacent to the root, but also wider). 3. Severe/ catastrophic tuberosity fracture (the fracture line entails a great part of the tuberosity and the adjacent tissue pterygoid plate, blood vessels and muscles) (1). The serious complications resulting from the maxillary tuberosity fracture have been reported earlier.In his book 'Dental Extraction' Coleman cited Cattlin's work dating from 1858 where a case of the maxillary tuberosity fracture was reported, resulting in deafness due to the disruption of the pterygoid hamulus and m.tensor veli palatini muscle, and this in turn damaged the Eustachian tube. As a result, the patient was left with a permanent reduction of mandibular movements caused by the injury of the pterygoid muscle and ligaments (2). Dissections of cadaver skulls at the Guy Campus Medical School in London have shown that the structure of bones and muscle attachments in the area of the maxillary tuberosity and lateral pterygoid plate can vary greatly. The examination of cases of grave fracture have shown the distance between the maxillary tuberosity and the initial part of the lateral pterygoid plate to be relatively small which is a predisposing factor for a comprehensive fracture in such cases (3). The important consequences of maxillary tuberosity fracture are as follows: 1. Prosthetic: The loss of tuberosity has a number of undesirable consequences in respect of prosthetic works: the foundation of the complete denture is disturbed; because of the impossibility of extension of the free saddle of partial denture, the pressure on the remaining integument is increased which, under certain conditions, can cause the pathological impact of the denture on the supporting tissue. In either case the static of the prothetic work is disturbed.
2. Forensic: Maxillary tuberosity fracture is considered a serious body injury. From the viewpoint of forensic medicine the process of assessing incapacity percentage varies, depending on skeletal deformities and a degree of dysfunction. In the case of tuberosity fracture the degree of incapacity is assessed in the range of 10 to 30% with a gradual 1% increase with each lost tooth, and 1, 5% for the first permanent molar (4). Tuberosity fracture is treated on a case to case basis because in the overall therapeutic procedure several factors must be taken into consideration such as age and general health condition of a patient, a toothache prior to extraction, whether the sinus was open or not, and also the overall condition of the remaining alveolar process, a degree of the fractured bone, the presence of antagonists etc. In general, three treatment procedures are applied: 1. Surgical removal of the tooth and fractured tuberosity. 2. Surgical extraction of the tooth by careful detachment from the bone. 3. Immobilization and fixation of the fractured tuberosity together with the bone. 2. Aim The aim of the present paper is to report a case of the maxillary tuberosity fracture from our dental practice with a review of the diagnostic-therapeutic protocol and a set of recommendations to prevent its occurence in everyday practice of a general dental practicioner. 3. Case report 3.1 First visit The patient came to the Dental Surgery Clinic of the Faculty of Dental Medicine to have the tooth No 27 extracted. During medical examination we learned that the said patient did not succeed in having the tooth extracted in a local dental surgery. Thereafter the patient brought an independent de2273
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
cision to contact the Oral surgery Clinic of the Faculty of Dental Medicine. Following the extraoral examination a haematoma with the two-centimeter diameter in the area of the lower edge of the mandible without any other specific features was observed (Figure 1). The haematoma could be accounted for by the attempted tooth extraction undertaken by the general dental practicioner from the local dental surgery who had failed to complete the extraction. A close intraoral examination enabled us to observe a significant asymetry of the upper left quadrant in relation to the right one in a sense of the enlarged palatinal alveolar ridge, while no changes in the vestibular part could be observed. The mucosa in the tuberosity area was of a slightly changed colour, free of disruption, and of soft consistence on palpation (in a sense of haematoma or oedema). No x-ray film had been made.
Therapy: The sutures were placed over the tooth No. 27 in order to immobilize it (Figure 2), a panoramic radiogram (Panorex) and the retro alveolar x-ray of the 25-27 area and also the x-ray of the para nasal sinuses were indicated as necessary. Ampicillin antibiotic in the 500mg dosage (4x2) was administered. Cold compression wraps were recommended and an analgesic if necessary, along with C vitamin tablets (2x1) and soft food.
Figure 2. Immobilization of tuberosity fracture with sutures 3.2 First check-up The first check-up was arranged two days after the first visit. The patient complained of shivering and feeling faint, but not of the loss of appetite. The haematoma on the cheek had receded. The patient did not complain of nose bleeding. The Panorex showed a fracture line in the maxillary tuberosity area mesially fom the tooth No 27 (Figure 3). On the PNS (para nasal sinuses) x-ray film the obscuration of the left maxillary sinus was visible confirming our suspicion of haematosinus (Figure 4). The retroalveolar x-ray film showed the existence of the fracture line. Definitive diagnosis: The analysis of the Panorex, PNS and retroalveolar x-ray films has confirmed our tentative diagnosis. Therapy: After consulting the maxillofacial surgeon regarding the maxillary tuberosity fracture it was decided to postpone the extraction of
Figure 1. Haematoma of the left cheek. Tentative diagosis: On the basis of clinical examination under local anaestesia the following diagnosis was made: Dg: Status post tentaminem extractionis dentis 27 cum fractura tuberis maxillae suspecta. With regard to the patient’s allegation of bleeding from the left nostril there was also a suspicion of: Haematosinus l. sin and Haemathoma buccae l sin. 2274
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
27 tooth until the formation of the bone callus. It was also decided to continue with the prescribed therapy and regular check-ups prior to the surgical extraction of the tooth.
3.4 Check-up after one month After one month a control PNP X-ray was made which showed the normal transparency of both maxillary sinuses confirming the complete regression of the haematoma (Figure 5). On the control Panorex film no significant differences could be observed in relation to the Panorex film made on the day of fracture. On examination an insignificant pathological moveability of the tuberosity was established. The patient was referred to come for a control check-up in three months’ time following the day of fracture.
Figure 3. Enlarged detail from the Panorex film where the fracture line can be observed.
Figure 5. Paranasal sinuses x-ray film one month later with the observable transparency of both maxillary sinuses. 3.5 Surgical extraction of tooth three months after fracture Figure 4. X-ray film of paranasal sinuses with the visible obscuration of the left sinus. 3.3 Further check-ups Further check-ups confirmed the regression of symptoms. The sutures were removed ten days after their placement while the antibiotic therapy was administered for ten days. Three months after the tuberosity fracture a decision was made to extract the teeth No 27 and 25 surgically in accordance with the following procedures: Under local anaesthesia incision was made following Peter Nowak’s procedure, and the mucoperiosteal flap was raised. By applying a sharp fissure borer the roots of the second upper left maxillary molar were separated, and each of them was extracted separately with tender rotating extraction movements (Figure 6). In a trauma-free 2275
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
manner, and with prior minimal corticotomy the second upper premolar was extracted. After treating the edges of the extraction wounds by flame shape carbide burr, the mucoperiosteal flap was lowered, adjusted to the deficiency and stiched up.
Figure 6. Separation of roots of the second molar 4. Discussion A maxillary tuberosity is thought to be more predisposed to fracture if the maxillary sinus has enlarged between the teeth and into tuberosity so creating thin bony walls in the dentoalveloar system. Dental anomalies of the maxillary molars may also be contributory including tooth fusion, tooth isolation, ankylosis, hypercementosis, chronic periapical infection and roots which are widely divergent. If a big risk of fracture during extraction is thought, surgical extraction of teeth is strongly recommended (5,6,7). In the retrospective analysis on the sample of 1213 patients, Christiaens et al. report that the incidence of complications in the upper jaw during extraction of third molars under local anaestesia is 1,5% , while under general anaestesia it is 2%. The most common complications in the upper jaw are tuberosity fracture and the creation of oro-antral communication. Understandibly, the complications were more common in cases when the dental surgeon had less experience, the patient was older and the tooth was set deeper in its foundation (8). 2276
All the predisposing factors contributing to tuberosity fracture have been reported in the literature, but dental malpractice has not been mentioned too often. In reporting their case Hidayet et al. refer to this particular problem. They report a careless and sloppy work on part of dentists. From the medical card they learned that the dentist did not fix the alveolar ridge in the area of the molar which was extracted.Besides, the general dental practicioner applied great thrust without fixing the ridge and, as a result, he had trouble to extract the tooth (9). At this point we would like to draw a comparison with the abovementioned case study and assert that in our case carelessness was also one of the etiological factors since the morphological features contributing to the maxillary tuberosity fracture were not observed by the general dental practicioner in the local surgery. On top of this, the patient was sent home without any explanation as to the nature of the complication or referral to a specialist. Our case has proved that the maxillary tuberosity fracture resulting in the enlargement of the maxillary sinus can also occur in younger patients with the relatively well preserved teeth. This in turn justifies our claim that the ensuing complication was caused by the rough and careless work of the general dental practicioner.Complications in everyday dental practice are a common occurence, but the duty of a practising dental practicioner is to recognize them and provide a clear and precise explanation to the patient. Resolving basic complications in oral surgery practice is the remit of every general dental practicioner and if he/she disposes of the necessary material his/her duty is to give first aid to a patient and refer him to a specialist unit. In our case, we had to address the emerged complication. We believe that the careful assessment of the gravity of extraction and potential complications is of inestimable importance for a successful intervention. Careful separation of roots,being in the remit of a general dental practicioner, is vital for a successful completion of ‘’difficult extractions’’, and, more importantly, it is a way to prevent serious complications such as maxillary tuberosity fracture. Maxillary tuberosity fracture does not only occur during extraction of second and third molars but also of the upper first molar according to available literature. Fixation of the alveolar ridge
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
is certainly a recommended procedure. In case of complications resulting from routine dental interventions a patient must be referred to a specialist. The application of simple fixation techniques reduces further progression, serious complications and the patient’s trouble, enhancing at the same time the healing procees (9). In our case the tuberosity fracture could not be observed in the first routine examination.Only after the application of forceps on the tooth No 27 did it become clear that at the attempted luxation toward the vestibule the whole maxillary tuberosity was being shifted with plenty of dark blood oozing from the maxillary sinus. Furthermore, it also became clear that the continuation of extraction would lead to the damage of the whole tuberosity. The greatest dilemma we were faced with was whether and in what manner to perform immobilization.The decision to perform immobilization in the simplest possible manner by applying sutures proved in the long run to be most effective since it enabled the healing of the tuberosity and prevention of invalidity. The fracture of a great portion of the bone in the maxillary tuberosity area is a condition of exceptional gravity. The big fractures of maxillary tuberosity present great complications. The major therapeutic objective is to save the fractured bone in situ and create the best possible conditions for its healing (10). The surgical extraction of the tooth and the tuberosity must be performed when the tooth had ached prior to extraction and when there is no possibility for the tuberosity to tether with the tissue of the upper jaw.If the fractured part of the tuberosity is smaller, or if the tooth was symptomatic in the moment of fracture, most authors consider that it must not be left in situ, the only solution being the removal of the tooth along with a part of the tuberosity (6, 11). If the alveolar segment is avulsed and detached from the mucoperiosteal lobe, there is a great likelihood it will not heal if left untreated. All tuberosity fractures do not necessarily fall under this cathegory.The avulsed bone must be slowly released from the remaining soft tissue with periosteal elevator. A big oro-antral fistula is inevitable in this situation.However, in view of a loss of the supporting bony substance, ordinarily there remains enough of the soft tissue to enable its normal closure (12).
If it is thought that there is a possibility of tethering of the tuberosity to the bone, the tooth should carefully be extracted by separating its roots or both its crown and roots, simultaneously fixing the tuberosity with wire ligatures or splint. Ngeow defends the conservative approach in big maxillary tuberosity fractures presenting an alternative method whereby a tooth is firmly gripped with molar forceps, resulting in the stabilisation of the fractured segment, and after that, by using Coupland periosteal elevator the alveolar bone is separated from the roots of the tooth, thus reducing a further progression of the fracture line (13). If a tooth was not painful but the patient came for routine treatment but, nevertheless, there occurs the maxillary tuberosity fracture the immobilisation and fixation of both the tooth and tuberosity should be performed. Clinical dental surgeons should inform a patient of potential complications and advantages of various treatment procedures before a final decision on tretament is reached.The experience of Hidayet and his associates is that an attempt should be made to save the big fractures, but on the other hand, immediate removal of the small particles of tuberosity around one or two teeth is a better choice in case of small fractures due to difficulties with regard to saving the bone. (9). The routine treatment of a big tuberosity fracture involves the stabilisation of the mobile portions of the bone by the application of rigid fixation techniques in the duration of 4-6 weeks. The surgical extraction may be attempted once the healing process has successfully been completed. If a tooth is infected and the symptoms of inflammation visible in the moment of fracture, extraction should proceed by separating the gingival attachment and removing the smallest possible portion of the bone with the aim of avoiding the separation of the tuberosity from the periosteum. In case of the failure of the separation attempt resulting in the removal of the infected tooth with the adjacent tuberosity , tissues must be closed with interrupted sutures in order to prevent oro-antral communication. If a tooth does not show the attending signs of infection or puss content, a surgeon my attempt the application of an autogene graft (14). In our case we applied the routine interrupted sutures to immobilize the fractured tuberosity to2277
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
gether with the tooth. Considering that we did not have any complications prior to the definitive solution, i.e. the surgical extraction of the tooth after three months, this simple therapeutic approach proved to be very effective. As mentioned earlier, the extraction was performed surgically, the tuberosity was preserved intact and that was ultimately our aim and the best outcome for the patient. 5. Conclusions Maxillary tuberosity fracture should be considered as a potential complication during the extraction of maxillary molars. Most fractures are preventable by the application of a careful, trauma-free extraction technique followed by the ridge stabilization and separation of roots which is in the remit of general dental practitioners. In tuberosity fracture all options of its fixation should be considered aimed at enabling its tethering. A patient must be informed about the tuberosity fracture, given first aid and referred to a specialist unit for treatment. References
1. Exodontia.info [homepage on the Internet]. United Kingdom: John Doran [updated 2010 August.; cited 2010 November 22]. Available from: http:// www.exodontia.info/FracturedTuberosity/html/. 2. Coleman F. Extraction of teeth. pp 76. London: H.K. Lewis, 1908. In Cattlin W. A paper on the form and size of the adult antrum and on the diagnosis and treatment of inflammation of the lining membrane. Tr Odont Soc 1858; 2: 31–46. 3. Shah N, Bridgman JB. An extraction complicated by lateral and medial pterygoid tethering of a fractured maxillary tuberosity. Br Dent J 2005;198:543-4. 4. Brkic H. Doktor stomatologije u sluzbi sudskog vjestaka. Hrvatska komore dentalne medicine [serial on the Internet] 2010 November [cited 2010 November 22]. Available from: http://www.hkdm. hr/?page=vjesnik,97,100. 5. Howe GL. Minor oral surgery. 3rd ed. pp 118–121. London: Wright, 1985.
6. Norman JE, Cannon PD. Fracture of the maxillary tuberosity. Oral Surg Oral Med Oral Pathol. 1967;24:459–467. 7. Altonen M, Rantanen AV. Factors increasing the risk of fracture of the maxillary tuberosity during tooth extraction. Pro Finn Den Soc 1976; 72(5):163–169. 8. Christiaens I, Reychler H. Complication after third molar extractions: retrospective analysis of 1,213 teeth. Rev Stomatol Chir Maxillofac. 2002;103(5): 269-74. 9. Hidayet B. Polat, Sinan Ay, M. Isa Kara. Maxillary Tuberosity Fracture Associated with First Molar Extraction: A Case Report. Eur J Dent. 2007;1(4):256–259. 10. Peterson LJ. Prevention and management of surgical complications. In: Peterson LJ, Ellis E III, Hupp JR, Tucker MR, editors. Contemporary Oral and Maxillofacial Surgery. 3. St Louis: Mosby Year Book, Inc;1998.p.261. 11. Hardman EG. Surgical emergencies in the dental office. Int Dent J. 1984;34:245–248. 12. Ward-Booth P, Hausaman J-E, Schendel S, editors. Maxillofacial Surgery. Edinburgh: Churchill Livingstone, 1999, 1591-1610. 13. Ngeow WC. Management of the fractured maxillary tuberosity: an alternative method. Quintessence Int. 1998;29:189–190. 14. Fonseca RJ. Oral and Maxillofacial Surgery. Pennsylvania: W.B. Saunders. 2000;Vol.1: 430. Corresponding author Naida Hadziabdic, Faculty of Dental Medicine, University of Sarajevo, Bosnia and Herzegovina, E-mail: nsulejma@yahoo.com
2278
Journal of Society for development in new net environment in B&H
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Instructions for the authors
All papers need to be sent to e-mail: healthmedjournal@gmail.com
Every sent magazine gets its number, and author(s) will be notified if their paper is accepted and what is the number of paper. Every corresponedence will use that number. The paper has to be typed on a standard size paper (format A4), leaving left margins to be at least 3 cm. Ali materials, including tables and references, have to be typed double-spaced, so one page has no more than 2000 alphanumerical characters (30 lines). Sent paper needs to be in the form of triplicate, considering that original one enclosure of the material can be photocopied. Presenting paper depends on its content, but usually it consists of a page title, summary, text references, legends for pictures and pictures. Type your paper in MS Word and send if on a diskette or a CD-ROM. TITLE PAGE Every article has to have a title page with a title of no more than 10 words: name (s), last and first of the author (s), name of the instituion the authors (s) belongs to, abstract with maximum of 45 letters (including space), footnote with acknowledgments, name of the first author or another person with whom correspondence will be maintained. SUMMARY Second page needs to contain paper summary, 200 words at the most. Summary needs to hold all essential facts of the work-purpose of work, used methods (with specific data, if possible) and basic facts. Summaries must have review of underlined data, ideas and conclusions from text. Summary has no quoted references. For key words, at the most, need to be placed below the text. CENTRAL PART OF THE ARTICLE Authentic papers contain these parts: intro-duction, goal, methods, results, discussion and conclusion. Introduction is brief and clear review of a problem. Methods are shown so that interested reader is able to repeat described research. Known methods don’ t need to be identified, it is cited (referenced). Results need to be shown clearly and legically, and their significance proven by statistical analysis. In discussion, results are interpreted and compared to existing, previously published findings in the same field. Conclusions have to give an answer to author’s goal. REFERENCES Quoting references must be in a scale in which they are really used. Quoting most recent literature is recommended. Only published articels (or articles accepted for publishing) can be used as references. Not-published observations and personal notifications need to be in text in brackets. Showing references is as how they appear in text. References cited in tables or pictures are also numbered according to quoting order. Citing paper with six or less authors must have cited names of all authors; if seven or more authors’ wrote the paper, the name of the first three authors are cited with a note “et all”. If the author is unknown, at the beginning of papers reference, the article is named as “unknown”. Titles of the publications are abbreviated in accordance to Index Medicus, but if not listed in the index, whole title of the journal has to be written. Footnote-comments, explanations, etc., cannot be used in the paper. STATISTICIAL ANALYSIS Tests used for statistical analysis need to be shown in text and in tables or pictures containing statistical analysis. TABLES AND PICTURES Tables have to be numbered and shown by their order, so they can be understood without having to read the paper. Every column needs to have title, every measuring unit (SI) has to be clearly marked, preferably in footnotes below the table, in Arabian numbers or symbols. Pictures also have to be numbered as they appear in text. Drawings need to be enclosed on a white paper or tracing paper, while black and white photo have to be printed on a radiant paper. Legends next to pictures and photos have to be written on a separate A4 format paper. All illustrations (pictures, drawings, diagrams) have to be original and on their backs contain illustration number, first author last name, abbreviated title of the paper and picture top. It is appreciated if author marks the place for table or picture. Preferable the pictures format is TIF, quality 300 DPI. USE OF ABBREAVIATIONS Use of abbreviations has to be reduced to minimum. Conventional units can be used without their definitions.
Journal of Society for development in new net environment in B&H
2279
HealthMED - Volume 5 / Number 6 - Suppl. 1 / 2011
Uputstvo za autore
Svaki upućeni časopis dobija svoj broj i autor(i) se obavještavaju o prijemu rada i njegovom broju. Taj broj koristit će se u svakoj korespondenciji. Rukopis treba otipkati na standardnoj veličini papira (format A4), ostavljajući s lijeve strane marginu od najmanje 3 cm. Sav materijal, uključujući tabele i reference, mora biti otipkan dvostrukim proredom, tako da na jednoj strani nema više od 2.000 alfanumeričkih karaktera (30 linija). Rad treba slati u triplikatu, s tim da original jedan prilog materijala može biti i fotokopija. Način prezentacije rada ovisi o prirodi materijala, a (uobičajeno) treba da se sastoji od naslovne stranice, sažetka, teksta, referenci, tabela, legendi za slike i slika. Svoj rad otipkajte u MS Wordu i dostavite na disketi ili kompakt disku Redakcijskom odboru, čime će te olakšati redakciju vašeg rada. NASLOVNA STRANA Svaki rukopis mora imati naslovnu stranicu s naslovom rada ne više od 10 riječi: imena autora; naziv ustanove ili ustanova kojima autori pripadaju; skraćeni naslov rada s najviše 45 slovnih mjesta i praznina; fusnotu u kojoj se izražavaju zahvale i/ili finansijska potpora i pomoć u realizaciji rada, te ime i adresa prvog autora ili osobe koja će s Redakcijskim odborom održavati i korespondenciju. SAžETAK Sažetak treba da sadrži sve bitne činjenice rada-svrhu rada, korištene metode, bitne rezultate (sa specifičnim podacima, ako je to moguće) i osnovne zaključke. Sažeci trebaju da imaju prikaz istaknutih podataka, ideja i zaključaka iz teksta. U sažetku se ne citiraju reference. Ispod teksta treba dodati najviše četiri ključne riječi. SAžETAK NA BOSANSKOM JEzIKU Prilog radu je i prošireni struktuirani sažetak (cilj), metode, rezultati, rasprava, zaključak) na bosanskom jeziku od 500 do 600 riječi, uz naslov rada, inicijale imena i prezimena auora te naziv ustanova na engleskom jeziku. Ispod sažetka navode se ključne riječi koje su bitne za brzu identifikaciju i klasifikaciju sadržaja rada. CENTRALNI DIO RUKOPISA Izvorni radovi sadrže ove dijelove: uvod, cilj rada, metode rada, rezultati, rasprava i zaključci. Uvod je kratak i jasan prikaz problema, cilj sadrži kratak opis svrhe istraživanja. Metode se prikazuju tako da čitaoci omoguće ponavljanje opisanog istraživanja. Poznate metode se ne navode nego se navode izvorni literaturni podaci.
Sve rukopise treba slati na e-mail adresu healthmedjournal@gmail.com
Rezultate treba prikazati jasno i logički, a njihovu značajnost dokazati odgovarajućim statističkim metodama. U raspravi se tumače dobiveni rezultati i uspoređuju s postojećim spoznajama na tom području. Zaključci moraju odgovoriti postavljenom cilju rada. REFERENCE Reference treba navoditi u onom obimu koliko su stvarno korištene. Preporučuje se navođenje novije literature. Samo publicirani radovi (ili radovi koji su prihvaćeni za objavljivanje) mogu se smatrati referencama. Neobjavljena zapažanja i lična saopćenja treba navoditi u tekstu u zagradama. Reference se označavaju onim redom kako s pojavljuju u tekstu. One koje se citiraju u tabelama ili uz slike također se numeriraju u skladu s redoslijedom citiranja. Ako se navodi rad sa šest ili manje autora, sva imena autora treba citirati; ako je u citirani članak uključeno sedam ili više autora, navode se samo prva tri imena autora s dodatkom “et al”. Kada je autor nepoznat, treba na početku citiranog članka označiti “Anon”. Naslovi časopisa skraćuju se prema Index Medicusu, a ako se u njemu ne navode, naslov časopisa treba pisati u cjelini. Fusnote–komentare, objašnjenja, itd. Ne treba koristiti u radu. STATISTIčKA ANALIzA Testove koji se koriste u statističkim anaizama treba prikazivati i u tekstu i na tabelama ili slikama koje sadrže statistička poređenja. TABELE I SLIKE Tabele treba numerirati prema redoslijedu i tako ih prikazati da se mogu razumjeti i bez čitanja teksta. Svaki stubac mora imati svoje zaglavlje, a mjerne jedinice (SI) moraju biti jasno označene, najbolje u fusnotama ispod tabela, arapskim brojevima ili simbolima. Slike također, treba numerisati po redoslijedu kojim se javljaju u tekstu. Crteže treba priložiti na bijelom papiru ili paus papiru, a crno-bijele fotografije na sjajnom papiru. Legende uz crteže i slike treba napisati na posebnom papiru formata A4. Sve ilustracije (slike, crteži, dijagrami) moraju biti originalne i na poleđini sadržavati broj ilustracije, prezime prvog autora, skraćeni naslov rada i vrh slike. Poželjno je da u tekstu autor označi mjesto za tabelu ili sliku. Slike je potrebno dostavljati u TIFF formatu rezolucije 300 DPI. KORIšTENJE KRATICA Upotrebu kratica treba svesti na minimum. Konvencionalne SI jedinice mogu se koristiti i bez njihovih definicija.
2280
Journal of Society for development in new net environment in B&H